Disclosure Of Secrets Research Articles

Counteraction to High Treason in Russian Legislation of the Second Half of the 19th — Early 20th Centuries

The problem of improving the criminal liability of the subjects of the Russian Empire at the end of the nineteenth century for espionage and spilling state secrets to a foreign state is considered. The relevance of the study is due to the importance of the problem under study for the effective functioning of the Russian state. The study is based on historical sources of a regulatory and legal nature and is interdisciplinary in nature. Particular attention is paid to the study of legal norms, the identification of the type and amount of punishments for the commission of espionage by Russian citizens and spilling the state secrets to a foreign state. It is indicated that in the second half of the 19th century, the intensity of intelligence of foreign secret services in the territory of the Russian Empire increased. It is noted that more and more often foreign powers involved Russian subjects in the process of obtaining Russian secrets. At the same time, the analysis of the sources made it possible to reveal a sufficient limitation of the institution of counteracting espionage and disclosure of state secrets to foreign states in the Russian Empire at the end of the 19th century. It is proved that it was precisely these phenomena at the end of the 19th and the beginning of the 20th centuries that determined the authorities’ desire to progressively improve legal mechanisms that counteract threats and challenges to national security.

Delitos informáticos en el Código penal argentino

La evolución de la tecnología de la información y la comunicación (TIC) ha propiciado el nacimiento de un contexto criminógeno y, con ello, la incorporación de nuevos tipos penales. Este trabajo se propone analizar los tipos penales regulados en el Código penal argentino que se cometen mediante el uso de TIC. Estos tipos penales son producción, distribución y tenencia de pornografía infantil; ciberacoso sexual de menores; violación de correspondencia digital; acceso ilegítimo a datos o a sistema informático; publicación ilegal o abusiva de comunicación electrónica; revelación de secretos oficiales; acceso ilegítimo, difusión o alteración de datos personales; estafa o fraude informático; daño en datos y sistemas informáticos; interrupción o entorpecimiento de comunicaciones electrónicas; y alteración de medios probatorios

“Thanks for Telling Me”: The Impact of Disclosing Sex Secrets on Romantic Relationships

This research investigated the relationship consequences of disclosing sexual secrets to a romantic partner. Analyses of data from a 39-item Internet questionnaire completed by 195 undergraduate students showed that revealing sex secrets to a romantic partner was associated with either neutral or positive relationship outcomes. Disclosure of sexual secrets almost never (< 5%) resulted in relationship dissolution and over a third of the sample reported that they appreciated the honest disclosure. In addition, keeping sex secrets was related to lower relationship satisfaction such that each additional sex secret being kept from a romantic partner was associated with a one-half point loss of satisfaction (on a 5-point relationship satisfaction scale). This decrease persisted when controlling for sex and race. Mediation analyses found support for the notion that the type of romantic relationship an individual is in explains part of the association between keeping secrets and relationship satisfaction. Implications and future research considerations are suggested.

Secretless pastry chefs on Instagram: the disclosure of culinary secrets on social media

PurposeInformed by Mihaly Csikszentmihalyi’s systems view of creativity and Chad Borkenhagen’s conceptualization of open source cooking, this study explored how a group of extraordinary pastry chef used Instagram to openly express creativity, disseminate knowledge and reveal culinary secrets. The subsequent impacts of such actions were also assessed.Design/methodology/approachA qualitatively driven mixed-method approach was conducted using a nested mixed-method design. A total of 2,456 Instagram posts were visually analyzed alongside a series of interviews with elite pastry chefs over a two-year period.FindingsAnalysis distilled three themes that delineated how elite pastry chefs express creativity and share knowledge mindfully, ethically and altruistically on Instagram. The findings also converged to form a new theoretical model, “systems view of culinary creative sharing,” which accounts for the multifaceted considerations of culinary knowledge sharing on social media.Research limitations/implicationsFindings converged to form a systems view of culinary knowledge sharing. This is peculiarly useful for scholars who are interested in developing a greater understanding about “where and how” creative ideas and knowledge originate, disseminate and receive corroborations in the contemporary digital era.Originality/valueThis study highlighted that a new praxis of open sharing looms large in the culinary profession. This praxis symbolizes a movement away from the traditional mindset of safeguarding culinary secrets and toward a more transparent and open philosophy toward knowledge sharing in the culinary community.

