Abstract

Gelatin is a hydrocolloid widely used in food products, especially soft candy. It contains essential amino acids - except tryptophan - which is easily digested, not toxic, can form a flexible and robust film layer to produce the right product. However, as a Muslim, it must ensure that what is consumed is halal, from bovine gelatin. The purpose of this study was to identify bovine gelatin in soft candy products using specific primers with real-time PCR methods. The specific DNA primer design is done with PRIMERQUEST and NCBI software and subjected to primer-basic local alignment search tool (BLAST). Analysis for the primer specificity was performed on fresh tissue (cows, pigs, dogs, chickens, goats, and rats) and gelatin sources (beef and pork). RT-PCR method using primer mitochondrial Cytochrome B gene was applied to analyze candies purchased from the market. The method is expected to be specific, sensitive, and reliable for analyzing bovine DNA in candy products. Amplification was also performed on soft candy reference from bovine gelatin. A sensitivity test was performed by measuring amplification at six dilution series (10000, 5000, 1000, 500, 50, and 10 pg) on bovine gelatin candies. The results show that the real-time PCR with primer mitochondrial cytochrome-B gene specifically able to identify the presence of bovine DNA in fresh tissue and gelatin sources at optimum annealing temperature 55,2°C. The limit of detection of porcine DNA was 500 pg. The standard curve of the serial dilution of the bovine gelatin DNA isolate produces a correlation coefficient R-value of 0.992 and an efficiency value (E) of 93.1%. Four products from the market were examined by using the primer showed three bovine DNA was detected. Real-time PCR using cytochrome-B DNA bovine primer (forward: ACTAGCCCTAGCCTTCTCTATC; reverse TGTCAGTAGGTCTGCTACTAGG) can be used for the Analysis of halal soft candy.

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.