Traditional Herbal Plant Research Articles

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Platycladus orientalis Leaf Extract Promotes Hair Growth via Non-Receptor Tyrosine Kinase ACK1 Activation.

Platycladus orientalis is a traditional oriental herbal medicinal plant that is widely used as a component of complex prescriptions for alopecia treatment in Eastern Asia. The effect of PO on hair growth and its underlying mechanism, however, have not been demonstrated or clarified. In this study, we investigated the hair-growth-promoting effect of PO in cultured human dermal papilla cells (hDPCs). Platycladus orientalis leaf extract (POLE) was found to stimulate the proliferation of hDPCs. POLE with higher quercitrin concentration, especially, showed a high level of cellular viability. In the context of cellular senescence, POLE decreased the expression of p16 (CDKN2A) and p21(CDKN1A), which resulted in enhanced proliferation. In addition, growth factor receptors, FGFR1 and VEGFR2/3, and non-receptor tyrosine kinases, ACK1 and HCK, were significantly activated. In addition, LEF1, a transcription factor of Wnt/β-catenin signaling, was enhanced, but DKK1, an inhibitor of Wnt/β-catenin signaling, was downregulated by POLE treatment in cultured hDPCs. As a consequence, the expression of growth factors such as bFGF, KGF, and VEGF were also increased by POLE. We further investigated the hair-growth-promoting effect of topically administered POLE over a 12-week period. Our data suggest that POLE could support terminal hair growth by stimulating proliferation of DPCs and that enhanced production of growth factors, especially KGF, occurred as a result of tyrosine kinase ACK1 activation.

Bioactive Natural Leads and Traditional Herbal Plants in the Management of Inflammatory Bowel Diseases: A Brief Review

: Inflammatory bowel disease is a chronic relapsing disorder that causes chronic inflammation and ulcers in the GIT. Depending upon the location, ulcerative colitis and Crohn's disease come under IBD. The exact etiology of IBD is still unknown. Over 8 lakhs of people were affected by inflammatory disease yearly, and the death rate increased daily. Depending upon the severity of the disease, JAK inhibitors, anti-TNF agents, and immunosuppressants can be used to manage ulcerative colitis and Crohn's disease. However, these treatments have been associated with harmful adverse effects, which cannot be ignored. To treat inflammatory diseases safely, various herbal medicines and their bioactive are preferred as game changers. Recently, the effectiveness of herbal plants has been recommended as the treatment against IBD, as shown by various in vivo models and clinical trials. The various herbal plants reported in the literature include gallic acid, lupeol, and curcumin aloe vera. This review focused on medicinal plants' anti-inflammatory, antioxidant, and anti-ulcer properties. Over 1.2 million healthcare practitioners are using herbal bioactive and have the advantages of lower side effects. Therefore, it is estimated that in Europe, the demand for plant-based products/formulations has risen by millions in 2020, showing the current position of herbal-based products in consumer health awareness.

Anti- Leishmanial activity of a traditional Indian herbal plant agave Vivipara

Infection due to protozoa of the Genus Leishmania are a major world wide health problem with high endemicity in developing countries. Visceral leishmaniasis commonly called Kala azar which is caused by an intracellular parasite Leishmania donovani. This disease may be fatal when left untreated . In the present study, In vitro anti- leishmanial activitiy of Ethyl acetate , Methanolic , Benzene, and Chloroform extracts of Agave vivipara have been evaluated . Among those extracts Ethyl acetate of Agave vivipara shows effective antileishmanial activity against promastigote form of leishmanial donovani. Saponins present in Agave vivipara which may be responsible for inhibition the growth of parasites. It was found that IC 50 = 300 ?g /ml( 50% inhibition at 300 ?g /ml) and IC90 =400 ?g /ml ( complete inhibition at 400 ?g /ml). . KEYWORDS :Visceral leishmaniasis, Agave vivipara ,Leishmania donovani,

Anti- Leishmanial activity of a traditional indian herbal plant Chenopodium ambrosioides

