Nucleic Acid Vaccines Research Articles

Identification of a Potential mRNA-based Vaccine Candidate against the SARS-CoV-2 Spike Glycoprotein: A Reverse Vaccinology Approach.

The emergence of the novel coronavirus (SARS‐CoV‐2) in December 2019 has generated a devastating global consequence which makes the development of a rapidly deployable, effective and safe vaccine candidate an imminent global health priority. The design of most vaccine candidates has been directed at the induction of antibody responses against the trimeric spike glycoprotein of SARS‐CoV‐2, a class I fusion protein that aids ACE2 (angiotensin‐converting enzyme 2) receptor binding. A variety of formulations and vaccinology approaches are being pursued for targeting the spike glycoprotein, including simian and human replication‐defective adenoviral vaccines, subunit protein vaccines, nucleic acid vaccines and whole‐inactivated SARS‐CoV‐2. Here, we directed a reverse vaccinology approach towards the design of a nucleic acid (mRNA‐based) vaccine candidate. The “YLQPRTFLL” peptide sequence (position 269–277) which was predicted to be a B cell epitope and likewise a strong binder of the HLA*A‐0201 was selected for the design of the vaccine candidate, having satisfied series of antigenicity assessments. Through the codon optimization protocol, the nucleotide sequence for the vaccine candidate design was generated and targeted at the human toll‐like receptor 7 (TLR7). Bioinformatics analyses showed that the sequence “UACCUGCAGCCGCGUACCUUCCUGCUG” exhibited a strong affinity and likewise was bound to a stable cavity in the TLR7 pocket. This study is therefore expected to contribute to the research efforts directed at securing definitive preventive measures against the SARS‐CoV‐2 infection.

Nucleic Acids for Potential Treatment of Rheumatoid Arthritis.

Rheumatoid arthritis (RA) is a common systemic inflammatory autoimmune disease that severely affects the life quality of patients. Current therapeutics in clinic mainly focus on alleviating the development of RA or relieving the pain of patients. The emerging biological disease-modifying antirheumatic drugs (DMARDs) require long-term treatment to achieve the expected efficacy. With the development of bionanotechnology, nucleic acids fulfill characters as therapeutics or nanocarriers and can therefore be alternatives to combat RA. This review summarizes the therapeutic RNAs developed through RNA interference (RNAi), nucleic acid aptamers, DNA nanostructures-based drug delivery systems, and nucleic acid vaccines for the applications in RA therapy and diagnosis. Furthermore, prospects of nucleic acids for RA therapy are intensively discussed as well.

Overview of COVID-19 Vaccine Development Strategy

Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) was identified as the cause of coronavirus disease 20019 (COVID19) pandemic which first emerged in December 2019 in Wuhan city, China. Currently, a vaccine is urgently needed to control the COVID-19 pandemic. Several vaccine candidates are under development and some are in the final stage of clinical trials. The COVID-19 vaccination aims to reduce morbidity and mortality rates, achieve herd immunity to prevent and protect the society, strengthen the health system, maintain productivity and minimize social and economic impacts. Before approval, vaccines have to undergo several clinical trials to ensure its safety profile, efficacy, duration of immune system resistance, and adverse effect. Various strategies have been used in the development of vaccines including viral vector vaccines, nucleic acid vaccines, inactivated virus, live attenuated virus, subunit protein¸and virus-like particle vaccine. Each strategy has its own advantages and disadvantages.

Therapeutic DNA Vaccines against HPV-Related Malignancies: Promising Leads from Clinical Trials.

