Human Telomeric Sequence Research Articles

Promoters vs. telomeres: AP-endonuclease 1 interactions with abasic sites in G-quadruplex folds depend on topology.

The DNA repair endonuclease APE1 is responsible for the cleavage of abasic sites (AP) in DNA as well as binding AP in promoter G-quadruplex (G4) folds in some genes to regulate transcription. The present studies focused on the topological properties of AP-bearing G4 folds and how they impact APE1 interaction. The human telomere sequence with a tetrahydrofuran model (F) of an AP was folded in K+- or Na+-containing buffers to adopt hybrid- or basket-folds, respectively. Endonuclease and binding assays were performed with APE1 and the G4 substrates, and the data were compared to prior work with parallel-stranded VEGF and NEIL3 promoter G4s to identify topological differences. The APE1-catalyzed endonuclease assays led to the conclusion that telomere G4 folds were slightly better substrates than the promoter G4s, but the yields were all low compared to duplex DNA. In the binding assays, G4 topological differences were observed in which APE1 bound telomere G4s with dissociation constants similar to single-stranded DNA, and promoter G4s were bound with nearly ten-fold lower values similar to duplex DNA. An in-cellulo assay with the telomere G4 in a model promoter bearing a lesion failed to regulate transcription. These data support a hypothesis that G4 topology in gene promoters is a critical feature that APE1 recognizes for gene regulation.

Reaction of human telomeric unit TTAGGG and a photoactivatable Pt(IV) anticancer prodrug.

The interaction of a photoactivatable diazidodihydroxido Pt(IV) prodrug, trans,trans,trans-[Pt(N3)2(OH)2(py)2] (py = pyridine; 1), with a hexamer straight human telomeric DNA unit sequence (5'-T1T2A3G4G5G6-3', I) upon light irradiation was investigated by electrospray ionization mass spectroscopy (ESI-MS). In the primary mass spectrum, two major mono-platinated I adducts with the bound Pt moieties, trans-[PtII(N3)(py)2]+ (1') and trans-[PtII(py)2]2+ (1''), respectively, were detected. It is rare to observe such high abundance and nearly equal intensity platinated DNA adducts formed by these two PtII species because 1' is usually the only major reduced Pt(II) species produced by the photodecomposition of complex 1 in the presence of DNA while 1'' was rarely detected as the major reduced PtII species reported previously. Subsequent tandem mass spectrometric analysis by collision-induced dissociation (CID) showed that in the former adduct {I + 1'}2+, G6 and A3 were the platination sites. While in the latter adduct {I + 1''}2+, a potential intrastrand crosslink was speculated after G4 and G6 sites were identified. Additionally, other minor platinated adducts like di-platinated I adduct by 1' with platination sites at G4 and G6 and mono-platinated I adducts containing base oxidation were also detected by mass spectrometry. Due to the rich guanines and their sensitivity to oxidation, the oxidation induced by 1 most probably occurred at guanine. The oxidation adducts were proposed as 8-hydroxyl guanine, spiroiminodihydantoin (Sp), 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG), 5-guanidinohydantoin (Gh), and/or dehydroguanidinohydantoin (DGh) referring to previous reports. The obtained results provide useful chemical information about the photoreaction between photoactivatable Pt(IV) anticancer prodrugs and human telomeric DNA. Such special damages of Pt(IV) prodrugs on human telomeric DNA implicate its active role in the mechanism of Pt(IV) prodrugs and further support the unique sequence-dependent photointeraction profile of complex 1 reacting with DNA.

Detecting secondary structure formation with FRET-PAINT.

We present single molecule studies demonstrating the capabilities of the FRET-PAINT method to detect secondary structures that would be challenging to detect with alternative methods, particularly single molecule FRET (smFRET). Instead of relying on the change in end-to-end separation as in smFRET, we use the change in accessibility to a small probe as the criterion for secondary structure formation and relative stability. As a model system, we study G-triplex formation by human telomeric repeat sequences in different structural contexts.

