Ideal Image Research Articles

‘Let the ladies know’: queer women’s perceptions of how gender and sexual orientation shape their eating and weight concerns

This exploratory study aimed to describe the lived experiences of queer women affected by eating and weight-related concerns. Qualitative data from young queer women (n = 105; Age = 23.6 ± 3.4 years) with eating and weight-related concerns in response to open-ended questions related to the influence of gender identity and body image on weight concern, behaviours, and perception were analysed using reflexive thematic analysis. Nine themes were created to describe participants’ experiences: (1) compensation for other internalised stigma, (2) to suppress body parts that can be gendered or sexualised, (3) comparisons to romantic partners’ bodies, (4) media representations, (5) queer signalling, (6) queerness as protective, (7) gender expression and dysphoria, (8) societal expectations of women’s bodies, and (9) internalisation of body/beauty ideals. Seven sub-themes were created to represent beauty ideals for specific subcultural communities (e.g. femme, butch). Findings suggest that queer women attribute individual, interpersonal and social factors to weight concerns, behaviours and perceptions. Findings highlight how complex tensions between the beauty/body ideals experienced in cisheteronormative and queer spaces influence eating and weight concerns among queer women. Gender, sexual orientation and subcultural ideals intersect in important ways, and may be useful to consider when screening, treating and preventing eating and weight concerns among queer women.

Synthesis of Prospective Multiple Time Points F-18 FDG PET Images from a Single Scan Using a Supervised Generative Adversarial Network.

The cumulative activity map estimation are essential tools for patient specific dosimetry with high accuracy, which is estimated using biokinetic models instead of patient dynamic data or the number of static PET scans, owing to economical and time-consuming points of view. In the era of deep learning applications in medicine, the pix-to-pix (p2 p) GAN neural networks play a significant role in image translation between imaging modalities. In this pilot study, we extended the p2 p GAN networks to generate PET images of patients at different times according to a 60 min scan time after the injection of F-18 FDG. In this regard, the study was conducted in two sections: phantom and patient studies. In the phantom study section, the SSIM, PSNR, and MSE metric results of the generated images varied from 0.98-0.99, 31-34 and 1-2 respectively and the fine-tuned Resnet-50 network classified the different timing images with high performance. In the patient study, these values varied from 0.88-0.93, 36-41 and 1.7-2.2, respectively and the classification network classified the generated images in the true group with high accuracy. The results of phantom studies showed high values of evaluation metrics owing to ideal image quality conditions. However, in the patient study, promising results were achieved which showed that the image quality and training data number affected the network performance. This study aims to assess the feasibility of p2 p GAN network application for different timing image generation.

A Study on Ureteric Abnormalities in Single Contrast Bolus CT Urography at A Tertiary Care Centre

Introduction: CT urography is an imaging technique in which the i.v contrast is injected and phases of CT scan are taken to study the entire urinary system. It has essentially replaced intravenous urography (IVU) in most imaging practices. CT Urography has evolved as an ideal imaging tool for comprehensive imaging assessment of patients with flank pain, malignancies, hematuria, trauma, renal calculi, suspected congenital malformations and in various clinical settings. Other CT advantages include the use of multiplanar reconstruction (MPR), curved planar reformatted images, maximum intensity projection (MIP) and three-dimensional (3D) reconstruction which gives valuable information to the clinician about the extent of the lesions and helps in management.
 Aim: To study various types of ureteric abnormalities in CT Urography in various clinical presentation.
 Materials and methods: This is a tertiary hospital based observational Descriptive Cross sectional study conducted on 360 patients referred for CT Urography with Clinical Signs & Symptoms of urinary tract abnormalities, having ureteric imaging abnormalities. Siemens somatum High Definition 128 slice CT scanner was used for single bolus CT urography.
 Results: Males were more as compared to females with age group 31 to 50 years (44.4%). Abdominal pain with urinary complaints was seen in maximum number of patients (203 cases- 56.4%). Urinary complaints in known abdomino-pelvic malignancies was seen in 18% cases. 285 patients had obstructive urography findings like hydronephrosis or hydroureter, and 75 cases had non obstructive findings like ureteral filling defects due to calculi, clots, etc or abnormal ureteric course or only congenital abnormality. Most hydroureter cases were secondary to obstructive calculus followed by obstruction by external malignant mass.
 Conclusion: This study outlines the most common ureteric abnormalities in patients referred for CT urography which were mostly obstructive findings most cases were secondary to obstructive calculus followed by obstruction by external malignant mass. The non obstructive findings like ureteral filling defects were due to calculi, clots, etc or abnormal ureteric course or only congenital abnormalities. Delayed phase of CT urography can also be applied in Contrast CT study of abdomen & Pelvic scans on case to case basis to study ureteric involvements & pathologies.

Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’

Genes to CellsEarly View CORRECTIONFree Access Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’ This article corrects the following: The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation Norinaga Urahama, Mitsuhiro Ito, Akiko Sada, Kimikazu Yakushijin, Katsuya Yamamoto, Atsuo Okamura, Kentaro Minagawa, Akio Hato, Kazuo Chihara, Robert G. Roeder, Toshimitsu Matsui, Volume 10Issue 12Genes to Cells pages: 1127-1137 First Published online: October 31, 2005 First published: 06 March 2023 https://doi.org/10.1111/gtc.13012AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat In the original version of Figure 1B, identical images of stained BFU-E cells were erroneously used for wild-type and knockout panels. Representative data from repeated experiments are now provided in corrected Figure 1B. The errors were in presentation only, and do not affect any results or discussion in the article. FIGURE 1BOpen in figure viewerPowerPoint It was also brought to the attention of the journal and the authors that in the original version of Figure 4A there were closely similar Northern blot images. Specifically, GAPDH lanes of 1,25-(OH)2D3-treated cells and background noises in VDH lanes of DMSO-treated cells were similar to GAPDH lanes and SRC-1 lanes of 1,25-(OH)2D3-treated cells in Figure 3, respectively; and TRAP220 lanes of control, TPA-treated and DMSO-treated cells at 0 hr were similar to each other. The authors have provided new versions of the figures as corrected Figure 4A by repeating experiments and measuring by RT-qPCR, a contemporary method that may be more accurate than Northern blot. This correction does not affect the results or conclusions of the work. The authors apologize for these mistakes. FIGURE 4AOpen in figure viewerPowerPoint Method for corrected Figure 4A: HL-60 cells were used to induce differentiation as described. Total RNAs (0.5 μg), isolated by using Isogen II (Toyobo), were used to reverse-transcribe by ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) in triplicates. Then mRNAs were quantificated by using KOD SYBR qPCR Mix (Toyobo) and StepOnePlus Real-Time PCR System (Thermo Fisher). Values were normalized by the values for GAPDH, and means ± SD of relative values are shown. The sequences of the primers used for qPCR are as the followings: for TRAP220, GGCGGATCTAGCTTCTCCTC and CTTCTCCATGACTTGACGCAC; for VDH, TGCCAGCGATAATACGCCTC and TGGTGCTGACACAGGTGAAG; for CD38, CGCGATGCGTCAAGTACAC and TGCAAGGTACGGTCTGAGTTC; for gp91, ACTGCATGCTGATTCTCTTGC and TTCGAACTCTTGTTGAGCAGC; and for GAPDH, CAGCAAGAGCACAAGAGGAAG and ACATGACAAGGTGCGGCT. REFERENCE Urahama, N., Ito, M., Sada, A., Yakushijin, K., Yamamoto, K., Okamura, A., Minagawa, K., Hato, A., Chihara, K., Roeder, R.G., & Matsui, T. (2005). The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation. Genes to Cells, 10(12), 1127– 1137. https://doi.org/10.1111/j.1365-2443.2005.00906.x Early ViewOnline Version of Record before inclusion in an issue FiguresReferencesRelatedInformation