The existing antileishmanial drugs for complete cure of visceral leishmaniasis( Kala azar) are limited The available drugs are either toxic or less effective leading to disease relapse or conversion to postkala ?azar dermal leishmaniasis Several herbal extracts have been shown to have antileishmanial activity... In the present study, In vitro anti- leishmanial activitiy of Ethanolic ,Methanolic , Benzene, and Chloroform extracts of Chinopodiumambrosioides have been evaluated . Among those extracts ethanolic extract of Chinopodiumambrosioides shows effective antileishmanial activity against promastigote form of leishmanial donovani. ascoridole present in C.ambrosioides which may be responsible for inhibition the growth of parasites. It was found that IC 50 = 150 ?g /ml( 50% inhibition at 150 ?g /ml) and IC90 =200 ?g /ml (complete inhibition at 200?g /ml).. KEYWORDS :Visceral leishmaniasis, Chinopodium ambrosioides,Leishmaniadonovani,

Norisoboldine, a Natural Alkaloid from Lindera aggregata (Sims) Kosterm, Promotes Osteogenic Differentiation via S6K1 Signaling Pathway and Prevents Bone Loss in OVX Mice.

Norisoboldine (NOR) is a major isoquinoline alkaloid component in the traditional Chinese herbal plant Lindera aggregata (Sims) Kosterm, with previously reported anti-osteoclast differentiation and antiarthritis properties. However, the roles of NOR on osteoblasts, bone marrow mesenchymal stem cells (BMSCs), and osteoporosis in vivo have never been well established. This study investigates the ability of NOR to improve bone formation in vitro and in vivo. Osteoblasts and BMSCs are used to study the effect of NOR on osteogenic and adipogenic differentiation. It finds that NOR promotes osteogenic differentiation of osteoblasts and BMSCs, while inhibiting adipogenic differentiation of BMSCs by reducing the relative expression of peroxisome proliferator-activated receptorγ (Ppar-γ) and adiponectin, C1Q and collagen domain containing (Adipoq). Mechanistic studies show that NOR increases osteoblast differentiation through the mechanistic target of rapamycin kinase (mTOR)/ribosomal protein S6 kinase; polypeptide 1 (S6K1) pathway, and treatment with an mTOR inhibitor rapamycin blocked the NOR-induced increase in mineral accumulation. Finally, the study evaluates the therapeutic potential of NOR in a mouse model of ovariectomy (OVX)-induced bone loss. NOR prevents bone loss in both trabecular and cortical bone by increasing osteoblast number and phospho-S6K1 (p-S6K1) expression in osteoblasts. NOR effects in enhancing osteoblast-induced bone formation via S6K1 pathway, suggesting the potential of NOR in osteoporosis treatment by increasing bone formation.

A Review Study on Traditional Herbal Medicines of Bangladesh against Different Skin Disorders

Traditional herbal medicines (THM) are used by almost 75%–80% of the people in Bangladesh to treat various types of skin diseases. This review includes ethnobotanical data as well as relevant scientific studies on plants used in traditional medicine in Bangladesh to treat various types of skin disorders like inflammatory skin disorders, viral infections, bacterial infections, fungal infections, parasitic infections, pigmentation disorders, skin cancers, trauma and other skin disease conditions. Using specified key phrases, information on the traditional herbal medicinal plants of Bangladesh that are effective against various skin ailments was collated from several electronic databases such as PubMed, Google Scholar, Web of Science, Scopus, ScienceDirect, Springer and others. A total of 45 relevant publications were investigated, providing complete information on 221 distinct herbal plant species belonging to 73 families utilised by the diverse peoples of Bangladesh for the treatment of skin problems. The most often utilised plant organ in this study was leaves, followed by roots, fruits, entire plants, barks, seeds, stems, rhizomes and flowers. The Asteraceae family has the most species, whereas in terms of plant habit, herbs have the most species. Azadirachta indica, Curcuma longa, Vitex negundo, Aegle marmelos, Allium sativum and Lawsonia inermis are the most commonly utilised species. This research might be used as a beginning point for a systematic search for natural herbal remedies to treat skin diseases in Bangladesh’s flora.

Variations in Cold Resistance and Contents of Bioactive Compounds among Dendrobium officinale Kimura et Migo Strains.