In 2014 and 2021, two nucleic-acid vaccine candidates named MAV E2 and VGX-3100 completed phase III clinical trials in Mexico and U.S., respectively, for patients with human papillomavirus (HPV)-related, high-grade squamous intraepithelial lesions (HSIL). These well-tolerated but still unlicensed vaccines encode distinct HPV antigens (E2 versus E6+E7) to elicit cell-mediated immune responses; their clinical efficacy, as measured by HSIL regression or cure, was modest when compared with placebo or surgery (conization), but both proved highly effective in clearing HPV infection, which should help further optimize strategies for enhancing vaccine immunogenicity, toward an ultimate goal of preventing malignancies in millions of patients who are living with persistent, oncogenic HPV infection but are not expected to benefit from current, prophylactic vaccines. The major roadblocks to a highly efficacious and practical product remain challenging and can be classified into five categories: (i) getting the vaccines into the right cells for efficient expression and presentation of HPV antigens (fusion proteins or epitopes); (ii) having adequate coverage of oncogenic HPV types, beyond the current focus on HPV-16 and -18; (iii) directing immune protection to various epithelial niches, especially anogenital mucosa and upper aerodigestive tract where HPV-transformed cells wreak havoc; (iv) establishing the time window and vaccination regimen, including dosage, interval and even combination therapy, for achieving maximum efficacy; and (v) validating therapeutic efficacy in patients with poor prognosis because of advanced, recurrent or non-resectable malignancies. Overall, the room for improvements is still large enough that continuing efforts for research and development will very likely extend into the next decade.

Nanotechnologies in Delivery of DNA and mRNA Vaccines to the Nasal and Pulmonary Mucosa.

Recent advancements in the field of in vitro transcribed mRNA (IVT-mRNA) vaccination have attracted considerable attention to such vaccination as a cutting-edge technique against infectious diseases including COVID-19 caused by SARS-CoV-2. While numerous pathogens infect the host through the respiratory mucosa, conventional parenterally administered vaccines are unable to induce protective immunity at mucosal surfaces. Mucosal immunization enables the induction of both mucosal and systemic immunity, efficiently removing pathogens from the mucosa before an infection occurs. Although respiratory mucosal vaccination is highly appealing, successful nasal or pulmonary delivery of nucleic acid-based vaccines is challenging because of several physical and biological barriers at the airway mucosal site, such as a variety of protective enzymes and mucociliary clearance, which remove exogenously inhaled substances. Hence, advanced nanotechnologies enabling delivery of DNA and IVT-mRNA to the nasal and pulmonary mucosa are urgently needed. Ideal nanocarriers for nucleic acid vaccines should be able to efficiently load and protect genetic payloads, overcome physical and biological barriers at the airway mucosal site, facilitate transfection in targeted epithelial or antigen-presenting cells, and incorporate adjuvants. In this review, we discuss recent developments in nucleic acid delivery systems that target airway mucosa for vaccination purposes.

De Novo Minimal Changes Disease Associated to Inoculation with Adenovirus Vector Vaccine (Sputnik V)

Due to the pandemic caused by the virus SARS-CoV-2, multiple therapeutic and preventive strategies have been developed in order to avoid its propagation. Vaccines have been proved to be the most efficient means to control the spread of COVID 19, which has prevented both massive admissions of critical patients to intensive care units and the collapse of the health system from happening. To the present day there are different tested vaccine platforms with adenovirus vectors, inactivated vaccines and nucleic acid vaccines, among others [1]. As the vaccination process moved forward around the globe, there has been a number of publications reporting on adverse renal events, which included case reports on Secondary Nephrotic Syndome derived from Minimal Changes Disease (MCD) after the application of both, nucleic acid (RNAm) and adenovirus vector vaccines. Case presentation: male patient presented with nephrotic syndrome without microhematuria and with renal dysfunction after the application of the second dose of SPUTNIK V vaccine, which is why a renal biopsy was carried out. Such biopsy reported it was a case of MCD, which had a complete remission after six weeks of oral corticosteroids.

Advances in the polymeric delivery of nucleic acid vaccines.

Nucleic acid vaccines, especially messenger RNA (mRNA) vaccines, display unique benefits in the current COVID-19 pandemic. The application of polymeric materials as delivery carriers has greatly promoted nucleic acid vaccine as a promising prophylactic and therapeutic strategy. The inherent properties of polymeric materials render nucleic acid vaccines with excellent in vivo stability, enhanced biosafety, specific cellular uptake, endolysosomal escape, and promoted antigen expression. Although polymeric delivery of nucleic acid vaccines has progressed significantly in the past decades, clinical translation of polymer-gene vaccine systems still faces insurmountable challenges. This review summarizes the diverse polymers and their characterizations and representative formulations for nucleic acid vaccine delivery. We also discussed existing problems, coping strategies, and prospect relevant to applications of nucleic acid vaccines and polymeric carriers. This review highlights the rational design and development of polymeric vaccine delivery systems towards meeting the goals of defending serious or emerging diseases.

