Gelatin Sources Research Articles

Authentication of porcine, bovine, and fish gelatins based on quantitative profile of amino acid and chemometric analysis

Gelatin is a biological macromolecule derived from the partial hydrolysis of collagen protein. This paper describes a sensitive and rapid method for the detection of gelatin sources based on the composition of amino acids. Hydrophilic interaction liquid chromatography coupled with tandem mass spectrometry (HILIC-MS/MS) and chemometric tools such as principle component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) were used for the analysis and spectral classification, respectively. Twenty amino acids are identified and quantified with the limit-of-detection (LOD) of 0.03–2.62 μg/mL and limit-of-quantification (LOQ) of 0.10–7.93 μg/mL, a precision of 0.19–11.21% and 0.03–13.62% (%RSD) for intra and inter-day, respectively, and a total recovery of 85.1–107.6%. Porcine gelatin showed correlation with glycine, proline, hydroxyproline, tyrosine glutamine, and glutamic acid; Bovine gelatin was correlated with lysine, leucine, and isoleucine histidine, phenylalanine, and alanine, and fish gelatin showed correlation with methionine, threonine, serine arginine and cysteine in PCA analysis. Verification of the developed method was confirmed by using different commercial and laboratory prepared gelatin products containing gelatin and the samples were successfully categorized into their respective sources.

Comparative analysis of red skin Tilapia and bovine gelatins as halal alternatives in food industry

Gelatin plays a vital role in the food industry, serving as a thickening agent, emulsifier, wetting agent, and stabiliser. However, conventional sources like mammalian gelatin pose health and societal issues, while poultry gelatin can present risks related to avian flu. Our work was motivated by recent studies focusing on alternative gelatin sources, which prompted further investigation. Our study aimed to extract gelatin from red-skin Tilapia and bovine sources. Both types of gelatin underwent pre-treatment using 0.2 M sodium hydroxide (NaOH) and 0.05 M acetic acid (CH3COOH) at 27ºC, followed by water extraction at 60°C for 3 hours. Fourier-transform infrared (FTIR) analysis confirmed that the extracted gelatins exhibited peaks similar to commercial gelatin. The extracted fish gelatin (EFG) demonstrated superior gel strength compared to commercial fish gelatin (CFG), whereas commercial bovine gelatin (CBG) exhibited superior gel strength than extracted bovine gelatin (EBG). The protein content of EFG and EBG was comparable, but the fat content was significantly higher in EFG. The foaming capacity was also evaluated, with EFG showing greater capacity than EBG. Our work demonstrates excellent potential of alternative gelatin for usage in various applications and creates new opportunities for the food sector, particularly for halal food production.

GelMA synthesis and sources comparison for 3D multimaterial bioprinting.

Gelatin Methacryloyl (GelMA) is one of the most used biomaterials for a wide range of applications, such as drug delivery, disease modeling and tissue regeneration. GelMA is obtained from gelatin, which can be derived from different sources (e.g., bovine skin, and porcine skin), through substitution of reactive amine and hydroxyl groups with methacrylic anhydride (MAA). The degree of functionalization (DoF) can be tuned by varying the MAA amount used; thus, different protocols, with different reaction efficiency, have been developed, using various alkaline buffers (e.g., phosphate-buffered saline, DPBS, or carbonate-bicarbonate solution). Obviously, DoF modulation has an impact on the final GelMA properties, so a deep investigation on the features of the obtained hydrogel must be carried on. The purpose of this study is to investigate how different gelatin sources and synthesis methods affect GelMA properties, as literature lacks direct and systematic comparisons between these parameters, especially between synthesis methods. The final aim is to facilitate the choice of the source or synthesis method according to the needs of the desired application. Hence, chemical and physical properties of GelMA formulations were assessed, determining the DoFs, mechanical and viscoelastic properties by rheological analysis, water absorption by swelling capacity and enzymatic degradation rates. Biological tests with lung adenocarcinoma cells (A549) were performed. Moreover, since 3D bioprinting is a rapidly evolving technology thanks to the possibility of precise deposition of cell-laden biomaterials (bioinks) to mimic the 3D structures of several tissues, the potential of different GelMA formulations as bioinks have been tested with a multi-material approach, revealing its printability and versatility in various applications.