Prevention of eating disorders: 2022 in review

ABSTRACT This review of 17 prevention-related publications in Eating Disorders during 2022 is framed by three models: (1) Mental Health Intervention Spectrum: health promotion ➔ types of prevention ➔ case identification/referral ➔ treatment; (2) the prevention cycle: rationale and theory, shaped by critical reviews ➔ clarifying risk and protective factors ➔ program innovation and feasibility studies ➔ efficacy and effectiveness research ➔ program dissemination; and (3) definitions of and links between disordered eating (DE) and eating disorders (EDs). Five articles fell into the category of prevention rationale, theory, and critical analyses, while seven articles addressed risk factors (RFs) for various aspects of DE. Eating Disorders also published two pilot studies, two prevention efficacy trials, and one effectiveness study in 2022. One implication of the 17 articles reviewed is that RF research toward construction of selective and indicated prevention programs for diverse at-risk groups should address a broad range of factors beyond negative body image and internalization of beauty ideals. Another implication is that, to expand and improve current and forthcoming prevention programs, and to shape effective advocacy for prevention-oriented social policy, the field in general and Eating Disorders in particular need more scholarship in the form of critical reviews and meta-analyses, protective factor research, and case studies of multi-step activism at the local, state (province, region), and national levels.

A comparison of the impact of exposure to fit ideal and non-fit ideal body shapes in fitspiration imagery on women

Previous research indicates a negative impact of exposure to fitspiration on women's mood, self-esteem, and body satisfaction. Fitspiration typically features thin and toned bodies, but there is some variation in the body types shown, which may influence its effects on viewers. Participants (N = 605women) were randomly allocated to view fit ideal, non-fit ideal, or neutral control images from Instagram, and completed state measures of appearance self-esteem, self-objectification, body satisfaction, and negative mood before and after image exposure. Women in the fitspiration conditions also reported level of state appearance comparison with women depicted and how inspired they were to do more exercise. Fit ideal and non-fit ideal images had a negative effect on body satisfaction. However, participants in the non-fit ideal condition showed an increase in state self-esteem and a decrease in state negative mood following image exposure, in contrast to the fit ideal condition. Condition did not have an impact on state self-objectification and there was no difference between fitspiration conditions in how inspired participants felt to do more exercise. State appearance comparison was correlated with change in self-esteem, negative mood, body satisfaction scores and with how inspired individuals felt to exercise. Small effect sizes and limitations indicate that replication of findings is required. However, the effects of viewing fitspiration imagery may depend on thinness and muscle tone of models shown, and level of comparison with people portrayed.

Knowledge-driven perceptual organization reshapes information sampling via eye movements.

Humans constantly move their eyes to explore the environment. However, how image-computable features and object representations contribute to eye-movement control is an ongoing debate. Recent developments in object perception indicate a complex relationship between features and object representations, where image-independent object knowledge generates objecthood by reconfiguring how feature space is carved up. Here, we adopt this emerging perspective, asking whether object-oriented eye movements result from gaze being guided by image-computable features, or by the fact that these features are bound into an object representation. We recorded eye movements in response to stimuli that initially appear as meaningless patches but are experienced as coherent objects once relevant object knowledge has been acquired. We demonstrate that fixations on identical images are more object-centered, less dispersed, and more consistent across observers once these images are organized into objects. Gaze guidance also showed a shift from exploratory information sampling to exploitation of object-related image areas. These effects were evident from the first fixations onwards. Importantly, eye movements were not fully determined by knowledge-dependent object representations but were best explained by the integration of these representations with image-computable features. Overall, the results show how information sampling via eye movements is guided by a dynamic interaction between image-computable features and knowledge-driven perceptual organization. (PsycInfo Database Record (c) 2023 APA, all rights reserved).