Short designed peptide unfolding human telomeric G-quadruplex: mimicking the helicase function

Human telomeric DNA can fold into G-quadruplex structures involving the interaction of four guanine bases in a square planar arrangement. The highly distinctive nature of quadruplex topologies suggests that they can act as novel therapeutic targets. In this study, we provide the evidence of human telomeric G4 destabilization in dilute and cell-mimicking molecular crowing conditions upon peptide binding. We have used three human telomeric sequences of different lengths. CD data showed that these sequences folded into anti-parallel G-quadruplex and CD intensity decreased significantly on increasing the peptide concentration. UV-thermal melting results showed significant decrease in hypochromicity due to formation of G4-peptide complex at 295 nm. Fluorescence data showed the quenching on titrating the peptide with human telomere G4. Electrophoretic mobility shift assay confirmed the unfolding of G4 structure. Cell viability was significantly reduced in the presence of QW5 peptide with IC50 values as 8.78 μM and 7.72 μM after 72 and 96 hours of incubation respectively. These results confirmed that QW5 peptide has an ability to bind and unfold to human telomeric G-quadruplex and hence might be the key modulator for targeting diseases having over-representation of G4 motifs and their destabilization will be helpful in increasing the efficiency of DNA replication, transcription or duplex reannealing. Communicated by Ramaswamy H. Sarma

Binding characterization of anthraquinone derivatives by stabilizing G-quadruplex DNA leads to an anticancerous activity

G-quadruplex is a non-canonical secondary structure identified in the telomeric region and the promoter of many oncogenes. Anthraquinone derivatives, a well-known inducer of telomere disruption in malignant cells and activate the apoptotic pathway. We used biophysical and biochemical studies to confirm the interaction of synthesized anthraquinone derivatives with the human telomeric G-quadruplex sequence. The binding affinity of N-2DEA and N-1DEA are K b= 4.8×106 M-1 and K b= 7.6×105 M-1, respectively, leading to hypochroism, fluorescence quenching with minor redshift and ellipticity variations indicating ligand binding in the external groove. We found that sodium ions induced stabilization more rather than potassium ions. Molecular docking of complex demonstrates a molecule's exterior binding to a quadruplex. The investigation of ROS activity indicated that the cell initiates mortality in response to the IC50 concentration. Cellular morphology, nuclear condensation, and fragmentation were altered in the treated cell, impairing cellular function. Finally, the transcriptional regulatory study paves the way for drug design as an anti-cancer agent because of the tremendous possibilities of changing substituent groups on anthraquinones to improve efficacy and selectivity for G-quartet DNA. Our research focused on how ligand binding to telomere sequences induces oxidative stress and inhibits the growth of malignant cells.

Influence of Different Salts on the G-Quadruplex Structure Formed from the Reversed Human Telomeric DNA Sequence.

G-rich telomeric DNA plays a major role in the stabilization of chromosomes and can fold into a plethora of different G-quadruplex structures in the presence of mono- and divalent cations. The reversed human telomeric DNA sequence (5′-(GGG ATT)4; RevHumTel) was previously shown to have interesting properties that can be exploited for chemical sensing and as a chemical switch in DNA nanotechnology. Here, we analyze the specific G-quadruplex structures formed by RevHumTel in the presence of K+, Na+, Mg2+ and Ca2+ cations using circular dichroism spectroscopy (CDS) and Förster resonance energy transfer (FRET) based on fluorescence lifetimes. CDS is able to reveal strand and loop orientations, whereas FRET gives information about the distances between the 5′-end and the 3′-end, and also, the number of G-quadruplex species formed. Based on this combined information we derived specific G-quadruplex structures formed from RevHumTel, i.e., a chair-type and a hybrid-type G-quadruplex structure formed in presence of K+, whereas Na+ induces the formation of up to three different G-quadruplexes (a basket-type, a propeller-type and a hybrid-type structure). In the presence of Mg2+ and Ca2+ two different parallel G-quadruplexes are formed (one of which is a propeller-type structure). This study will support the fundamental understanding of the G-quadruplex formation in different environments and a rational design of G-quadruplex-based applications in sensing and nanotechnology.

Photo-Oxidizing Ruthenium(II) Complexes with Enhanced Visible-Light Absorption and G-quadruplex DNA Binding Abilities.