An investigation of water status in gelatin methacrylate hydrogels by means of water relaxometry and differential scanning calorimetry.

The relationship between molecular structure and water dynamics is a fundamental yet often neglected subject in the field of hydrogels for drug delivery, bioprinting, as well as biomaterial science and tissue engineering & regenerative medicine (TE&RM). Water is a fundamental constituent of hydrogel systems and engages via hydrogen bonding with the macromolecular network. The methods and techniques to measure and reveal the phenomena and dynamics of water within hydrogels are still limited. In this work, differential scanning calorimetry (DSC) was used as a quantitative method to analyze freezable (including free and freezable bound) and non-freezable bound water within gelatin methacrylate (GelMA) hydrogels. Nuclear magnetic resonance (NMR) is a complementary method for the study of water behavior and can be used to measure the spin-relaxation of water hydrogen nuclei, which is related to water dynamics. In this research, nuclear magnetic resonance relaxometry was employed to investigate the molecular state of water in GelMA hydrogels using spin-lattice (T1) and spin-spin (T2) spin-relaxation time constants. The data displays a trend of increasing bound water content with increasing GelMA concentration. In addition, T2 values were further applied to calculate microviscosity and translational diffusion coefficients. Water relaxation under various chemical environments, including different media, temperatures, gelatin sources, as well as crosslinking effects, were also examined. These comprehensive physical data sets offer fundamental insight into biomolecule transport within the GelMA hydrogel system, which ultimately are important for drug delivery, bioprinting, as well as biomaterial science and TE&RM communities.

Underused Marine Resources: Sudden Properties of Cod Skin Gelatin Gel.

The main object of this work was to characterize the structure and properties of laboratory-made fish gelatin from cod skin in comparison with known commercial gelatins of fish and mammalian origin. This is one way we can contribute to the World Food Program and characterize foodstuff resources from alternative natural sources. Our research was based on the combination of an expanded set of complementary physical-chemical methods to study the similarities and distinctions of hydrogels from traditional and novel gelatin sources from underused marine resources. In this work, we have compared the morphology, supramolecular structure and colloid properties of two commercial (mammalian and fish) gelatins with gelatin we extracted from cold-water cod skin in laboratory conditions. The obtained results are novel, showing that our laboratory-produced fish gelatin is much closer to the mammalian one in terms of such parameters as thermal stability and strength of structural network under temperature alterations. Especially interesting are our experimental observations comparing both fish gelatins: it was shown that the laboratory-extracted cod gelatin is essentially more thermally stable compared to its commercial analogue, being even closer in its rheological properties to the mammalian one.

Halal Alternative Sources of Gelatin: A Review

This article explores the growing interest in halal alternative sources of gelatin, driven by the need to provide suitable options for individuals adhering to Islamic laws. The overall methodology of this review involves a systematic examination using search engines from online databases, encompassing journals published from 2006 to 2023. The rationale for seeking alternatives beyond porcine gelatin is examined, considering religious and ethical considerations. Promising halal alternative sources are discussed, including animal-based gelatin, plant-based alternatives gelatin, aquatic animal-derived gelatin, microbial and fungal sources, as well as synthetic and recombinant gelatin. Each alternative is evaluated for its potential to meet halal requirements and applicability in various industries. The article also delves into the obstacles faced by the industry in adopting alternative gelatin sources, focusing on technological challenges and consumer acceptance. Technological challenges encompass replicating the functional properties of traditional gelatin, ensuring stability and shelf life, and addressing compatibility issues in diverse applications. Consumer acceptance and awareness pose challenges related to taste and texture perception, cultural and dietary preferences, and effective labelling and communication. Despite these challenges, the shift towards halal alternative sources of gelatin presents an opportunity for innovation in the food and pharmaceutical industries. It requires collaborative efforts between researchers, industry professionals, and regulatory bodies to overcome obstacles, ensure compliance with halal standards, and provide diverse consumer options following Islamic principles.

