Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’

Abstract

Genes to CellsEarly View CORRECTIONFree Access Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’ This article corrects the following: The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation Norinaga Urahama, Mitsuhiro Ito, Akiko Sada, Kimikazu Yakushijin, Katsuya Yamamoto, Atsuo Okamura, Kentaro Minagawa, Akio Hato, Kazuo Chihara, Robert G. Roeder, Toshimitsu Matsui, Volume 10Issue 12Genes to Cells pages: 1127-1137 First Published online: October 31, 2005 First published: 06 March 2023 https://doi.org/10.1111/gtc.13012AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat In the original version of Figure 1B, identical images of stained BFU-E cells were erroneously used for wild-type and knockout panels. Representative data from repeated experiments are now provided in corrected Figure 1B. The errors were in presentation only, and do not affect any results or discussion in the article. FIGURE 1BOpen in figure viewerPowerPoint It was also brought to the attention of the journal and the authors that in the original version of Figure 4A there were closely similar Northern blot images. Specifically, GAPDH lanes of 1,25-(OH)2D3-treated cells and background noises in VDH lanes of DMSO-treated cells were similar to GAPDH lanes and SRC-1 lanes of 1,25-(OH)2D3-treated cells in Figure 3, respectively; and TRAP220 lanes of control, TPA-treated and DMSO-treated cells at 0 hr were similar to each other. The authors have provided new versions of the figures as corrected Figure 4A by repeating experiments and measuring by RT-qPCR, a contemporary method that may be more accurate than Northern blot. This correction does not affect the results or conclusions of the work. The authors apologize for these mistakes. FIGURE 4AOpen in figure viewerPowerPoint Method for corrected Figure 4A: HL-60 cells were used to induce differentiation as described. Total RNAs (0.5 μg), isolated by using Isogen II (Toyobo), were used to reverse-transcribe by ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) in triplicates. Then mRNAs were quantificated by using KOD SYBR qPCR Mix (Toyobo) and StepOnePlus Real-Time PCR System (Thermo Fisher). Values were normalized by the values for GAPDH, and means ± SD of relative values are shown. The sequences of the primers used for qPCR are as the followings: for TRAP220, GGCGGATCTAGCTTCTCCTC and CTTCTCCATGACTTGACGCAC; for VDH, TGCCAGCGATAATACGCCTC and TGGTGCTGACACAGGTGAAG; for CD38, CGCGATGCGTCAAGTACAC and TGCAAGGTACGGTCTGAGTTC; for gp91, ACTGCATGCTGATTCTCTTGC and TTCGAACTCTTGTTGAGCAGC; and for GAPDH, CAGCAAGAGCACAAGAGGAAG and ACATGACAAGGTGCGGCT. REFERENCE Urahama, N., Ito, M., Sada, A., Yakushijin, K., Yamamoto, K., Okamura, A., Minagawa, K., Hato, A., Chihara, K., Roeder, R.G., & Matsui, T. (2005). The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation. Genes to Cells, 10(12), 1127– 1137. https://doi.org/10.1111/j.1365-2443.2005.00906.x Early ViewOnline Version of Record before inclusion in an issue FiguresReferencesRelatedInformation