Dendrobium officinale is a valuable traditional Chinese herbal plant that is both medicinal and edible. However, the yield of wild Dendrobium officinale is limited. Adverse stress affects the growth, development, and yield of plants, among which low temperature is the primary limiting factor for introducing Dendrobium officinale to high-latitude areas and expanding the planting area. Therefore, this study aims to explore the variations in growth ability, cold resistance, and contents of bioactive compounds among different Dendrobium officinale strains. Four strains of Dendrobium officinale were selected as experimental materials and were subjected to low-temperature stress (4 °C). The agronomic traits, physiological indices, as well as the expressions of cold resistance-related genes (HSP70, DcPP2C5, DoCDPK1, and DoCDPK6) in the roots and leaves of Dendrobium officinale, were determined. The contents of bioactive compounds, including polysaccharides, flavonoids, and phenols were also measured. Compared with the other strains, Xianju had the highest seed germination and transplantation-related survival rates. Under low-temperature stress, Xianju exhibited the strongest cold resistance ability, as revealed by the changes in water contents, chlorophyll levels, electrical conductivities, enzyme activities, and expressions of the cold resistance-related genes. Additionally, the polysaccharide content of Xianju increased the most, while the stem flavonoid and leaf phenol contents were elevated in all four strains under cold treatment. Therefore, selecting excellent performing strains is expected to expand the planting area, improve the yield, and increase the economic benefits of Dendrobium officinale in high latitude areas with lower temperatures.

Effect of dietary supplementation Ampelopsis grossedentata extract on growth performance and muscle nutrition of Megalobrama hoffmanni by gut bacterial mediation

Nowadays, Megalobrama hoffmanni is a typical cultured fish in south China due to its resource decline in the Pearl River. Meanwhile, since antibiotics had been banned internationally, Chinese medical herbal plant serving as alternative to antibiotics has been adopted in aquaculture. In the present study, to ensure the health growth of M. hoffmanni, extract of traditional medical herbal plant Ampelopsis grossedentata was dietary supplemented and a series experiments were performed, including growth performance determination, physiological/biochemical detection, nutrition analysis, histology analysis, and 16S rRNA amplicon sequencing. Growth performance enhancement was determined since the weight gain rate (WGR), specific growth rate (SGR), and condition factor (CF) of M. hoffmanni increased as feeding inclusion A. grossedentata extract. Interestingly, the total content of muscle fatty acids ascended via supplementing A. grossedentata extract at middle level, in which group the activities of superoxide dismutase (SOD) and catalase (CAT) significantly increased and thus retarded the lipid peroxidation process (manifesting as malondialdehyde (MDA) content rising). Additionally, immune response and inflammatory reaction was stimulated in low and high level A. grossedentata extract added groups, indicating a suitable dosage of A. grossedentata extract benefited in safety production. Moreover, gut microbiota community varied hugely as daily supplementation A. grossedentata extract and the keystone species were tightly related to lipid transformation, which ultimately led to fatty acids composition variation. Our results confirmed that dietary supplementation A. grossedentata extract at the middle level (0.5‰, w/w) is suitable for serving as feed additive in healthful aquaculture of M. hoffmanni.

Genome-Wide Analysis of Aux/IAA Gene Family in Artemisia argyi: Identification, Phylogenetic Analysis, and Determination of Response to Various Phytohormones.

Artemisia argyi is a traditional herbal medicine plant, and its folium artemisia argyi is widely in demand due to moxibustion applications globally. The Auxin/indole-3-acetic acid (Aux/IAA, or IAA) gene family has critical roles in the primary auxin-response process, with extensive involvement in plant development and stresses, controlling various essential traits of plants. However, the systematic investigation of the Aux/IAA gene family in A. argyi remains limited. In this study, a total of 61 Aux/IAA genes were comprehensively identified and characterized. Gene structural analysis indicated that 46 Aux/IAA proteins contain the four typical domains, and 15 Aux/IAA proteins belong to non-canonical IAA proteins. Collinear prediction and phylogenetic relationship analyses suggested that Aux/IAA proteins were grouped into 13 distinct categories, and most Aux/IAA genes might experience gene loss during the tandem duplication process. Promoter cis-element investigation indicated that Aux/IAA promoters contain a variety of plant hormone response and stress response cis-elements. Protein interaction prediction analysis demonstrated that AaIAA26/29/7/34 proteins are possibly core members of the Aux/IAA family interaction. Expression analysis in roots and leaves via RNA-seq data indicated that the expression of some AaIAAs exhibited tissue-specific expression patterns, and some AaIAAs were involved in the regulation of salt and saline-alkali stresses. In addition, RT-qPCR results indicated that AaIAA genes have differential responses to auxin, with complex response patterns in response to other hormones, indicating that Aux/IAA may play a role in connecting auxin and other hormone signaling pathways. Overall, these findings shed more light on AaIAA genes and offer critical foundational knowledge toward the elucidation of their function during plant growth, stress response, and hormone networking of Aux/IAA family genes in A. argyi.