Influence of Gelatin Source and Bloom Number on Gelatin Methacryloyl Hydrogels Mechanical and Biological Properties for Muscle Regeneration.

Approximately half of an adult human's body weight is made up of muscles. Thus, restoring the functionality and aesthetics of lost muscle tissue is critical. The body is usually able to repair minor muscle injuries. However, when volumetric muscle loss occurs due to tumour extraction, for instance, the body will form fibrous tissue instead. Gelatin methacryloyl (GelMA) hydrogels have been applied for drug delivery, tissue adhesive, and various tissue engineering applications due to their tuneable mechanical properties. Here, we have synthesised GelMA from different gelatin sources (i.e., porcine, bovine, and fish) with varying bloom numbers, which refers to the gel strength, and investigated for the influence of the source of gelatin and the bloom number on biological activities and mechanical properties. The results indicated that the source of the gelatin and variable bloom numbers have an impact on GelMA hydrogel properties. Furthermore, our findings established that the bovine-derived gelatin methacryloyl (B-GelMA) has better mechanical properties than the other varieties composed of porcine and fish with 60 kPa, 40 kPa, and 10 kPa in bovine, porcine, and fish, respectively. Additionally, it showed a noticeably greater swelling ratio (SR) ~1100% and a reduced rate of degradation, improving the stability of hydrogels and giving cells adequate time to divide and proliferate to compensate for muscle loss. Furthermore, the bloom number of gelatin was also proven to influence the mechanical properties of GelMA. Interestingly, although GelMA made of fish had the lowest mechanical strength and gel stability, it demonstrated excellent biological properties. Overall, the results emphasise the importance of gelatin source and bloom number, allowing GelMA hydrogels to have a wide range of mechanical and excellent biological properties and making them suitable for various muscle tissue regeneration applications.

GELATIN IN HALAL PHARMACEUTICAL PRODUCTS

Since the Muslim population has increased around the world, they are more concerned about halal awareness. Therefore, there are a lot of emerging halal industries nowadays, and among them is halal pharmaceuticals. However, with the advancement of technology, gelatin-based products have been widely developed and are being used in the pharmaceutical industry. Nevertheless, its halal status can be questionable (mashbooh). Hence, this paper is aimed to study the Islamic perspective on gelatin-based products in pharmaceuticals. The study uses a qualitative method which involves a literature review from al-Quran, as-Sunnah, articles, journals, and some other references from the internet that can be trusted as data sources. Apart from that, the methodology of this study is by researching the istihalah method and fatwa in Malaysia to determine the halal status of gelatin in pharmaceutical products. Besides, this paper also focuses on the Malaysian Standard of Halal Pharmaceuticals- General Requirements (MS 2424:2019) and Malaysian Halal Certification Procedure Manual- Domestic 2020 (MPPHM 2020). The finding of this study shows that gelatin mostly comes from animal sources. Therefore, its halal status can be questionable even if it comes from permitted animals such as cows or chickens. This is because the animals are considered halal if they were slaughtered according to Islamic law only. Hence, to avoid religious concerns, there is a lot of research on the alternatives to animal gelatin such as from marine sources and plant-based sources. From the Islamic perspective, the use of gelatin from marine sources and animals that have been slaughtered according to Islamic rules is halal. However, gelatin sources from pork and its derivatives are still haram after going istihalah because its chemical substances remain the same and unchanged even after istihalah. Nevertheless, during an emergency, it is permissible to consume it accordingly if there is no replacement or alternative for pork gelatin even if it is from haram sources.