T-Matrix Backprojection Imaging for Scalar and Vector Electromagnetic Waves

Expressions for the ideal free-space backprojected image of an object with known transition matrix (T-matrix) are derived for scalar and vector electromagnetic waves in bistatic and monostatic geometries. Discrete backprojection sums are extended to continuous integrals over source/receiver spheres. Images are formed without the need to generate or process scattered field data. The final expressions only depend on regular wave functions in the frame of the object and the object T-matrix. The formulation is validated numerically using the aggregate T-matrix solution for a collection of acoustic and dielectric spheres. Applications include assessment and validation of free-space focusing and T-matrix scattering solutions.

Incels://cheeks/jaws: On fragile masculinity, fatal body ideals, homophobic homoeroticism and National Socialist aesthetics revisited

This article is concerned with fragile masculinity and its tendency towards authoritarianism and violence by focusing on the characteristics of a specific social group/online community of men called incels ( in voluntary cel ibates). Incels are men who have no sexual encounters, blame women for their exclusion from sexual contact and create toxic online communities to share their violent and deadly misogyny. This article will detail their typical characteristics, including a discussion of their idealized body appearances. These toxic body politics are sampled by National Socialist aesthetics and charged with homoerotic looks and body styles. Like other right-wing groups, incels are driven by homophobia and racism. In their world-view, they also understand their own non-beauty-compliant appearance according to the mainstream normative of beauty as a reason for their sexlessness. The article focuses on the strategy of the misogynistic online community to achieve ‘looksmaxxing’ through cosmetic surgery. Their idealized body images sampled from various set pieces, from pop culture to Nazi chic, display consistent body ideals which feed on ancient mythologies.

Social Media overall impact womens perception on their bodies

The development of social media has led to faster information dissemination in the internet world; those contents involve the ideal body images for both women and men, imposing negative impacts on peoples perception of their bodies and their ways to live lives. In my paper, I want to address how social media construct images and spread words that mislead women to conduct the unhealthy weight-loss process; in addition, I want to examine what kind of influence social media can have or cast on the general public's conception about body forms. Previous research and articles have systematically discussed the harmful effects when people spend a majority of their time immersing themselves in the body ideals present by social media; also, they reveal what kind of health-damaging consequences brought by social media if adolescents and adults blindly believe the so-called perfect body images demonstrate on it. However, they havent suggested which methods are applied by social media operators when they attempt to indoctrinate the general public about the ideal body types. I want to use this paper to educate the audience. I want to use this paper to educate people about negative effects which social media can impose on us, especially those we tend to neglect as the usage of it becomes a daily routine. I collect the existing data and findings from different scholarly articles and offer my own interpretation in my paper. The glamorous body images present online can often mislead us about the healthy ways to manage our body weight and body types, and we should possess a clear mind instead of following whats seemingly right about the appearance of our physical being.

A Probe into the Artistic Style of Aubrey Beardsley

This paper explores the artistic style of British artist Beardsley from three different aspects. Beardsley's unique style of Art Deco is formed by his absorption of Japanese Ukiyo-e's style and features, the coordinated proportion of the picture composition and the use of black and white blocks. In addition, the beautiful and gorgeous painting style and the expression of the theme of "evil" constitute the artistic characteristics of decadentism. At the same time, the creation of female images in the works of Aubrey Beardsley also shows a rebellion against the ideal female images in the Victorian era.

The real and ideal parent image among representatives of different age groups

The article presents a comparative analysis of the image specifics of an ‟ideal” and ‟real” parent among a young people group and adults with parenting experience, 89 young people and 56 adults took part in the study. The ‟ideal parent” image has similar features among a young people group and adults is associated with a pedagogical competence high level, first of all. The ‟ideal parent” is able to interact with children effectively. Adult respondents tend to idealize the image more than young people. Adults also place stricter requirements on the qualities of a ‟real parent”. Among a young people group the ‟real parent” image is associated with the ability to understand and be patient, with parental competence. Among an adults group the ‟real parent” image, the ability to fairly assess various situations of interaction with a child, trusting relationships and patience are significant.