Effect of Syzygium cumini on Oxidative Stress Induced Cardiac Cellular Anomalies.

Doxorubicin (Dox), an antineoplastic agent is used as a primary anticancerous drug against various types of cancers. However, its associated toxicity to the cardiovascular system is major. Literature has recorded the cases of mortality due to poor validation and lack of prediagnosis of Dox-induced cardiotoxicity. Therapeutic interventions using natural products having cardioprotective properties with low toxic outcomes hold therapeutic potential for future cardio-oncological therapies. Syzygium cumini (Black berry), a traditional Indian herbal plant, has been researched and found to exert cardioprotective, anti-inflammatory, and antioxidant activities, which have been credited due to the presence of polyphenols, flavonoids, and tannins. In the current research, we investigated the cardioprotective potential of Syzygium cumini against Doxorubicin-induced cardiotoxicity (DIC) in H9C2 cardiomyocytes. Methanolic seed extract preparation of Syzygium cumini was performed using the Soxhlet apparatus. Cell viability and cell death assays were performed to determine the cardiotoxic doses of Doxorubicin. Furthermore, the cardioprotective potential of Syzygium cumini extract against DIC was studied. Morphological and nuclear alterations in H9C2 cells were studied by microscopic assays using Giemsa, Haematoxylin-Eosin stain, and PI. The intracellular stress level and ROS production were studied using DCFH-DA followed by mitochondrial integrity analysis using fluorescent microscopic methods. In the results, we investigated that Dox exerted a dose and time-dependent cardiotoxicity on H9C2 cardiomyocytes. Moreover, we observed that morphological and nuclear alterations caused by doxorubicin in dose-dependent manner were prevented by supplementing with Syzygium cumini polyphenols and it attenuated the oxidative stress in H9C2 cardiomyocytes effectively. Conclusively, Syzygium cumini possesses cardioprotective potential in H9C2 cardiomyocytes in dox-induced cardiotoxicity.

Identification and characterization of a novel Cytorhabdovirus associated with goji berry (Lycium barbarum L.) crinkle disease.

Goji berry (Lycium barbarum L.) is a traditional Chinese herbal medicinal plant that is extensively cultivated in the arid and semiarid regions of northwest China. In this study, a novel cytorhabdovirus, tentatively named "goji cytorhabdovirus A (GCVA)," was identified from the goji berry plant exhibiting leaf crinkle symptoms through high-throughput sequencing (HTS). GCVA contains a linear, negative sense single-stranded RNA genome of 14,812 nucleotides and encodes six open reading frames in the order of 3' leader-N-P-P4-M-G-L-5' trailer. The genome of GCVA shares the highest nucleotide (nt) identity of 65.80% (16% query coverage) with yerba mate virus A (YmVA) (NC_076472). The N and L proteins also share low amino acid (aa) identities (<35.42 and < 41.23%, respectively) with known cytorhabdoviruses. Typical features of the viruses in the genus Cytorhabdovirus include a highly conserved consensus sequence in the intergenic regions and extensive complementation of the 5' non-coding trailer and the 3' leader. These features were also found in GCVA. These data in combination with a phylogenetic analysis that was based on the aa sequences of the N and L proteins support the proposal that GCVA is a new species in the genus Cytorhabdovirus.

Effectiveness of plant-based hand sanitizer incorporating Quercus infectoria gall extract.