Photosensitizers that gather high photo-oxidizing power and strong visible-light absorption are of great interest in the development of new photo-chemotherapeutics. Indeed, such compounds constitute attractive candidates for the design of type I photosensitizers that are not dependent on the presence of oxygen. In this paper, we report on the synthesis and studies of new ruthenium(II) complexes that display strong visible-light absorption and can oxidize guanine residues under visible-light irradiation, as evidenced by nanosecond transient absorption spectroscopy. The reported compounds also tightly bind to G-quadruplex DNA structures from the human telomeric sequence (TTAGGG repeat). The kinetic and thermodynamic parameters of the interaction of these Ru(II) complexes with G-quadruplex and duplex DNA were studied thanks to luminescence titrations and bio-layer interferometry measurements, which revealed higher affinities towards the non-canonical G-quadruplex architecture. Docking experiments and non-covalent ionic analysis allowed us to gain information on the mode and the strength of the interaction of the compounds towards G-quadruplex and duplex DNA. The different studies emphasize the substantial influence of the position and the number of non-chelating nitrogen atoms on the interaction with both types of DNA secondary structures.

Novel Planar Pt(II) Cyclometallated Cytotoxic Complexes with G-Quadruplex Stabilisation and Luminescent Properties.

Herein is described the development of a series of novel quadruplex DNA (QDNA)-stabilising cyclometallated square–planar metal complexes (CMCs). Melting experiments using quadruplex DNA (QDNA) demonstrated that interactions with the complexes increased the melting temperature by up to 19 °C. This QDNA stabilisation was determined in two of the major G-quadruplex structures formed in the human c-MYC promoter gene (c-MYC) and a human telomeric repeat sequence (H-Telo). The CMCs were found to stabilise H-telo more strongly than c-MYC, and the CMCs with the highest cytotoxic effect had a low–moderate correlation between H-telo binding capacity and cytotoxicity (R2 values up to 10 times those of c-MYC). The melting experiments further revealed that the stabilisation effect was altered depending on whether the CMC was introduced before or after the formation of QDNA. All CMCs’ GI50 values were comparable or better than cisplatin in human cancer cell lines HT29, U87, MCF-7, H460, A431, Du145, BE2-C, SJ-G2, MIA, and ADDP. Complexes 6, 7, and 9 were significantly more cytotoxic than cisplatin in all cell lines tested and had good to moderate selectivity indices, 1.7–4.5 in MCF10A/MCF-7. The emission quantum yields were determined to be relatively high (up to 0.064), and emission occurred outside cellular autofluorescence, meaning CMC fluorescence is ideal for in vitro analyses.

Significant destabilization of human telomeric G-quadruplex upon peptide binding: dramatic effect of flanking bases

Human telomere is composed of highly repeated hexanucleotide sequence TTAGGG and a 3′ single-stranded DNA tail. Many telomere G4 topologies characterized at atomic level by X-ray crystallography and NMR studies. Until now, various small ligands developed to interact with G-quadruplex mainly to stabilize the structure and least is known for its destabilization. In this study, we provide the first evidence of human telomeric G4 destabilization upon peptide binding in dilute and cell-mimicking molecular crowing conditions due to the changes in flanking bases of human telomeric sequences. Hence, our findings will open the new ways to target diseases related with increasing the efficiency of DNA replication, transcription or duplex reannealing. Communicated by Ramaswamy H. Sarma

A single molecule investigation of i-motif stability, folding intermediates, and potential as in-situ pH sensor.

We present a collection of single molecule work on the i-motif structure formed by the human telomeric sequence. Even though it was largely ignored in earlier years of its discovery due to its modest stability and requirement for low pH levels (pH < 6.5), the i-motif has been attracting more attention recently as both a physiologically relevant structure and as a potent pH sensor. In this manuscript, we establish single molecule Förster resonance energy transfer (smFRET) as a tool to study the i-motif over a broad pH and ionic conditions. We demonstrate pH and salt dependence of i-motif formation under steady state conditions and illustrate the intermediate states visited during i-motif folding in real time at the single molecule level. We also show the prominence of intermediate folding states and reversible folding/unfolding transitions. We present an example of using the i-motif as an in-situ pH sensor and use this sensor to establish the time scale for the pH drop in a commonly used oxygen scavenging system.