1970년대 김주영 대중소설의 ‘남성성’ 구현양상과 의미

This paper examines the complexion and significance of ‘masculinity’ in Kim Joo-young's popular novels. Masculinity is concept defined by society and its relationship to femininity. Men depicted in popular novels often admire ‘the ideal man’, and it is common to produce 'hegemonic masculinity' that dominates power, authority, and economic abundance. However, often, men in Kim Joo-young's novels are alienated or despised by society, such as rogues or gangsters. They roam the city, disregarding the status quo and authority, ignoring customs and order, and destroying the ideal male image. The masculinity these characters represent has a certain ‘libertine existence’ and an overly intentional violent personality, or it has antisocial characteristics that hate ‘daring women’ and objectify women. Men with such forced masculinity contribute to exposing the disruptiveness of capitalist society and create an ironic effect. Kim criticizes the oppressed ruling order by implementing them, but there is a limit to revealing ambivalence that admires ‘hegemonic masculinity’. Nevertheless, the masculinity depicted in Kim Joo-young's is meaningful in that it caused cracks in the solid patriarchal social order and produced critical discourse.

Taking Rights Seriously? Recent Shifts in Procedural and Substantive Matters of the Thai Constitutional Court

The Thai Constitutional Court has recently dealt with more cases concerning constitutional rights such as those involving abortion and same-sex marriage, gaining widespread public attention similar to its many cases on political issues. This new development may show that the Court has now performed its role as a constitutional guardian and bulwark of rights. But the expansion of the caseload on rights may promote judicial activism and thus indicate a new strategy for the Court to be more powerful. This article looks at both the substantive changes in the jurisprudence of the Court as well as the procedural adjustments in recent court cases to determine the extent to which the Court has transformed itself to the ideal image of a great constitutional court in a comparative context. The Article analyzes all constitutional rights cases decided since 2019 to gauge the overall performance of the Court. Moreover, the Article also provides some examples of cases that seemingly protect constitutional rights but simultaneously expand the powers of the Court in the future. The analysis then suggests that while the Court might have facially helped protect more rights, it comes with a cost of a potentially even more active and political Court.

Extracting angle-domain common-image gathers in VTI media using ansiotropic-Helmholtz P/S wave-mode decomposition

Common-image gathers are extensively used in amplitude versus angle (AVA) and migration velocity analysis (MVA). The current state of methods for anisotropic angle gathers extraction use slant-stack, local Fourier transform or low-rank approximation, which requires much computation. Based on an anisotropic-Helmholtz P/S wave-mode decomposition method, we propose a novel and efficient approach to produce angle-domain common-image gathers (ADCIGs) in the elastic reverse time migration (ERTM) of VTI media. To start with, we derive an anisotropic-Helmholtz decomposition operator from the Christoffel equation in VTI media, and use this operator to derive the decomposed formulations for anisotropic P/S waves. Second, we employ the first-order Taylor expansion to calculate the normalized term of decomposed formulations and obtain the anisotropic-Helmholtz decomposition method, which generates the separated P/S wavefields with correct amplitudes and phases. Third, we develop a novel way that uses the anisotropic-Helmholtz decomposition operator to define the polarization angles for anisotropic P/S waves and substitute these angles to decomposing formulations. The polarization angles are then calculated directly from the separated vector P- and S-wavefields and converted to the phase angles. The ADCIGs are thusly produced by applying the phase angles to VTI ERTM. In addition, we develop a concise approximate expression of residual moveout (RMO) for PP-reflections of flat reflectors in VTI media, which avoids the complex transformations between the group angles and the phase angles. The approximate RMO curves show a good agreement with the exact solution and can be used as a tool to assess the migration velocity errors. As demonstrated by two selected examples, our ADCIGs not only produce the correct kinematic responses with regards to different velocity pertubatation, but also generate the reliable amplitude responses versus different angle. The final stacking images of ADCIGs data exhibit the identical imaging effect as that of VTI ERTM.

Relationship of masked obesity to self-reported lifestyle habits, ideal body image, and anthropometric measures in Japanese university students: A cross-sectional study.

