Dengue Virus Serotypes Research Articles

Hyperendemic Dengue and Possible Zika Circulation in the Westernmost Region of the Indonesian Archipelago.

The transmission of dengue and other medically important mosquito-borne viruses in the westernmost region of Indonesia is not well described. We assessed dengue and Zika virus seroprevalence in Aceh province, the westernmost area of the Indonesian archipelago. Serum samples collected from 199 randomly sampled healthy residents of Aceh Jaya in 2017 were analyzed for neutralizing antibodies by plaque reduction neutralization test (PRNT). Almost all study participants (198/199; 99.5%) presented with multitypic profiles of neutralizing antibodies to two or more DENV serotypes, indicating transmission of multiple DENV in the region prior to 2017. All residents were exposed to one or more DENV serotypes by the age of 30 years. The highest geometric mean titers were measured for DENV-4, followed by DENV-1, DENV-2 and DENV-3. Among a subset of 116 sera, 27 neutralized ZIKV with a high stringency (20 with PRNT90 > 10 and 7 with PRNT90 > 40). This study showed that DENV is hyperendemic in the westernmost region of the Indonesian archipelago and suggested that ZIKV may have circulated prior to 2017.

Intersectins as Novel Protein for Viral Endocytosis- A Mini Review

Intersectins (INSTNs) have been defined as scaffold proteins that have several biochemical functions. Initially INSTNs are described as endocytic regulators and function in different signalling pathways including Ras and Ras-like GTPases, PI3Ks and RTKs in several diseases. Recently, INSTNs have been reported in viral endocytosis. INSTNs was found to be upregulated in transcriptomic analysis of differentially expressed protein from Dengue virus serotype four from our recent data. Hence, this review summarises the role of INSTNs in viral endocytosis by interaction with signalling pathways. INSTN-2 interact with K15 protein of Kaposi’s Sarcoma-Associated Herpesvirus by selective SH3 domain, INSTN-1 interaction with Epstein-Barr virus Latent Membrane Protein 2 (LMP2A), while direct interaction of NPF motifs at C-terminus of A36 with INSTN-1 and Epsin15 homology domains recruiting AP-2 and clathrin mediate viral release was reported in Vaccinia virus. Most recent, INSTN-2 was shown to regulate adaptive immune response during viral infectivity. This was discovered when mice deficient in INSTN-2 exhibited high mortality rate, impaired antibody responses to vaccination and reduced germinal centre formation in Influenza A virus. This review revealed INSTNs as essential viral endocytic proteins. The review also highlights INSTNs role in other diseases and the regulation of signalling pathways. Targeting INSTNs could be important for the development of pharmaceuticals against viruses and diseases. More study is required to establish the mechanistic role of INSTNs for viral endocytosis.

A flavivirus-inducible gene expression system that modulates broad-spectrum antiviral activity against dengue and Zika viruses

Incidence of dengue virus (DENV) and Zika virus (ZIKV), two mosquito-borne flaviviruses, is increasing in large parts of the world. Vaccination and medication for these diseases are unsatisfactory. Here, we developed a novel antiviral approach, using a virus-inducible gene expression system, to block virus replication and transmission. Constructs containing the smallest replication units of dengue virus serotype 2 (DENV2) with negative-stranded DENV2 artificial genomes and genes of interest were established in an Aedes aegypti cell line, resulting in expression of target genes after DENV2 infection. Green fluorescent protein (GFP) assays confirmed the system was virus-inducible. When we used one of two apoptosis-related genes, A. aegypti michelob_x (AaMx) and inhibitor of apoptosis (IAP)-antagonist michelob_x-like protein (AaIMP) instead of GFP, the production of viral RNA and proteins were inhibited for all five viruses tested (DENV1–4 and ZIKV), and effector caspase activity was induced. The system thus inhibited the production of infectious virus particles in vitro, and in mosquitoes it did so after DENV2 infection. This is a novel broad-spectrum antiviral approach using a flavivirus-inducible gene-expression system, which could lead to new avenues for mosquito-borne disease control.