New insights into the effect of molecular crowding environment induced by dimethyl sulfoxide on the conformation and stability of G-quadruplex

Various structures of G-quadruplex in biosystems play an important role in different diseases and are often regulated by a variety of molecular crowding environments induced by internal and even external factors (e.g., a solvent). Dimethyl sulfoxide (DMSO), a universal solvent, has been widely used in biological studies and for drug therapy, but little is known regarding its effect on G-quadruplex structure and stability. Here, we report the influence of molecular crowding environment induced by DMSO on the conformation and stability of G-quadruplex structure. We show that the G-quadruplex-forming sequences such as human telomeric sequence, which may have diverse conformations in different environments, tend to convert their topologies to parallel structures under the molecular crowding stimulated by DMSO. Moreover, DMSO can increase the stability of the parallel and antiparallel topologies, especially the parallel G-quadruplex sequence c-kit, but not the hybrid topologies. Further analysis of c-kit using the CD and NMR technique, combined with the unique structural characteristics of c-kit, reveals that the crowding, dehydration and interaction of DMSO are conductive to the formation and stability of the parallel G-quadruplex. The present study suggests that, DMSO, a common solvent used in DNA experiments, may have a nonnegligible influence on the structure and stability of G-quadruplex.

Photoactivatable V-Shaped Bifunctional Quinone Methide Precursors as a New Class of Selective G-quadruplex Alkylating Agents.

Combining the selectivity of G‐quadruplex (G4) ligands with the spatial and temporal control of photochemistry is an emerging strategy to elucidate the biological relevance of these structures. In this work, we developed six novel V‐shaped G4 ligands that can, upon irradiation, form stable covalent adducts with G4 structures via the reactive intermediate, quinone methide (QM). We thoroughly investigated the photochemical properties of the ligands and their ability to generate QMs. Subsequently, we analyzed their specificity for various topologies of G4 and discovered a preferential binding towards the human telomeric sequence. Finally, we tested the ligand ability to act as photochemical alkylating agents, identifying the covalent adducts with G4 structures. This work introduces a novel molecular tool in the chemical biology toolkit for G4s.

A Biophysical Analysis on the Effect of Ligands on Fluorescently Active G‐quadruplex Structures

The formation of G‐quadruplex (GQ), a non‐canonical nucleic acid secondary structure, can inhibit the elevated telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most of the biochemical processes involving GQs involve local conformational changes of GQs at the guanine tetrad (G4) level. Previously we developed a method to study the local conformations of individual G4 layers in GQs that uses 6‐methylisoxanthopterine (6MI), a Circular Dichroism (CD)‐active fluorescent base analogue of guanine. Using this method here we explore the local conformational changes of individual G4 layers in GQ‐drug interactions. Experiments were performed with human telomeric 22AG sequence (5′‐AGGGTTAGGGTTAGGGTTAGGG‐3′) where guanines at the positions 3,9,15 and 21 were site‐specifically replaced by 6MI monomers. The CD and fluorescence properties of the GQ structures with and without the ligands were characterized under various conditions. Thermal denaturation studies showed that properly positioned 6MI monomers and dimers in a GQ forming sequence can form stable GQs with CD‐active fluorescent G4 layers. The local conformation of individual fluorescent G4 layers in the GQ structure was then monitored by following the fluorescence intensity and circular dichroism changes of the incorporated probes. The results showed the interaction of ligands with the fluorescent G4 layer varied depending on the functional groups as well as the bulkiness of the ligand suggesting that there are multiple ways of G4‐ligand interaction.