Ultralightweight resilient mutual authentication protocol for IoT based edge networks

Confidentiality and authentication are primary concerns of RFID (Radio Frequency IDentification) based identification systems. Low cost, non sight-line scanning capability, unique identification and functional haste make RFID systems much more suitable for supply chain management and IoT networks, compare to barcodes and magnetic tapes. Since, RFID tags can be scanned from a greater distance over a radio channel which is easily accessible for adversaries, therefore numerous Ultralightweight Mutual Authentication Protocols (UMAPs) have been proposed to ensure the security of the RFID systems in a cost effective way. These UMAPs mainly involve low cost bitwise logical ( $$Triangular$$ ) operations such as $$XOR, AND OR$$ etc., usually these logical operations offer poor diffusion properties and hence result in disclosure of the concealed secrets. Almost all of the previous UMAPs have certain pitfalls and reported to be susceptible to Denial of Service, traceability, full disclosure and cloning attacks. In this paper, we propose a new UMAP that is resilient to structured and unstructured cryptanalysis techniques. The proposed Ultralightweight Resilient Mutual Authentication Protocol (URMAP) avoids all the pitfalls and unbalanced operators in its design that were the main reasons of failure of previous UMAPs. The incorporation of ultralightweight primitives; $$Per{\text{-}}XOR$$ ( $${P}_{x})$$ and $$Inverse Per{\text{-}}XOR$$ $$({ P}_{x}^{-1})$$ makes the protocol messages more resistant to all types of adversaries. The security and privacy capabilities of URMAP are evaluated through formal analysis. The results of GNY Logic analysis prove that the proposed protocol is resilient to all possible attack scenarios thus ensuring optimal confidentiality, integrity and availability services.

УГОЛОВНАЯ ОТВЕТСТВЕННОСТЬ ЗА НАРУШЕНИЕ РЕЖИМА КОНФИДЕНЦИАЛЬНОСТИ В РОССИЙСКОМ И ЗАРУБЕЖНОМ ЗАКОНОДАТЕЛЬСТВЕ

The subject of the work is the status and prospects of criminal law liability for various violations of the special legal regime of legally protected secrets. Considering the specifics of criminal liability for violation of confidentiality of information, experts traditionally focus on certain legally protected secrets and a detailed analysis of the relevant corpus delicti, which does not allow to cover the problem of protection of information of limited access by criminal law means as a whole. The author of this article performed a comprehensive legal analysis of criminal liability for violation of legal regime of secrets protected by law and other restricted information on the basis of a set of unlawful acts of non-compliance with the requirements of the regime. Methodologically, the study is based on a set of modern general scientific and private legal methods. It is based on the comparative legal method, which allows to compare the norms of criminal legislation of Russia, CIS countries, European and other states. The author draws attention to the existing differences and notes that some provisions of the modern Russian criminal law do not meet the requirements of the time, modern challenges and threats of the global information society in the conditions of building a digital economy. Based on a generalized analysis of the regulatory legal framework of the Russian Federation, foreign states and existing doctrinal views, the conclusion is made about the unsystematic composition of crimes aimed at violating the legal regime of secrets protected by law and other information of limited access. The author additionally notes the need to separate eco-nomic espionage and intentional disclosure of trade secrets into separate corpus delicti. Certain shortcomings of the Russian criminal law is the lack of corpus delicti aimed at the protection of legal regimes of professional and official secrets, personal data. Taking into account changes in the attitude to the institution of adoption and global trends in the protec-tion of children's rights, the possibility of decriminalisation of the disclosure of adoption secrets in modern conditions has been argued. The above and other problems identified in Russian criminal law with regard to the protection of legally established secrets and other restricted information are aimed at improving criminal legislation.