Production of antiviral vaccines using a silkworm-baculovirus expression system

The outbreak of the new coronavirus (SARS-2) infection (COVID-19) in Wuhan, China, has become a global outbreak and continues to cause many deaths. Not only COVID-19, but the risk of pandemic continues to increase due to global environmental changes and globalization of human exchange and logistics. On the other hand, we are inadequately prepared for such unknown emerging infectious diseases, and dealing with viral infections has become one of the most important issues facing humanity. Vaccine based disease prevention is considered an ideal disease control strategy, especially for viral diseases for which there is no or little cure. New nucleic acid vaccines (mRNA and viral vector vaccines) are leading the way in the fight against COVID-19, but even today, the mainstream of vaccines are inactivated vaccines and live-attenuated vaccines. Subunit vaccines, in which some specific viral proteins of the pathogen are produced as recombinant proteins and used as vaccine antigens, have also been developed. On the other hand, many antigens that are difficult to produce in large quantities as recombinant proteins, such as the spike protein antigen of COVID-19 (the same antigen is also targeted by nucleic acid vaccines), have not yet been produced and developed. In this paper, we describe the development of a recombinant protein vaccine based on the silkworm insect factory, which has an advantage in the production of such difficult-to-express vaccine antigens.

Emerging Frontiers in Vaccine Development: A Review of Changing Paradigm

The technology behind vaccine development varies significantly from one vaccine to another depending on the time when the vaccine was first developed. Over the years, the vaccine innovation time has significantly shortened with the advancement of knowledge in the fields of molecular and cell biology, and discoveries in the field of biotechnology. The first vaccines created were tested in a kind of trial-and-error approach which sometimes had deadly side effects. These vaccines used either living, weakened, or completely dead pathogens. The use of whole pathogen vaccines was seen to be time consuming and unpredictable because even though it would cause an immune response, it could vary from person to person, and always had the risk of pathogens returning to virulence causing sometimes fatal outcomes. The next major technology used to create vaccines was subunit vaccines which utilize purified antigens inactivated through various methods. This technology is quite prevalent among the vaccines that are currently in circulation, making them quite effective, and free from fatal side effects. The viral vector vaccine technology has been around for a few decades and utilizes knowledge of molecular genetics to the greatest extent. It uses intermediate vectors to deliver genetic instructions to trigger an immune response within the subject body. The introduction of nucleic acid vaccines is the newest technology and has come to a great deal of attention during the SARS-CoV-2 immunization efforts. The technology primarily utilizes the delivery of genetic information using messenger ribonucleic acid (mRNA) to create characteristic pathogen-specific proteins that in turn generate an immune response in the recipients.

An Update on the Status of Vaccine Development for SARS-CoV-2 Including Variants. Practical Considerations for COVID-19 Special Populations.

The progress in the development of various vaccine platforms against SARS-CoV-2 have been rather remarkable owing to advancement in molecular and biologic sciences. Most of the current vaccines and those in development focus on targeting the viral spike proteins by generating antibodies of varying spectrum. These vaccines represent a variety of platforms including whole virus vaccines, viral vector vaccines, nucleic acid vaccines representing RNA, DNA, and their hybrid forms.The therapeutic efficacy of these vaccines varies owing to their pharmacodynamic individualities. COVID-19 variants are capable of inducing different pathologic responses and some of which may be resistant to antibodies generated by current vaccines. The current clinical use of these vaccines has been through emergency use authorization until recently. Moreover, the efficacy and safety of these vaccines have been tested in substantial numbers of individuals but studies in special populations that better reflect the global population are pending results. These specialized populations include young children, immunocompromised patients, pregnant individuals, and other specialized groups. Combination approaches, molecularly modified vaccination approaches, and vaccines conferring longer periods of immunity are being currently being investigated, as well as pharmacovigilance studies.The continual transformation of SARS-CoV-2 and its variants are of concern along with the breakthrough infections. These considerations pose new challenges for the development of vaccination platforms. For this purpose, booster doses, combination vaccine approaches, and other modalities are being discussed. This review provides an updated account of currently available vaccines and those in advanced development with reference to their composition and mechanisms of action.A discussion on the use of vaccines in special populations including immunocompromised patients, pregnant women and other specialized populations are also included.