Anthraquinone derivatives inhibit telomerase activity by interaction with G quadruplex DNA and acts as a promising anticancerous agent

G‐quadruplex defines as an evolutionarily conserved sequence, non‐canonical secondary structures found at the telomeric region and in promoter regions of various oncogenes like cMYC, CKIT, and BCL2, etc. Telomerase enzyme activity is inhibited by a small molecule that selectively interacts with G‐quadruplex. Understanding the binding mechanism of the ligand‐G quadruplex complex is crucial for assessing anti‐tumor therapeutic efficacy. We have synthesized different anthraquinone derivative‐based G4 ligands which stabilize quadruplex sequence and influence various cellular processes. We have explored the interaction of synthesized anthraquinone derivatives with G4 DNA sequences comprising human telomeric DNA sequence by using absorption, fluorescence, circular dichroism (CD) spectroscopy, surface plasmon resonance (SPR) and thermal melting. Each ligand binds to the G4 DNA in monomeric form. The absorption intensity decreases with a shift of 6‐8 nm. Fluorescence quenching studies and sensorgram indicated a significant binding affinity (Kb) in the order of 102 to 108 M−1. A shift of ~6‐10 nm indicates partial stacking of aromatic chromophores with nucleic acid bases. Similar studies with CD spectroscopy yielded Kb in the range of 103 to 107 M−1. Thermal melting profiling of DNA saturated at Drug/DNA = 5 indicated a stabilization (ΔTm) of 21 to 34 °C in presence of different ions indicating more thermal stabilization in the presence of Na+ ions as compared to K+. Molecular docking analysis concluded that external binding of the ligands to G4 DNAs. The formation of a complex G4 structure was further established by polymerase stop assay. The compounds showed in vitro cytotoxicity in cancer cells (MCF) based on a cell viability assessment which undergoes oxidative lesions at a greater extent. Apoptosis is the mechanical pathway behind the cytotoxicity of cancer cells from the live‐dead staining trials. Modifications of cellular morphs, nuclear condensation, and fragmentation were observed in fluorescence microscopy upon treatment of these compounds. qRT‐PCR highlights gene transcriptional regulation genes containing G4 sequence after treatment of ligands. Apart from damaging G4 DNA, thermal stabilization caused by selective interactions is thought to block telomerase enzyme associated with telomere end and contribute to drug‐induced death in cancerous cell types. The insights expedite therapeutic development due to the extensive possibilities of changing ensuing groups on anthraquinones to improve efficacy, reduce cell toxicity, and increase specificity for G‐quadruplex DNA.

Replication Control of Human Telomere G-Quadruplex DNA by G-Quadruplex Ligands Dependent on Solution Environment.

The human telomere region is known to contain guanine-rich repeats and form a guanine-quadruplex (G4) structure. As telomeres play a role in the regulation of cancer progression, ligands that specifically bind and stabilize G4 have potential therapeutic applications. However, as the human telomere sequence can form G4 with various topologies due to direct interaction by ligands and indirect interaction by the solution environment, it is of great interest to study the topology-dependent control of replication by ligands. In the present study, a DNA replication assay of a template with a human telomere G4 sequence in the presence of various ligands was performed. Cyclic naphthalene diimides (cNDI1 and cNDI2) efficiently increased the replication stall of the template DNA at G4 with an anti-parallel topology. This inhibition was stability-dependent and topology-selective, as the replication of templates with hybrid or parallel G4 structures was not affected by the cNDI and cNDI2. Moreover, the G4 ligand fisetin repressed replication with selectivity for anti-parallel and hybrid G4 structures without stabilization. Finally, the method used, referred to as quantitative study of topology-dependent replication (QSTR), was adopted to evaluate the correlation between the replication kinetics and the stability of G4. Compared to previous results obtained using a modified human telomere sequence, the relationship between the stability of G4 and the effect on the topology-dependent replication varied. Our results suggest that native human telomere G4 is more flexible than the modified sequence for interacting with ligands. These findings indicate that the modification of the human telomeric sequence forces G4 to rigidly form a specific structure of G4, which can restrict the change in topology-dependent replication by some ligands.

Ruthenium Polypyridyl Complex Bound to a Unimolecular Chair-Form G-Quadruplex.

The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-[Ru(phen)2(qdppz)]2+ displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (htel21T18), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T10–T11–A12. The two remaining wide lateral loops are linked through a third K+ ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.

Sequence Effect on the Activity of DNAzyme with Covalently Attached Hemin and Their Potential Bioanalytical Application.