Organizational and legal security of business trade secrets

The article is dedicated to the study of legal and illegal acquisition, use and disclosure of trade secrets of business, in the context of the application of security conditions. It is established that a comprehensive analysis of the provisions of the Directive and legislation of Ukraine on the protection of trade secrets indicates the relevance of clarifying certain issues of the protection of trade secrets of businesses in Ukraine, which as a consequence will ensure a high level of security conditions. The conceptual and categorical apparatus of trade secrets and the normative and legal basis for ensuring international cooperation, respectively, was investigated. A practical set of measures to ensure the confidentiality of trade secrets of business was substantiated. As a result of scientific research, the essential and substantive characteristics of the provision of the Directive as the main legal vector of ensuring security conditions have been identified. The provisions that should be taken into account when protecting the trade secret of the business are highlighted, namely: clarification of the procedure for securing the claim and precautionary measures; protection of trade secrets during court proceedings; clarification of legislation regarding the disclosure of trade secrets in the public interest, etc. It is determined that the current procedural legislation also requires improvement in the issue of ensuring in any type of judicial proceedings to limit access to materials that contain information constituting a business secret, in particular, by determining the circle of persons who will have access as such and the opportunity to become familiar with the materials of the case. Based on this, the implementation of the legal aspects of international cooperation in the context of secure measurement of trade secrets is demonstrated. The adoption of the Law provides for the confidentiality of court proceedings. In civil proceedings, authorizing the transfer of jurisdiction to certain specialized courts in cases of breaches of business secrets, the ability to classify litigation as confidential at the request of one party, and the potential limitation of the number of persons entitled to access evidence and / or hearings.

Disclosure of the secret of adoption: certain aspects of differentiating with other offenses

Disclosure of the secret of adoption: certain aspects of differentiating with other offenses

Захист комерційної таємниці в контексті стратегічного управління економічною безпекою організації в умовах цифровізації економіки

The article substantiates the relevance of developing the mechanism for protecting commercial secrets of the organization in the system of strategic management of economic security of the organization, taking into account the transformational changes in the economy. Using the methods of synthesis and analysis, logical and generalizing methods, the authors determined the essence and basic features of the concept of "commercial secret" in both legal and scientific literature. The most common threats to commercial secrets have been identified and the sources of threats to the leakage of confidential information have been identified, taking into account the digitalization of economic processes. Four areas of protection of commercial secrets of an organization have been identified: legal, organizational, technical and psychological. The importance of providing valuable information in the strategic perspective of commercial secrets for the formation of the basis for its protection in future were highlighted, as well as those responsible for protecting this information with the consolidation of duties and responsibilities in collective and employment agreements were identified. In the context of formation of an effective system of strategic management of economic security of organizations in the conditions of transformational changes the directions of improvement of protection of a commercial secret are offered. Taking into account a growing share of cyber fraud and transition to the preservation of information mainly on digital media, the urgency of enhanced protection increases. Thus, the formation of information security using advanced technologies and equipment, attracting highly qualified specialists in this field, monitoring to identify potential sources of information leakage and eliminate them. Considering that most common source of disclosure of trade secrets is the staff of the organization, it is proposed to form a long-term loyalty of employees and their understanding of the importance of protecting confidential information, the introduction of socially oriented personnel strategy.

THEORY AND PRACTICE OF UNFAIR COMPETITION IN UKRAINE

The article considers the concept of fair and unfair competition from the point of view of different scientists. Concepts and types of measures that contradict trade and other fair business practices are revealed, namely: illegal use of the business reputation of the business entity, creation of obstacles in the competitive process and achievement of illegal competitive advantage and collection, disclosure and use of trade secrets. characteristics of these instructions. The essence of the influence of various factors on the conditions of development of competitive positions in the economy of Ukraine is revealed. The state policy on restriction of monopoly and development of competition as an integral part of internal economic and social policy of the state is considered. An analysis of the dynamics of the main structural competitive conditions in the economy of Ukraine. The number and structure of terminated violations of unfair competition are explained. The main goals and objectives of the Antimonopoly Committee of Ukraine, directions of antimonopoly policy are established. The directions of improvement of activity of bodies of the Antimonopoly committee concerning regulation of consequences of non-price competition in Ukraine are established. It should be noted that one of the methods of protection against unfair competition is to conduct antitrust activities, ie the activities of individual companies (legal entities and individuals) aimed at creating and maintaining a competitive environment, especially competitive relations. The mechanisms of protection against unfair competition provided by the current legislation of Ukraine are stated. The factors influencing the choice of methods to protect the company from unfair competition are identified. The main problems of introduction of the EU competition legislation into the legislation of Ukraine are analyzed. In particular, it is noted that in order to deepen relations with the EU, regulatory norms must be improved in accordance with European standards. In analyzing the rules of competition law, their complexity is highlighted and it is emphasized that the competition law of Ukraine contains rules, categories and institutions of several branches of law governing relations of different content using the rules of substantive and procedural law.