Design and Preparation of Solid Lipid Nanoparticle (SLN)-Mediated DNA Vaccines.

Increasing application of nucleic acid vaccines is driving demand for new delivery systems to improve stability and efficacy of DNA vaccines. Solid lipid nanoparticles (SLN) are a particulate carrier system composed of a solid lipid core and a cationic lipid surface suitable for binding negatively charged DNA. SLN delivery systems can be used to bind DNA resulting in an SLN/DNA complex (termed "lipoplex") which can be used as a potential vaccine.In this chapter, the methodologies associated with the use of SLNs as a DNA vaccine nanocarrier are discussed. First, requirements for an effective experimental lipoplex vaccine are discussed along with current and historical examples. Then, flowcharts for design and synthesis of lipoplex vaccines are outlined, followed by detailed materials and methods for synthesis and characterization of lipoplex vaccines.

Vaccine Technologies and Platforms for Infectious Diseases: Current Progress, Challenges, and Opportunities.

Vaccination is a key component of public health policy with demonstrated cost-effective benefits in protecting both human and animal populations. Vaccines can be manufactured under multiple forms including, inactivated (killed), toxoid, live attenuated, Virus-like Particles, synthetic peptide, polysaccharide, polysaccharide conjugate (glycoconjugate), viral vectored (vector-based), nucleic acids (DNA and mRNA) and bacterial vector/synthetic antigen presenting cells. Several processes are used in the manufacturing of vaccines and recent developments in medical/biomedical engineering, biology, immunology, and vaccinology have led to the emergence of innovative nucleic acid vaccines, a novel category added to conventional and subunit vaccines. In this review, we have summarized recent advances in vaccine technologies and platforms focusing on their mechanisms of action, advantages, and possible drawbacks.

Potential Utility of Induced Translocation of Engineered Bacteria as a Therapeutic Agent for Mounting a Personalized Neoantigen-Based Tumor Immune Response.

Today, an unprecedented understanding of the cancer genome, along with major breakthroughs in oncoimmunotherapy, and a resurgence of nucleic acid vaccines against cancer are being achieved. However, in most cases, the immune system response is still insufficient to react against cancer, especially in those tumors showing low mutational burden. One way to counteract tumor escape can be the induction of bacterial translocation, a phenomenon associated with autoimmune diseases which consists of a leakage in the colonic mucosa barrier, causing the access of gut bacteria to sterile body compartments such as blood. Certain commensal or live‐attenuated bacteria can be engineered in such a way as to contain nucleic acids coding for tumor neoantigens previously selected from individual tumor RNAseq data. Hypothetically, these modified bacteria, previously administered orally to a cancer patient, can be translocated by several compounds acting on colonic mucosa, thus releasing neoantigens in a systemic environment in the context of an acute inflammation. Several strategies for selecting neoantigens, suitable bacteria strains, genetic constructs, and translocation inducers to achieve tumor‐specific activations of CD4 and CD8 T‐cells are discussed in this hypothesis.

Blocking T-cell egress with FTY720 extends DNA vaccine expression but reduces immunogenicity.