Gelatin extracted from jundiá skin (Rhamdia quelen): An alternative to the discarded by-product

The production of gelatin from by-products of the fishing industry values ​​the discarded raw material and serves a part of the population that does not consume products originating from mammals. Therefore, the objective of the research was to use the jundiá skin (Rhamdia quelen) (JS) to obtain gelatin (GJS) and characterize this product, not yet studied until the present moment. Thus, the extraction process showed a yield of 7.3 % for JS and 18.2 % for GJS (in wet weight). Both JS and GJS presented, in their composition, high concentration of protein (26.3 and 88.1 %), low levels of fixed mineral residue (1.0 and 1.9 %), lipids (1.7 and 1.5 %) and hydroxyproline content (1.5 and 7.2 %), respectively. The GJS dispersion had a pH value of 4.7 and the color analysis indicated a snow effect with a white appearance. Fourier transform infrared spectroscopy (FTIR) showed amide bands commonly found in gelatin, gel electrophoresis (SDS-PAGE) showed high molecular weight bands, differential scanning calorimetry (DSC) revealed a denaturation temperature of 69.4 °C and scanning electron microscopy (SEM) showed a compact and non-porous structure. The emulsifying property was high when subjected to a temperature of 80 °C for 30 min, while the foaming capacity was significant at a concentration of 1 %. The highest dispersivity was observed at pH 2.0 and, in this condition, the viscosity was higher than that of other gelatin sources (25.5 cP). In view of the above, attention is drawn to the use of JS as a raw material for obtaining gelatin and for the various possibilities of application.

The Employment of Real-Time Polymerase Chain Reaction for the Identification of Bovine Gelatin in Gummy Candy

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

Identification of peptide biomarkers for halal gelatin using bioinformatics techniques

Gelatin, a partial hydrolysis result of animal collagen, has been commonly utilized in the Indonesian food industry, yet a strict regulation regarding the origin of gelatin is applied due to religious concerns. Therefore, a procedure that identify the origin of gelatin is required. The purpose of this research was to estimate peptide biomarkers using a bioinformatics approach that applicable to identify different gelatin sources by means of mass spectrometry. Collagen sequences from cattle, pigs, chickens, and fish were collected from the UniProt database. The sequences were in silico digested using trypsin in PeptideMass software. The resulting peptides were filtered following the criteria for mass spectrometry. Trypsin digestion produced a high number of specific peptides. Some of the specific peptides has been identified and it has potential to distinguish the animal derived gelatin.

Physical and Mechanical Characteristics of Gelatin-Based Films as a Potential Food Packaging Material: A Review.

This review discusses the potential application of gelatin-based film as biodegradable food packaging material from various types of gelatin sources. The exploitation of gelatin as one of the biopolymer packaging in the food industry has rising interest among researchers as the world becomes more concerned about environmental problems caused by petroleum-based packaging and increasing consumer demands on food safety. Single gelatin-based film properties have been characterized in comparison with active and intelligent gelatin-based composite films. The physical properties of gelatin-based film such as thickness, color, and biodegradability were much influenced by total solid contents in each film. While, for mechanical and light barrier properties, poultry-based gelatin films have shown better properties compared to mammalian and marine gelatin films. This paper detailed the information on gelatin-based film characterization in comparison with active and intelligent gelatin-based composite films. The physical properties of gelatin-based film such as color, UV-Vis absorption spectra, water vapor permeability, thermal, and moisture properties are discussed along with their mechanical properties, including tensile strength and elongation at break.

Pangasius Fish Skin and Swim Bladder as Gelatin Sources for Hard Capsule Material.

In this paper, we report the extraction and characterization of gelatin from the abundant industrial fishery waste of Pangasius skin and swim bladder and its application as the base material for hard capsule shells. The yield of gelatin ranged between 19 and 23%, content of moisture is 7.6–9.2%, ash is 1.1–1.7%, pH is 4.1–5.2, gel strength is 238–278 bloom, and viscosity is 65–74.7% mP. SDS-PAGE showed all gelatins have chains of α1, α2, and β-peptides. The skin, swim bladder, and mixed gelatins were successfully used in the production of hard capsule shells. The dimensions, weight, disintegration time, and water content properties of the hard capsules from these Pangasius wastes were akin to the standards of commercial capsules.