Masked obesity (MO) is defined as a normal body mass index (BMI) with a high body fat percentage (%BF), and is associated with the onset of lifestyle-related diseases. However, little is known about the current status of MO. Therefore, we investigated the relationship of MO to physical characteristics and lifestyle habits among Japanese university students. Between 2011 and 2019, we conducted a survey of 10,168 males and 4,954 females with BMI within the normal range (18.5 ≤ BMI < 25 kg/m2). MO was defined as %BF ≥ 20% in males and %BF ≥ 30% in females. Students completed a questionnaire containing items about lifestyle habits. Systolic and diastolic blood pressures were measured, and hypertension was defined as systolic above 140 mmHg and/or diastolic blood pressure above 90 mmHg. A multivariate logistic regression analysis was performed to evaluate the relationships as follows: the relationship of masked obesity to self-reported lifestyle habits, ideal body image, and anthropometric measures; the relationship between hypertension and body indices. The proportion of students with MO in 2019 was 13.4% in males and 25.8% in females, and the proportion of females increased over time. MO was associated with desire for weight loss (odds ratio, 95% confidence interval: 1.76, 1.53-2.02), intake of five macronutrients (0.79, 0.67-0.93), rice and wheat intakes (1.22, 1.01-1.47), sleep duration of < 7hr (0.85, 0.74-0.98), and exercise habit (0.71, 0.63-0.81) in males; and with balanced diet intake (0.79, 0.64-0.99) and exercise habit (0.65, 0.51-0.82) in females. There was a significant association of MO with hypertension in males (1.29, 1.09-1.53). The percentage of female students with MO increased during the study period, and in males, MO may be a risk factor for hypertension. These results suggest that intervention for MO is needed in Japanese university students.

Early life influences on the development of food addiction in college attending young adults

PurposeThere is little investigation into the causes of food addiction. The aim of this study was to determine the impact of early life influences on the development of food addiction in college-attending young adults aged 18–29.MethodsThis study utilized a sequential explanatory mixed-methods research design. College-attending young adults were invited to complete an online survey measuring Adverse Childhood Experiences (ACEs), food addiction, depression, anxiety, stress, and demographic information. Correlations between food addiction and the other variables were analyzed and significant variables were placed into a nominal logistic regression model to predict the development of food addiction. Participants who met the criteria for food addiction were invited to participate in interviews to examine their childhood eating environment and when their symptoms emerged. Interviews were transcribed and thematically analyzed. Quantitative analysis was conducted using JMP Pro Version 16.0 and qualitative analysis was conducted using NVIVO Software Version 12.0.ResultsSurvey respondents (n = 1645) had an overall 21.9% prevalence of food addiction. Significant correlations were observed between food addiction and ACEs, depression, anxiety, stress, and sex (p < .01 for all). Depression was the only significant predictor of the development of food addiction (OR = 3.33 95% CI 2.19, 5.05). The most common eating environment described by interview participants (n = 36) was an emphasis on diet culture, ideal body image, and restrictive environments. Symptoms frequently emerged after transitioning into college and having the ability to make their own food choices.ConclusionThese results show the impact of early life eating environments and young adulthood mental health on the development of food addiction. These findings contribute to the understanding of underlying causes of food addiction.Level of evidence: Level V, Opinions of authorities, based on descriptive studies, narrative reviews, clinical experience, or reports of expert committees.

Improving the localisation of features for the calibration of cameras using EfficientNets.