Quercus infectoria (Qi), a traditional herbal plant with broad-spectrum of activities on multidrug-resistant bacteria has been develop as hand sanitizer applications. Antimicrobial activity was evaluated using agar-well diffusion and broth microdilution method. Bactericidal activity was determined following the European Standard 1276 antibacterial suspension test. Neutralization assay was performed to assess anti-respiratory syncytial virus. Safety, stability, and skin permeation of Qi hand gel was investigated. Qi hand sanitizer gel inhibited microorganisms ranging from 99.9-99.999% against Enterococcus faecalis, Staphylococcus aureus, methicillin-resistant S. aureus, S. epidermidis, S. pseudintermedius, S. saprophyticus, Streptococcus pyogenes, Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, Pseudomonas aeruginosa, and Candida albicans. A significant reduction in main human dermatophytes including Microsporum canis, Microsporum gypseum, and Talaromyces marneffei of approximately 50% was observed (p<0.05). Qi hand sanitizer gel inactivated more than 99% viral particles entering human laryngeal epidermoid carcinoma cells in a dose-dependent manner. Scanning electron micrographs further illustrated that Qi hand sanitizer gel disrupted microbial cell membrane after 1-min contact time resulting in cell death. Qi hand sanitizer gel delivered emollient compounds through simulated human skin layers and showed no cytotoxicity on fibroblast cells. Moreover, Qi hand sanitizer gel demonstrated stability under extreme conditions. Qi hand sanitizer gel was able to inhibit various microorganisms including bacteria, dermatophytes, and virus.

Nutritional Value, Volatile Components, Functional Metabolites, and Antibacterial and Cytotoxic Activities of Different Parts of Millettia speciosa Champ., a Medicinal and Edible Plant with Potential for Development.

Highly nutritious traditional plants which are rich in bioactive substances are attracting increasing attention. In this study, the nutritional value, chemical composition, biological activities, and feed indices of different parts of Millettia speciosa were comprehensively evaluated. In terms of its nutritional value, this study demonstrated that the leaves, flowers and seeds of M. speciosa were rich in elements and amino acids; the biological values (BVs) of these ingredients ranged from 85% to 100%, showing the extremely high nutritional value of this plant. GC-MS analysis suggested that the main chemical components of the flower volatile oil were n-hexadecanoic acid (21.73%), tetracosane (19.96%), and pentacosane (5.86%). The antibacterial activities of the flower and seed extracts were significantly stronger than those of the leaves and branches. The leaf extract displayed the strongest antifungal activities (EC50 values: 18.28 ± 0.54 μg/mL for Pseudocryphonectria elaeocarpicola and 568.21 ± 33.60 μg/mL for Colletotrichum gloeosporioides) and were the least toxic to mouse fibroblasts (L929) (IC50 value: 0.71 ± 0.04 mg/mL), while flowers were the most toxic (IC50 value: 0.27 ± 0.03 mg/mL). In addition, the abundance of fiber, protein, mineral elements, and functional metabolite contents indicated the potential applicability of M. speciosa as an animal feed. In conclusion, as a traditional herbal plant used for medicinal and food purposes, M. speciosa shows potential for safe and multifunctional development.

New dammarane-type triterpenoids from hydrolyzate of total Gynostemma pentaphyllum saponins with protein tyrosine phosphatase 1B inhibitory activity

Protein tyrosine phosphatase 1B (PTP1B) is a key factor and regulator of glucose, lipid metabolism throughout the body, and a promising target for treatment of type 2 diabetes mellitus (T2DM). Gynostemma pentaphyllum is a famous oriental traditional medicinal herbal plant and functional food, which has shown many beneficial effects on glucose and lipid metabolism. The aim of the present study is to assess the inhibitory activity of five new and four known dammarane triterpenoids isolated from the hydrolysate product of total G. pentaphyllum saponins. The bioassay data showed that all the compounds exhibited significant inhibitory activity against PTP1B. The structure-activity relationship showed that the strength of PTP1B inhibitory activity was mainly related to the electron-donating group on its side chain. Molecular docking analysis suggested that its mechanism may be due to the formation of competitive hydrogen bonding between the electron-donating moiety and the Asp48 amino acid residues on the PTP1B protein.

Sirtuin1 Mediates the Protective Effects of Echinacoside against Sepsis-Induced Acute Lung Injury via Regulating the NOX4-Nrf2 Axis.