Conditional Disclosure of Secrets: Amplification, Closure, Amortization, Lower-bounds, and Separations

In the conditional disclosure of secrets (CDS) problem [Gertner et al., J. Comput. System Sci., 60 (2000), pp. 592--629] Alice and Bob, who hold inputs $x$ and $y$, respectively, wish to release a ...

Questioning the Security of Three Recent Authentication and Key Agreement Protocols

Providing the desired security for constrained devices in the edge of Internet of Things (IoT) systems is a challenging task. Given that those devices are in shortage of the area and energy, many lightweight and ultra-lightweight protocols have been proposed so far in the literature. On the other hand, while we see many new proposals in the literature to secure communications on IoT systems, security analysis of those schemes has not received enough attention. Hence, in this paper, we analyse the security of three recently protocols for constrained environments and show their security loopholes. The analysed schemes include two protocols which have been published by IEEE Access and a recently proposed protocol entitled Extremely Good Privacy (EGP). The designers of all those protocols claimed optimal security against active adversaries. However, in this paper, we propose an efficient secret disclosure attack against EGP that recovers the whole secret parameters of the protocol after eavesdropping/blocking several sessions of the protocol and doing some off-line computations. The probability of the adversary to recover whole 2l secret parameters of the tag after eavesdropping/blocking 68 sessions of the protocol is 0.99, targeting a 128-bit security level by l=128. In addition, we show that an adversary can efficiently desynchronize the target tag from the reader/server in polynomial time. In the case of the other protocols, we also present efficient attacks that contradict the designers' security claims.

An Improved Blockchain-Based Authentication Protocol for IoT Network Management

Communication security between IoT devices is a major concern in this area, and the blockchain has raised hopes that this concern will be addressed. In the blockchain concept, the majority or even all network nodes check the validity and accuracy of exchanged data before accepting and recording them, whether this data is related to financial transactions or measurements of a sensor or an authentication message. In evaluating the validity of an exchanged data, nodes must reach a consensus in order to perform a special action, in which case the opportunity to enter and record transactions and unreliable interactions with the system is significantly reduced. Recently, in order to share and access management of IoT devices information with distributed attitude a new authentication protocol based on blockchain is proposed and it is claimed that this protocol satisfies user privacy preserving and security. However, in this paper, we show that this protocol has security vulnerabilities against secret disclosure, replay, traceability, and Token reuse attacks with the success probability of 1 and constant complexity of also 1. We also proposed an improved blockchain-based authentication protocol (IBCbAP) that has security properties such as secure access management and anonymity. We implemented IBCbAP using JavaScript programming language and Ethereum local blockchain. We also proved IBCbAP’s security both informally and formally through the Scyther tool. Our comparisons showed that IBCbAP could provide suitable security along with reasonable cost.

ОСОБЛИВОСТІ СТИГМАТИЗАЦЇЇ ОСІБ З ПСИХІЧНИМИ ПОРУШЕННЯМИ СТУДЕНТАМИ-ПСИХОЛОГАМИ

Introduction . Stigmatization of mental disorders and discrimination against people with mental disorders remain the most persistent obstacles to improving the quality of life of these people. Stigmatization is the cause of deteriorating health due to untimely access to professional help . People prefer to hide their mental health disorders from others and from themselves. Stigmatization exacerbates the negative feelings of the patient and his family, in particular, the fear of social relationships due to fear of disclosure of secrets, fear of being ridiculed, fear of social exclusion, guilt. Purpose . The aim of the study is to identify the tendency of student psychologists to stigmatize people with mental disorders and to find its correlations with the psychological features of young people. Methods . Psychodiagnostic methods used in the study : Sixteen Personality Factor Questionnaire, 16PF (R. B. Cattell); Рersonality self-esteem ( Н. Kazantseva ); State-Trait Anxiety Inventory, STA (C. Spielberger); Level of reflexivity scale (А. Karpov ) , Tolerance of ambiguity scale (S. Budner) ; The Interpersonal Diagnosis of Personality (T. Leary) . An author's questionnaire was developed to identify the features of stigmatization . Originality . The study of the specifics of stigmatization of mental pathology by students-psychologists will allow specialists of psychological services to develop and implement effective programs to prevent and overcome this problem. Conclusion . Increased trait- anxiety does not correlate with a change in perceptions of mentally ill people. T rait - anxiety increases with decreasing self-esteem . As tolerance of ambiguity decreases, the negative perception of people with mental disorders increases. It is known that the experience of uncertainty, incomprehensibility of the situation causes an increase in reactive anxiety, which is difficult to regulate because it is intense, and the sources of its occurrence are often beyond human consciousness. To avoid or reduce such anxiety a person needs to quickly navigate the situation, name, define, predict . In such In such situations, a person tends to think stereotypically, because it is a fast and economical way to predict events. With the increase of reflection for students of psychology, the importance of scientific information about mental pathology increases. With the increase in the level of reflection of psychology students, they tend to rely on scientific information about mental pathology. This may indirectly indicate a reduction in stigma A correct understanding of the causes of mental pathology, symptomatology, ways of helping and ways of establishing communication with persons who have mental disorders, reduces fear, promote to unconditional acceptance of another person. The above is an important competence of a psychologist