Optimal immunogenicity from nucleic acid vaccines requires a balance of antigen expression that effectively engages the host immune system without generating a cellular response that rapidly destroys cells producing the antigen and thereby limiting vaccine antigen expression. We investigated the role of the cellular response on the expression and antigenicity of DNA vaccines using a plasmid DNA construct expressing luciferase. Repeated intramuscular administration led to diminished luciferase expression, suggesting a role for immune‐mediated clearance of expression. To investigate the role of cell trafficking, we used the sphingosine 1‐phosphate receptor (S1PR) modulator, FTY720 (Fingolimod), which traps lymphocytes within the lymphoid tissues. When lymphocyte trafficking was blocked with FTY720, DNA transgene expression was maintained at a constant level for a significantly extended time period. Both continuous and staggered administration of FTY720 prolonged transgene expression. However, blocking lymphocyte egress during primary transgene administration did not result in an increase of transgene expression during secondary administration. Interestingly, there was a disconnect between transgene expression and immunogenicity, as increasing expression by this approach did not enhance the overall immune response. Furthermore, when FTY720 was administered alongside a DNA vaccine expressing the HIV gp140 envelope antigen, there was a significant reduction in both antigen‐specific antibody and T‐cell responses. This indicates that the developing antigen‐specific cellular response clears DNA vaccine expression but requires access to the site of expression in order to develop an effective immune response.

Hepatitis C virus DNA vaccines: a systematic review

BackgroundVaccination against HCV is an effective measure in reduction of virus-related public health burden and mortality. However, no prophylactic vaccine is available as of yet. DNA-based immunization is a promising modality to generate cellular and humoral immune responses. The objective of this study is to provide a systematic review of HCV DNA vaccines and investigate and discuss the strategies employed to optimize their efficacies.MethodsMEDLINE (PubMed), Web of Science, Scopus, ScienceDirect, and databases in persian language including the Regional Information Centre for Science & Technology (RICeST), the Scientific Information Database and the Iranian Research Institute for Information Science and Technology (IranDoc) were examined to identify studies pertaining to HCV nucleic acid vaccine development from 2000 to 2020.ResultsTwenty-seven articles were included. Studies related to HCV RNA vaccines were yet to be published. A variety of strategies were identified with the potential to optimize HCV DNA vaccines such as incorporating multiple viral proteins and molecular tags such as HBsAg and Immunoglobulin Fc, multi-epitope expression, co-expression plasmid utilization, recombinant subunit immunogens, heterologous prime-boosting, incorporating NS3 mutants in DNA vaccines, utilization of adjuvants, employment of less explored methods such as Gene Electro Transfer, construction of multi- CTL epitopes, utilizing co/post translational modifications and polycistronic genes, among others. The effectiveness of the aforementioned strategies in boosting immune response and improving vaccine potency was assessed.ConclusionsThe recent progress on HCV vaccine development was examined in this systematic review to identify candidates with most promising prophylactic and therapeutic potential.

COVID-19 Vaccines - A Narrative Review

Since the pandemic started, various clinical trials have been going on to develop COVID vaccines. Vaccines which have passed the clinical trials include live attenuated vaccines, inactivated vaccines, protein subunit vaccines, virus like particles vaccines, viral vector vaccines, and nucleic acid vaccines. There are several vaccines in phase III and IV trials, and more than ten vaccines have been approved or authorized. Most of these vaccines are efficacious and safe. However, there are various pros and cons of these vaccines. This review explains how these vaccines have been developed, their mechanism of action, advantages, and disadvantages of these vaccines, along with costing and post vaccination challenges. Keywords: Covid-19 vaccines, efficacy, safety, post-vaccination challenges.