Identification of bovine, porcine and fish gelatin signatures using chemometrics fuzzy graph method

Gelatin is a protein substance that is widely used in food and pharmaceutical industries. Gelatin is mainly derived from bovine and porcine sources. Fish gelatin is becoming alternative source of gelatin due to concern on health issue and religious constraints. Numerous studies for identification of gelatin sources have been reported. In this study, Fourier transform infrared (FTIR) spectroscopy was used in combination with chemometrics fuzzy autocatalytic set (c-FACS) to distinguish between bovine, porcine and fish gelatins. The gelatin spectra at Amide and 1600–1000 cm−1 regions were analyzed using c-FACS and the results were compared to principal component analysis (PCA) and linear discriminant analysis (LDA). The results obtained from c-FACS method showed that each bovine, porcine and fish gelatin possessed dominant wavenumbers at 1470–1475 cm−1, 1444–1450 cm−1 and 1496–1500 cm−1 respectively, which represent their unique signatures. Furthermore, a clear distinction for porcine gelatin was observed in coordinated FACS. The c-FACS method is rigor and faster than PCA and LDA in differentiating the gelatin sources. The novel method promises at least another chemometrics method for FTIR related analysis and the possibilities for other applications are endless.

Gelatin from Milkfish Scales for Food Application

The amount of gelatin used worldwide in the food industry is increasing annually. Recovery of valuable components from fish processing-by products could help solve problems on tons of wastes produced each year and address religious beliefs like Islam and Judaism as well as the fear of mad cow disease. In this study, gelatin was extracted from milkfish scales for food application. The physical properties (yield, strength, color, clarity and pH) of extracted gelatin were studied and compared with commercially-available bovine gelatin. Marshmallows were developed from these gelatin sources. Sensory evaluation was done to determine the appropriateness of the level of a specific attribute and the consumer’s preference using the nine-point hedonic and just about right (JAR) scales. The extracted fish gelatin was comparable to bovine gelatin in terms of strength but they differ in terms of color, clarity and pH. The fish gelatin had a yield of 8.7%, high bloom value of 505g, white appearance and an acidic pH (5.25). The marshmallow developed from fish gelatin is comparable to bovine gelatin in all attributes (color, aroma, texture, taste, sweetness and aftertaste) except for sweetness. Overall, the gelatin extracted from milkfish scales can be used as an alternative to bovine gelatin for food application such as in marshmallow production.

Fish gelatin as an alternative to mammalian gelatin for food industry: A meta-analysis

Gelatin is prepared from heat denaturation and partial hydrolysis of collagen from mammalian sources and is a common ingredient in the food industry. Diet restrictions of porcine gelatin due to culture and/or religion, and the health safety concerns due to an onset of zoonotic disease in cattle from earlier period, have led to the search for alternative gelatin sources. The most extensively studied alternatives with high potential are fish and fish by-products. However, fish gelatin application in the food industry is still limited due to inferior performance in gelling ability. The gel strength values of the warm-water and cold-water fish gelatin compared to mammalian gelatin, were evaluated by meta-analysis to determine their potential as an alternative. Through rigorous screening of the extraction and gel strength determination methods, a total of 13 studies were included in the analysis. The mean gel strength of fish gelatin was significantly lower in comparison to mammalian gelatin (p < 0.05). Interestingly, the warm-water fish skin gelatin was the only sample group with a combined effect estimate point that overlapped and extended pass the null effect line, making it the most suitable substitute of mammalian gelatin in food gel preparation when compared to other fish gelatins.

Detection of Pork Gelatin in Jelly Candy Using Fourier Transform Infrared (FTIR) and Polymerase Chain Reaction (PCR)

This study aims to identify the content of pork gelatin in jelly candy using Fourier Transform Infrared (FTIR) and Polymerase Chain Reaction (PCR) methods. This method provide information to the public in choosing halal and tested food products. By uses a stepwise cluster survey method to obtain a sample then the samples obtained were isolated in gelatin, analyzed using the FTIR spectrophotometer method, and continued with data analysis using PCA (Principal Component Analysis). In addition, DNA detection analysis of pork gelatin was carried out using the PCR method. The results of the study were FTIR spectrum at wavelengths of 1450 – 1300 cm-1, 1543 cm-1, and 2800-3000 cm-1. The classification of gelatin sources in jelly candy with PCA resulted in the proportion value of Principal Component 1 (PC 1) of 39%, the value of the proportion of Principal Component 2 (PC 2) of 31%, the value of the proportion of Principal Component 3 (PC 3) of 14.5% and the cumulative value of PC 1, PC 2, and PC 3 is 84.5%. DNA amplification of jelly candy samples by PCR proved that all jelly candy samples A, B, C, D, and E did not contain pork.