Dengue Fever: Clinical, Laboratory Profile and Outcome in Pediatric Patient

Introduction: Infection with any of the 4 dengue virus serotypes results in a diverse range of symptoms, from mild undifferentiated fever to life-threatening hemorrhagic fever and shock. Given that dengue virus infection elicits such a broad range of clinical symptoms, early and accurate laboratory diagnosis is essential for appropriate patient management. So a study was carried out to know its clinical profile, correlation between the laboratory profile and the severity of dengue fever and outcome in dengue patients.
 Aim: To study the clinical profile, correlation between the laboratory profile and the severity of dengue fever and outcome in dengue patients at tertiary care center.
 Method: Retrospective Observational study from 1st May 2019 to 31st April 2021.
 Result: Total 323 patients were studied during 1st May 2019 to 31st April 2021. Most common presentation was fever (100%), most common clinical finding is hepatomegaly (14.2%). All severe dengue infection has platelet count < 50000/cumm. In study of 323 patients 194(60%) of dengue fever,85(26.4%) of DHF GRADE 1,9(2.8%) of DHF GRADE 2 were discharged .13(4%) patients of DSS were expired.22 patients (6.8%) went DAMA.
 Conclusion: Reliable diagnosis of dengue fever in endemic areas can be done by clinical parameters like presence of nausea, vomiting, pain abdomen and hepatomegaly. Monitoring platelet count, hematocrit and WBC count is very useful for management of dengue cases.
 Keywords: dengue fever, platelet count, outcome

Generation and characterization of genetically and antigenically diverse infectious clones of dengue virus serotypes 1–4

ABSTRACT Dengue is caused by four genetically distinct viral serotypes, dengue virus (DENV) 1-4. Following transmission by Aedes mosquitoes, DENV can cause a broad spectrum of clinically apparent disease ranging from febrile illness to dengue hemorrhagic fever and dengue shock syndrome. Progress in the understanding of different dengue serotypes and their impacts on specific host-virus interactions has been hampered by the scarcity of tools that adequately reflect their antigenic and genetic diversity. To bridge this gap, we created and characterized infectious clones of DENV1–4 originating from South America, Africa, and Southeast Asia. Analysis of whole viral genome sequences of five DENV isolates from each of the four serotypes confirmed their broad genetic and antigenic diversity. Using a modified circular polymerase extension reaction (CPER), we generated de novo viruses from these isolates. The resultant clones replicated robustly in human and insect cells at levels similar to those of the parental strains. To investigate in vivo properties of these genetically diverse isolates, representative viruses from each DENV serotype were administered to NOD Rag1−/−, IL2rgnull Flk2−/− (NRGF) mice, engrafted with components of a human immune system. All DENV strains tested resulted in viremia in humanized mice and induced cellular and IgM immune responses. Collectively, we describe here a workflow for rapidly generating de novo infectious clones of DENV – and conceivably other RNA viruses. The infectious clones described here are a valuable resource for reverse genetic studies and for characterizing host responses to DENV in vitro and in vivo.

Immune profile and responses of a novel dengue DNA vaccine encoding an EDIII-NS1 consensus design based on Indo-African sequences

The ongoing COVID-19 pandemic highlights the need to tackle viral variants, expand the number of antigens, and assess diverse delivery systems for vaccines against emerging viruses. In the present study, a DNA vaccine candidate was generated by combining in tandem envelope protein domain III (EDIII) of dengue virus serotypes 1–4 and a dengue virus (DENV)-2 non-structural protein 1 (NS1) protein-coding region. Each domain was designed as a serotype-specific consensus coding sequence derived from different genotypes based on the whole genome sequencing of clinical isolates in India and complemented with data from Africa. This sequence was further optimized for protein expression. In silico structural analysis of the EDIII consensus sequence revealed that epitopes are structurally conserved and immunogenic. The vaccination of mice with this construct induced pan-serotype neutralizing antibodies and antigen-specific T cell responses. Assaying intracellular interferon (IFN)-γ staining, immunoglobulin IgG2(a/c)/IgG1 ratios, and immune gene profiling suggests a strong Th1-dominant immune response. Finally, the passive transfer of immune sera protected AG129 mice challenged with a virulent, non-mouse-adapted DENV-2 strain. Our findings collectively suggest an alternative strategy for dengue vaccine design by offering a novel vaccine candidate with a possible broad-spectrum protection and a successful clinical translation either as a stand alone or in a mix and match strategy.

