A Biophysical Analysis on the Effect of Ligands on Fluorescently Active G‐quadruplex Structures

Abstract

The formation of G‐quadruplex (GQ), a non‐canonical nucleic acid secondary structure, can inhibit the elevated telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most of the biochemical processes involving GQs involve local conformational changes of GQs at the guanine tetrad (G4) level. Previously we developed a method to study the local conformations of individual G4 layers in GQs that uses 6‐methylisoxanthopterine (6MI), a Circular Dichroism (CD)‐active fluorescent base analogue of guanine. Using this method here we explore the local conformational changes of individual G4 layers in GQ‐drug interactions. Experiments were performed with human telomeric 22AG sequence (5′‐AGGGTTAGGGTTAGGGTTAGGG‐3′) where guanines at the positions 3,9,15 and 21 were site‐specifically replaced by 6MI monomers. The CD and fluorescence properties of the GQ structures with and without the ligands were characterized under various conditions. Thermal denaturation studies showed that properly positioned 6MI monomers and dimers in a GQ forming sequence can form stable GQs with CD‐active fluorescent G4 layers. The local conformation of individual fluorescent G4 layers in the GQ structure was then monitored by following the fluorescence intensity and circular dichroism changes of the incorporated probes. The results showed the interaction of ligands with the fluorescent G4 layer varied depending on the functional groups as well as the bulkiness of the ligand suggesting that there are multiple ways of G4‐ligand interaction.