Utilization of mucilage extracted from taro tubers (Colocasia esculenta) in canned beef

The commercial gelatin is not accepted from some Muslim community because it might be extracted from pig. This issue led to searching for alternative gelatin sources. This study aims to investigate the possibility of utilization of natural binders extracted from plant sources such as mucilage extracted from taro (Colocasia esculenta) as an alternative gelatin in different concentrations (1, 2 and 3%) in canned beef products. In this study we evaluated the physical properties, minerals (K, P, Na, Ca, Zn, Pb and Cd), antioxidant activity and total phenolic for taro mucilage. Chemical quality characteristics, texture profile, microbiology analysis and sensory evaluation were evaluated in the canned beef products. The comparison study between taro mucilage treatments and commercial gelatin showed the taro mucilage (TM2) had a higher value of emulsion capacity (35.71 g water/g sample) and oil absorption (2.84 g oil/g sample) than gelatin (14.28 g water/g sample), (0.8 g oil/g sample); respectively. Water absorption values were higher in the commercial gelatin (37.80g water/g sample), compared to the taro mucilage treatments (TM1, TM2 and TM3) that were 23.48, 24.28 and23.20g water/g sample, respectively. Viscosity value was higher in taro mucilage treatment (TM2) (625cp) compared to the other all treatment. The total phenolic content in taro mucilage was 32.2mg gallic acid/g). In conclusion, adding hydrocolloid material (taro mucilage) to canned meat improved the stability of the samples during storage at room temperature for six months. On the other side, this material improved the texture profile, and organoleptic properties of canned beef.

A Fuzzy Graph Based Chemometrics Method for Gelatin Authentication

Graph theory is a well-established concept that is widely used in numerous applications such as in biology, chemistry and network analysis. The advancement in the theory of graph has led to the development of a new concept called fuzzy autocatalytic set. In this paper, a fuzzy graph-based chemometrics method, namely, chemometrics fuzzy autocatalytic set (c-FACS) is developed and applied for gelatin authentication. The issue on authenticity of gelatin has become a sensitive issue among some religious communities. Due to the matter, Fourier transform infrared (FTIR) spectra of bovine, porcine and fish gelatins are analyzed using c-FACS to identify their signatures and differences and presented in this paper. The results from the c-FACS analysis showed distinct features of each gelatin, particularly porcine. Furthermore, the new method is faster than principal component analysis (PCA) in identifying the gelatin sources.

Желатин: источники, получение и применение в пищевой промышленности и биомедицине

Gelatin is a proteinaceous substance composed of all the essential amino acids (except tryptophan) and derived from collagen using a hydrolysis technique. Hydrogels and modified composites based on gelatin are widely used in the food industry, biomedicine, pharmaceutical industry and food packaging materials due to their biocompatibility, biodegradability, nonimmunogenicity and ability to stimulate cell adhesion and proliferation. Gelatin can absorb 5-10 times its weight of water and is the main ingredient of hard and soft capsules in pharmaceutical industry. It melts above 30°C and easily releases biologically active compounds, nutrients and drugs in human gastrointestinal tract. In addition, gelatin contains arginine-glycine-asparagine RGD-sequences in the polymer structure and contributes to various functions such as antioxidant, anti-hypertensive, anti-microbial, tissue regeneration, wound healing, enhances bone formation and anti-cancer therapy. This article reports a brief overview of gelatin sources, gelatin preparation processes and its physico-chemical properties, as well as advances in the preparation of gelatin-based composite materials and hydrogels for tissue engineering, drug delivery, wound dressings, active packaging using various cross-linking techniques.