In this work we investigated the effect of a DNA oligonucleotide sequence on the activity of a DNAzyme with covalently attached hemin. For this purpose, we synthesized seven DNA-hemin conjugates. All DNA-hemin conjugates as well as DNA/hemin complexes were characterized using circular dichroism, determination of melting temperatures and pKa of hemin. We observed that hemin conjugation in most cases led to the formation of parallel G-quadruplexes in the presence of potassium and increased thermal stability of all studied systems. Although the activity of DNA-hemin conjugates depended on the sequence used, the highest activity was observed for the DNA-hemin conjugate based on a human telomeric sequence. We used this DNAzyme for development of “sandwich” assay for detection of DNA sequence. For this assay, we used electric chip which could conduct electricity after silver deposition catalyzed by DNAzyme. This method was proved to be selective towards DNA oligonucleotides with mismatches and could be used for the detection of the target. To prove the versatility of our DNAzyme probe we also performed experiments with streptavidin-coated microplates. Our research proved that DNAzyme with covalently attached hemin can be used successfully in the development of heterogeneous assays.

Early steps of oxidative damage in DNA quadruplexes are position-dependent: quantum mechanical and molecular dynamics analysis of human telomeric sequence containing ionized Guanine.

Early steps of oxidative damage in DNA quadruplexes are position-dependent: quantum mechanical and molecular dynamics analysis of human telomeric sequence containing ionized Guanine.

Early steps of oxidative damage in DNA quadruplexes are position-dependent: Quantum mechanical and molecular dynamics analysis of human telomeric sequence containing ionized guanine

Guanine radical cation (G•+) is a key intermediate in many oxidative processes occurring in nucleic acids. Here, by combining mixed Quantum Mechanical/Molecular Mechanics calculations and Molecular Dynamics (MD) simulations, we study how the structural behaviour of a tract GGG(TTAGGG)3 (hereafter Tel21) of the human telomeric sequence, folded in an antiparallel quadruple helix, changes when one of the G bases is ionized to G•+ (Tel21+). Once assessed that the electron-hole is localized on a single G, we perform MD simulations of twelve Tel21+ systems, differing in the position of G•+ in the sequence. When G•+ is located in the tetrad adjacent to the diagonal loop, we observe substantial structural rearrangements, which can decrease the electrostatic repulsion with the inner Na+ ions and increase the solvent exposed surface of G•+. Analysis of solvation patterns of G•+ provides new insights on the main reactions of G•+, i.e. the deprotonation at two different sites and hydration at the C8 atom, the first steps of the processes producing 8oxo-Guanine. We suggest the main structural determinants of the relative reactivity of each position and our conclusions, consistent with the available experimental trends, can help rationalizing the reactivity of other G-quadruplex topologies.

Investigation on the competition of duplex/ G-quadruplex/ i-motif in telomere sequences and c-MYC gene with a solid-state nanopore sensor

Apart from duplex helix, the coexisted noncanonical DNA may be involved in inhibiting DNA replication, and controlling gene expression. The competition of duplex/ G4/ i-motif depends on many factors, including sequence information, external conditions and binding effects. This work looked into the human telomere sequences of different length (hTelo-1, 2) and intramolecular G-rich and C-rich strands (hTelo-3, 4, 5). Nanopore translocation properties suggested that in the presence of their complementary sequences in the mixed K+/Cs+ buffer, G4 was the major species, and G4 from hTelo-2 that holds multiple G-quartets formed slower than shorter hTelo-1. The intramolecular G/C-rich strands hTelo-3, 4, 5 predominantly formed duplex rather than quadruplex under K+ or acidic conditions, indicating that intramolecular quadruplex is less stable than duplex due to the strand strain. Translocation behaviors of mixed proto-oncogene cMYC/c-cMYC illustrated that G4 was formed in both K+ and Cs+, and Cs+ inhibited the duplex formation in K+/Cs+ buffer. The increase of the ratio of Cs+ will decrease the duplexes species. Our work demonstrated the relative stability of duplex/quadruplex under various conditions with distinct strands, which is useful for the investigation of DNA secondary structural dynamics and transition mechanism in biological function regions, and paved the way for the potential of disease-targeted diagnosis.