On the Power of Amortization in Secret Sharing

Consider the following secret-sharing problem: A file s should be distributed between n servers such that (d-1)-subsets cannot recover the file, (d+1)-subsets can recover the file, and d -subsets should be able to recover s if and only if they appear in some pre-defined list L . The goal is to minimize the information ratio—that is, the number of bits stored on a server per each bit of the secret. We show that for any constant d and any pre-defined list L , if the file is sufficiently long (exponential in n d ), the problem can be solved with a constant asymptotic information ratio of c d that does not grow with the number of servers n . This result is based on a new construction of d -party conditional disclosure of secrets for arbitrary predicates over an n -size domain in which each party communicates at most four bits per secret bit. In both settings, previous results achieved a non-constant information ratio that grows asymptotically with n , even for the simpler special case of d = 2 . Moreover, our constructions yield the first example of an access structure whose amortized information ratio is constant, whereas its best-known non-amortized information ratio is sub-exponential, thus providing a unique evidence for the potential power of amortization in the context of secret sharing. Our main result applies to exponentially long secrets, and so it should be mainly viewed as a barrier against amortizable lower-bound techniques. We also show that in some natural simple cases (e.g., low-degree predicates), amortization kicks in even for quasi-polynomially long secrets. Finally, we prove some limited lower bounds and point out some limitations of existing lower-bound techniques.

Особливості тактики проведення слідчих (розшукових) дій під час розслідування незаконного збирання та розголошення комерційної або банківської таємниці.

Проблема розкриття та здійснення досудового роз-слідування, зокрема, і проведення слідчих (розшуко-вих) дій у кримінальних провадженнях, розпочатих за фактами незаконного збирання з метою викори-стання або використання відомостей, що становлять комерційну таємницю суб’єкта господарської діяльно-сті, а також розголошення комерційної таємниці, без-перечно є. Вона зумовлена відсутністю достатніх пра-вових знань з організації та методики розслідування, тактики проведення слідчих (розшукових) дій слідчи-ми органами, а також відсутністю юридичної літерату-ри та наукових розробок із цієї тематики.У статті частково розкрито та проаналізовано першо-чергові слідчі (розшукові) дії, які необхідно проводити при отриманні інформації про факти незаконного збиран-ня з метою використання або використання відомостей, що становлять комерційну або банківську таємницю. Водночас у статті виокремлені типові слідчі ситу-ації, характерні для початкового етапу розслідування незаконного збирання та розголошення комерційної або банківської таємниці, та встановлено, що черговість слідчих (розшукових) дій у кримінальних проваджен-нях, розпочатих за фактами незаконного збирання з метою використання або використання відомостей, що становлять комерційну таємницю або банківську таємницю, а також розголошення комерційної або бан-ківської таємниці, їх послідовність залежить від кон-кретної слідчої ситуації, що склалася на початковому етапі розслідування.Вперше визначено, які саме слідчі (розшукові) дії необхідно проводити в першу чергу в процесі розсліду-вання незаконного збирання з метою використання або використання відомостей, що становлять комерційну таємницю або банківську таємницю. Розглянуто про-цесуальний порядок та тактику їх проведення.Проведення вказаних слідчих (розшукових) дій із дотриманням наукових рекомендацій та врахуванням певних тактичних особливостей сприятиме отриманню криміналістично значимої доказової інформації вже на початковому етапі розслідування незаконного зби-рання та розголошення комерційної таємниці.