Camera-based methods for optical coordinate metrology, such as digital fringe projection, rely on accurate calibration of the cameras in the system. Camera calibration is the process of determining the intrinsic and distortion parameters which define the camera model and relies on the localisation of targets (in this case, circular dots) within a set of calibration images. Localising these features with sub-pixel accuracy is key to providing high quality calibration results which in turn allows for high quality measurement results. A popular solution to the localisation of calibration features is provided in the OpenCV library. In this paper, we adopt a hybrid machine learning approach where an initial localisation is given by OpenCV which is then refined through a convolutional neural network based on the EfficientNet architecture. Our proposed localisation method is then compared with the OpenCV locations without refinement, and to an alternative refinement method based on traditional image processing. We show that under ideal imaging conditions, both refinement methods provide a reduction in the mean residual reprojection error of approximately 50%. However, in adverse imaging conditions, with high noise levels and specular reflection, we show that the traditional refinement degrades the results given by pure OpenCV, increasing the mean residual magnitude by 34%, which corresponds to 0.2 pixels. In contrast, the EfficientNet refinement is shown to be robust to the unideal conditions and is still able to reduce the mean residual magnitude by 50% compared to OpenCV. The EfficientNet feature localisation refinement, therefore, enables a greater range of viable imaging positions across the measurement volume. leading to more robust camera parameter estimations.

Impact of Brand Identity and Brand Image On Fashion Entrepreneurs: A Case Study of Greater Accra Metropolis

Over the years branding has been the concern of many businesses across the globe, however the fashion world has not been exempted, many studies has also been carried out to investigate relationship that exist between fashion and branding. Brand images and identity has been the major point for competition among fashion customers, clients, investors and brand owners. This call for this research to find out impact of brand image and brand identity has on fashion entrepreneurs. The population was drawn from Accra metropolis covering areas such as McCarthy hill, and North-Kaneshie, Accra. Purposive sampling was used to select 50 respondents made up of fashion entrepreneurs (14), fashion students (18) and consumers (18). The questionnaire was the main tool used for this study. Four research questions were tested in this study using simple percentage, piecharts and frequencies respectively. The results show that the essence of branding on fashion entrepreneurs is inseparable. Logo, symbol/ colors of a fashion enterprise contribute to the progress of fashion entrepreneurs. It was also discovered that brand name has an influence on purchase decision of their clients and that brand identity increases investors and customer awareness and customer loyalty. It was concluded that the impact of brand image and identity such as logo, symbols, colors among others, contribute significantly to customers and loyalty. This study recommends that fashion entrepreneurs should give adequate time to come up with brands that speak for them anytime and anywhere, fashion entrepreneurs should cultivate the habit of setting fund aside for their business needs, as funds will be required to enhance their businesses, relying on government, non-governmental organization or others for loans may not always be available, creativity should be the focus of fashion entrepreneurs, because we live in a world where change is constant.

Clean mucosal area detection of gastroenterologists versus artificial intelligence in small bowel capsule endoscopy.

Studies comparing the detection of clean mucosal areas in capsule endoscopy (CE) using human judgment versus artificial intelligence (AI) are rare. This study statistically analyzed gastroenterologist judgments and AI results. Three hundred CE video clips (100 patients) were prepared. Five gastroenterologists classified the video clips into 3 groups (≥75% [high], 50%-75% [middle], and < 50% [low]) according to their subjective judgment of cleanliness. Visualization scores were calculated using an AI algorithm based on the predicted visible area, and the 5 gastroenterologists' judgments and AI results were compared. The 5 gastroenterologists evaluated CE clip video quality as "high" in 10.7% to 36.7% and as "low" in 28.7% to 60.3% and 29.7% of cases, respectively. The AI evaluated CE clip video quality as "high" in 27.7% and as "low" in 29.7% of cases. Repeated-measures analysis of variance (ANOVA) revealed significant differences in the 6 evaluation indicators (5 gastroenterologists and 1 AI) (P < .001). Among the 300 judgments, 90 (30%) were consistent with 5 gastroenterologists' judgments, and 82 (91.1%) agreed with the AI judgments. The "high" and "low" judgments of the gastroenterologists and AI agreed in 95.0% and 94.9% of cases, respectively. Bonferroni's multiple comparison test showed no significant difference between 3 gastroenterologists and AI (P = .0961, P = 1.0000, and P = .0676, respectively) but a significant difference between the other 2 with AI (P < .0001). When evaluating CE images for cleanliness, the judgments of 5 gastroenterologists were relatively diverse. The AI produced a relatively universal judgment that was consistent with the gastroenterologists' judgements.