Nucleic acid vaccines: A taboo broken and prospect for a hepatitis B virus cure

Although a prophylactic vaccine is available, hepatitis B virus (HBV) remains a major cause of liver-related morbidity and mortality. Current treatment options are improving clinical outcomes in chronic hepatitis B; however, true functional cure is currently the exception rather than the rule. Nucleic acid vaccines are among the emerging immunotherapies that aim to restore weakened immune function in chronically infected hosts. DNA vaccines in particular have shown promising results in vivo by reducing viral replication, breaking immune tolerance in a sustained manner, or even decimating the intranuclear covalently closed circular DNA reservoir, the hallmark of HBV treatment. Although DNA vaccines encoding surface antigens administered by conventional injection elicit HBV-specific T cell responses in humans, initial clinical trials failed to demonstrate additional therapeutic benefit when administered with nucleos(t)ide analogs. In an attempt to improve vaccine immunogenicity, several techniques have been used, including codon/promoter optimization, coadministration of cytokine adjuvants, plasmids engineered to express multiple HBV epitopes, or combinations with other immunomodulators. DNA vaccine delivery by electroporation is among the most efficient strategies to enhance the production of plasmid-derived antigens to stimulate a potent cellular and humoral anti-HBV response. Preliminary results suggest that DNA vaccination via electroporation efficiently invigorates both arms of adaptive immunity and suppresses serum HBV DNA. In contrast, the study of mRNA-based vaccines is limited to a few in vitro experiments in this area. Further studies are needed to clarify the prospects of nucleic acid vaccines for HBV cure.

A mini-review on the different types of covid-19 vaccines in use

Novel Coronavirus (Covid-19) is an infectious disease caused by Severe Acute Respiratory Syndrome Corona Virus 2 (SARS-CoV-2). It is a new strain that is identified newly in humans, which was originated in China in 2019. This virus spread from an infected person’s mouth or nose upon coughing, sneezing, speaking, or breathing. This is an ongoing global pandemic which increases day by day. The only solution to decrease the fatality caused by COVID-19 is vaccination. Vaccines are of different types. Vaccines get differed depending on the approach in designing them. Inactivated, live attenuated, and viral vector vaccines are made up of the whole microbe approach. Subunit vaccines are made up of the subunit approach. Nucleic acid vaccines are made up of nucleic acids. The present review has attempted to reveal the different types of vaccines used against COVID-19.

Nucleic Acid Vaccines for COVID-19: A Paradigm Shift in the Vaccine Development Arena

Coronavirus disease, COVID-19, has touched every country globally except five countries (North Korea, Turkmenistan, Tonga, Tuvalu and Nauru). Vaccination is the most effective method to protect against infectious diseases. The objective is to ensure that everyone has access to a COVID-19 vaccine. The conventional vaccine development platforms are complex and time-consuming to obtain desired approved vaccine candidates through rigorous regulatory pathways. These safeguards guarantee that the optimized vaccine product is safe and efficacious for various demographic populations prior to it being approved for general use. Nucleic acid vaccines employ genetic material from a pathogen, such as a virus or bacteria, to induce an immune response against it. Based on the vaccination, the genetic material might be DNA or RNA; as such, it offers instructions for producing a specific pathogen protein that the immune system will perceive as foreign and mount an immune response. Nucleic acid vaccines for multiple antigens might be made in the same facility, lowering costs even more. Most traditional vaccine regimens do not allow for this. Herein, we demonstrate the recent understanding and advances in nucleic acid vaccines (DNA and mRNA based) against COVID-19, specifically those in human clinical trials.

Strategies and Challenges in the Development of Coronavirus Disease-2019 Vaccine

The novel coronavirus infection (coronavirus disease-2019 (COVID-19)) emerged from Wuhan in the Hubei Province of China in late 2019. Millions of people were infected with COVID-19 pandemic due to the long incubation period of the virus inside the human body and the dearth of available treatments or vaccines. High transmission rates created havoc, which highlighted the urgent need for effective interventions to stop the spread and clinical impact of the virus on patients and populations. Previous research on severe acute respiratory syndrome coronavirus (SARS-CoV) provides information on vaccination strategies that could inform how governments approach the elimination of this novel coronavirus. Numerous efforts have been made to develop vaccines against Middle East respiratory syndrome (MERS) and SARS. The spike glycoprotein or S protein is the critical target for most of the drugs and vaccines against coronavirus. The virus uses the spike (S) protein for entering the host cell, by interacting with the receptor called angiotensin converting enzyme-2 (ACE2). Various vaccine platforms are available such as nucleic acid vaccine, protein-based vaccines, virus-vectored vaccines and live or attenuated vaccines, with each having their advantages and disadvantages. This review focuses on the overview of different vaccine candidates used, those currently in development, and the challenges encountered while developing effective vaccines.