Currently, the treatment for sepsis-induced acute lung injury mainly involves mechanical ventilation with limited use of drugs, highlighting the urgent need for new therapeutic options. As a pivotal aspect of acute lung injury, the pathologic activation and apoptosis of endothelial cells related to oxidative stress play a crucial role in disease progression, with NOX4 and Nrf2 being important targets in regulating ROS production and clearance. Echinacoside, extracted from the traditional Chinese herbal plant Cistanche deserticola, possesses diverse biological activities. However, its role in sepsis-induced acute lung injury remains unexplored. Moreover, although some studies have demonstrated the regulation of NOX4 expression by SIRT1, the specific mechanisms are yet to be elucidated. Therefore, this study aimed to investigate the effects of echinacoside on sepsis-induced acute lung injury and oxidative stress in mice and to explore the intricate regulatory mechanism of SIRT1 on NOX4. We found that echinacoside inhibited sepsis-induced acute lung injury and oxidative stress while preserving endothelial function. In vitro experiments demonstrated that echinacoside activated SIRT1 and promoted its expression. The activated SIRT1 was competitively bound to p22 phox, inhibiting the activation of NOX4 and facilitating the ubiquitination and degradation of NOX4. Additionally, SIRT1 deacetylated Nrf2, promoting the downstream expression of antioxidant enzymes, thus enhancing the NOX4-Nrf2 axis and mitigating oxidative stress-induced endothelial cell pathologic activation and mitochondrial pathway apoptosis. The SIRT1-mediated anti-inflammatory and antioxidant effects of echinacoside were validated in vivo. Consequently, the SIRT1-regulated NOX4-Nrf2 axis may represent a crucial target for echinacoside in the treatment of sepsis-induced acute lung injury.

In vivo anti-inflammatory activity, safety and gene expression profiles of Carissa edulis, Withania somnifera, Prunus africana and Rhamnus prinoides for potential management of rheumatoid arthritis

IntroductionRheumatoid arthritis (RA) is a chronic, inflammatory and systemic autoimmune disease. Treatment for RA is aimed at eliminating symptoms, slowing disease progression, and optimizing quality of life. However, drugs currently in use are associated with adverse side effects. Search for alternative treatment for rheumatoid arthritis involves traditional herbal plants owing to the fewer side effects and more compatibility with long-term usage compared to the conventional drugs. The use of the selected medicinal plants to manage RA among local communities in Kenya is rife. This study sought to establish the safety and effectiveness of Carissa edulis, Withania somnifera, Prunus africana and Rhamnus prinoides aqueous extracts in the management and treatment of RA. MethodLambda IV Carrageenan was used to induce inflammation and the percentage inhibition calculated, gene expression of IL-6, TNF-α and IL-4 was evaluated using Real Time Polymerase Chain Reaction and acute oral and sub-acute toxicity was assessed in Swiss albino mice. ResultsC. edulis, W. somnifera, P. africana and R. prinoides showed a dose dependent anti-inflammatory activity, there was also a downregulation of TNF-α and IL-6 and upregulation expression of IL-4. Acute toxicity showed no mortality or significant changes in body weight and behavioral parameters at a cut-off dosage of 2000 mg/kg of the plant's extracts. The sub-acute toxicity also confirmed no toxic effects as evidenced by the hematological parameters and weekly change in body weights of mice. ConclusionThis study confirms potential application of these medicinal plants in RA management and act as a lead in drug development.

Evaluation of Substitution of Stem Bark with Small Branches of Stereospermum Chelonoides DC and Quantitative Estimation of Lapachol by HPLC

Background: Stereospermum chelonoides DC, also known as padhri, is a medicinal plant that belongs to the Bignoniaceous family and is commonly used in herbal medicine. Natural materials separated from a variety of traditional herbal plants have been claimed to had a significant impact on the development of numerous lead compounds used in the treatment of health issues in communities all over the world. The plant stem bark and small branches is used in traditional and folklore medicine to treat a variety of ailments. The aim of this study is to assess the Pharmacognostic and physicochemical analysis of Stereospermum chelonoides stem bark and small branches. The stem is used for the study of characters; whereas physicochemical parameters such as pH, total ash content, acid insoluble ash, water soluble extractive, alcohol soluble extractive, loss on drying are determined. Results: Preliminary phytochemical studies of ethanolic and aqueous extract of Stereospermum chelonoides DC ascertained the presence of flavonoids, saponins, Coumarins, Alkaloids, Furanoids, phenolic, Quinones, Reducing sugars, Sugars (Carbohydrate), triterpenoids, and tannins. The findings of the present study lay down standards which could be useful to detect the authenticity and for detailed evaluation and investigation of this plant. Lapachol which is indicated in the High Performance Liquid Chromatography, further studies may be conducted on the method validation by High Performance Liquid Chromatography to quantify in formulations, extracts and raw materials for quality control purpose. Conclusion: The stem bark and small branches of this plant useful in the future as it will not have any harmful effect to the plant so its small branches are more important than stem bark in the formulation of drugs which will derive from Stereospermum chelonoides DC