Secure Timestamp-Based Mutual Authentication Protocol for IoT Devices Using RFID Tags

Internet of Things (IoT) is playing more and more important roles in our daily lives in the last decade. It can be a part of traditional machine or equipment to daily household objects as well as wireless sensor networks and devices. IoT has a huge potential which is still to be unleashed. However, as the foundation of IoT is the Internet and all the data collected by these devices is over the Internet, these devices also face threats to security and privacy. At the physical or sensor layer of IoT devices the most commonly used technology is RFID. Thus, securing the RFID tag by cryptographic mechanisms can secure our data at the device as well as during communication. This article first discusses the flaws of our previous ultra-lightweight protocol due to its vulnerability to passive secret disclosure attack. Then, the authors propose a new protocol to overcome the shortcomings of our previous work. The proposed scheme uses timestamps in addition to bitwise operation to provide security against de-synchronization and disclosure. This research also presents a security and performance analysis of our approach and its comparison with other existing schemes.

“Therefore I Have Removed the Veil”: Disclosure of Secrets in Eleventh-Century Islam and the Literary Character of Maimonides’s Guide

AbstractThis article investigates Maimonides’s ethos of disclosing “secrets” and explores its Islamic origins, focusing on sources neglected by earlier scholarship concerning the Guide of the Perplexed. I turn from the prevalent method by which the Guide has been studied for decades, namely, as a work at the core of which lie strategies and an ethos of concealment. In lieu of the conventional method, I go in a very different direction by inquiring into the modes that Maimonides used in fashioning his Guide as a work that involves a self-proclaimed exceptional act of revelation of secrets and a breach of the boundaries of concealment. The resulting textual investigation demonstrates that clusters of motifs presented in these sources, as well as structures of arguments, were retained in their cultural migration. This exploration allows me to illuminate new aspects of the question of the genre of Maimonides’ Guide, its sources, and its author’s intertextual art of writing.

A disclosure of hidden secrets in human cytomegalovirus: An in-silico study of identification of novel genes and their analysis for vaccine development

Human cytomegalovirus (CMV), has a largest, linear double stranded DNA genome of 236Kbps. It causes adverse congenital infections, resulting in morbid, irreversible CNS associated pathologies. Present study deals with in-silico human CMV genome analysis for novel genes identification and their analysis, for expressed protein structure, function and epitope predictions for vaccine development. Our analysis resulted in identification of 7 novel gene sequences and exposed their functions in essential viral processes. All the identified sequences were having conserved sequences for the different MHC class I and class II alleles. Sequence 2, 4 and 5 can absolutely act as B-cell epitope whereas sequence 7 and 3 contained some B-cell receptor responsive residues. Sequence 7(ATGCAGCACCTAGATATCCAGTTTAACCCCGTATATCACAAGTCTCTGTGTCACTTTTTTTTTGTCTGTTTTTTTTTTCTTCTCCTGGTTCAGACGTTCTCTTCTTCGTCAGAGTCTTTCAAGTGTCGGTAG) was most effective for vaccine development containing B-cell and T-cell receptors epitopes with high 3D-structure prediction score and function annotated as lymphocyte proliferation retardation, thus can also be a highly potent target to develop therapies against the infection.

Obligation or Voluntary Disclosure of Medical Confidentiality

Abstract The relationship between the patient and medical personnel, related to the satisfying of health needs, is covered by the principle of confidentiality, and the question of possible disclosure requires a statutory basis defined in a strict manner, with the principle of minimisation also imposed by law. The wording of the statutory exceptions does not imply explicitly that the absence of the obligation to maintain secrecy is tantamount to the obligation to disclose it. As a general rule, a doctor is obliged to be discreet, while with regard to exceptions only “the provision does not apply”. The question arises whether and under what circumstances this obligation to disclose exists, and whether it can be legally enforced. There are no clear obligations for the doctor, nor for the amendment of the regulations, allowing the disclosure of medical secrets after the patient’s death with the consent of a close relative, nor the release of secrets by a court in non-contentious proceedings. The place where a doctor released from secrecy should disclose it is only the court conducting a trial in a specific case, when the doctor is summoned as a witness. Medical confidentiality therefore retains its special status, but a change that allows the court to break the patient’s previous objection to it is detrimental to the most personal legal interests of persons who can no longer feel safe with their secrets. It is also a disgrace to doctors who are being urged to break their silence, contrary to fundamental deontological principles. However, the wording of the regulations allows for evasion, dictated by loyalty to the deceased patient who entrusted his/her secrets in the trust that they will be kept even after death.