Genome-Wide Analysis of the bHLH Gene Family in Loropetalum chinense var. rubrum: Identification, Classification, Evolution, and Diversity of Expression Patterns under Cultivation.

The basic helix-loop-helix (bHLH) transcription factor family is the second-largest transcription factor family in plants. Members of this family are involved in the processes of growth and development, secondary metabolic biosynthesis, signal transduction, and plant resistance. Loropetalum chinense var. rubrum is a critical woody plant with higher ornamental and economic values, which has been used as ornamental architecture and traditional Chinese herbal medicine plants. However, the bHLH transcription factors in Loropetalum chinense var. rubrum (L. chinense var. rubrum) have not yet been systematically demonstrated, and their role in the biosynthesis of anthocyanin is still unclear. Here, we identified 165 potential LcbHLHs genes by using two methods, and they were unequally distributed on chromosomes 1 to 12 of the genome of L. chinense var. rubrum. Based on an evolutionary comparison with proteins from Arabidopsis and Oryza sativa, these bHLH proteins were categorized into 21 subfamilies. Most LcbHLHs in a particular subfamily had similar gene structures and conserved motifs. The Gene Ontology annotation and Cis-elements predicted that LcbHLHs had many molecular functions and were involved in processes of plant growth, including the biosynthesis of flavonoids and anthocyanins. Transcriptomic analysis revealed different expression patterns among different tissues and cultivars of L. chinense var. rubrum. Many LcbHLHs were expressed in the leaves, and only a few genes were highly expressed in the flowers. Six LcbHLHs candidate genes were identified by bioinformatics analysis and expression analysis. Further Real-time quantitative PCR analysis and protein interaction network analysis showed that LcbHLH156, which is one of the candidate proteins belonging to the IIIf subfamily, could interact with proteins related to anthocyanin synthesis. Therefore, LcbHLH156 was transiently expressed in L. chinense var. rubrum to verify its function in regulating anthocyanin synthesis. Compared with the control group, red pigment accumulation appeared at the wound after injection, and the total anthocyanin content increased at the wound of leaves. These results lay a foundation for the research of the regulation mechanism of leaf colors in L. chinense var. rubrum and also provide a basis for the function of the LcbHLH family.

Natural product osthole can significantly disrupt cell wall integrity and dynamic balance of Fusarium oxysporum

Dendrobium officinale Kimura et Migo is a traditional Chinese herbal medicinal plant. However, the frequent occurrence of soft rot disease (SRD) is one of the most harmful diseases in D. officinale production in recent years, which can seriously affect its yield and quality. In this study, the major pathogenic fungus (SR-1) was isolated from D. officinale with typical symptoms of SRD, and was identified as Fusarium oxysporum through morphological and molecular identification. The biological activities of five natural products were determined against F. oxysporum using a mycelial growth inhibition assay. The results showed that osthole had the highest antifungal activity against F. oxysporum, with an EC50 value of 6.40 mg/L. Scanning electron microscopy (SEM) showed that osthole caused F. oxysporum mycelia to shrink and deform. Transmission electron microscopy (TEM) showed that the organelles were blurred and the cell wall was thickened in the presence of osthole. The sensitivity of F. oxysporum to calcofluor white (CFW) staining was significantly enhanced by osthole. Relative conductivity measurements and propidium iodide (PI) observation revealed that osthole had no significant effect on the cell membrane. Further experiments showed that the activity of chitinase and β-1,3-glucanase were decreased, and expression levels of chitinase and β-1,3-glucanase related genes were significantly down-regulated after treatment with osthole. In conclusion, osthole disrupted the cell wall integrity and dynamic balance of F. oxysporum, thereby inhibiting normal mycelial growth.