A validated triplex RT-qPCR protocol to simultaneously detect chikungunya, dengue and Zika viruses in mosquitoes.

Recently, the incidences of chikungunya, dengue and Zika infections have increased due to globalization and urbanization. It is vital that reliable detection tools become available to assess the viral prevalence within mosquito populations. Based on the previous publications on clinical diagnosis in human infections, for the first time, we described a customized triplex RT-qPCR protocol for simultaneous detection of chikungunya virus (CHIKV), dengue virus serotypes 1-4 (DENV1-4) and Zika virus (ZIKV) in mosquitoes. In preliminary assessment to determine the specificity and sensitivity of primers and probes, all six targets were detected individually with the following thresholds as indicated by calculated pfu equivalents: 3.96x100 for CHIKV, 3.80x101 for DENV1, 3.20x101 for DENV2, 8.00x104 for DENV3, 1.58x100 for DENV4, and 6.20x100 for ZIKV When tested in a full combination of six targets (CDZ mix), CHIKV, DENV1-4 mix or ZIKV were all detected with the thresholds of 1.32x100 for CHIKV, 3.79x100 for DENV1-4 and 2.06x100 for ZIKV All targets, individually or in full combination were detected in the mixtures of Aedes aegypti (L.) homogenate and viral lysates. A robust evaluation with three replicates in each of three plates for CHIKV, DENV1-4 and ZIKV individually or in full combination was conducted. In individual assays, CHIKV was detected to 3.96x10-1, DENV1-4 to 1.14x100 and ZIKV to 3.20x100. In full combination assays, CHIKV was detected to 1.32x104, DENV1-4 to 3.79x101 and ZIKV to 1.07x100. This triplex RT-qPCR assay appears to consistently detect all six targets and does not cross react with Ae. aegypti homogenate, making it a feasible, practical, and immediately adoptable protocol for use among vector control and other entities, particularly in the endemic areas of CHIKV, DENVs and ZIKV.

Tetravalent formulation of polymeric nanoparticle-based vaccine induces a potent immune response against dengue virus.

Dengue is a mosquito-borne disease caused by the four serotypes of the dengue virus (DENV 1-4). It is growing at an alarming rate globally, which could be partly attributed to the lack of an effective therapeutic regimen. Therefore, strategies for developing an effective vaccine have gained more significance in the given scenario. Failure of the existing live attenuated vaccine candidates to mount effective and broader protection against all the four serotypes of DENV has generated a new interest in exploring novel strategies for augmenting the efficacy of non-infectious, non-replicating subunit vaccines. In the current study, we employed a new strategy of encapsulating the immunodominant EDIII domain of Envelop protein of all the serotypes of DENV (1-4) into PLGA nanoparticles separately. All four nano formulations were physically mixed to develop a tetravalent nano formulation in combination with TLR agonists. Further, we examined its immunological efficacy using a mouse and in vitro infection model system. Interestingly, our results demonstrate that majority of EDIII protein loaded PLGA nanoparticles were polydispersed and less than 1 μm in size with optimal encapsulation efficacy. Tetravalent nanoformulation along with TLR agonists (MPLA + R837) enhanced the magnitude of antigen-specific polyfunctional T cell response. It triggered robust antibody responses in mice concurrent with the increased level of genes involved in the programming of memory B-cell formation and the maintenance and maturation of GCs, leading to the formation of long-lived plasma cells secreting antigen-specific antibodies. Further assessment revealed that tetravalent nanoformulation in combination with TLR ligands upon immunization in mice aids in the enhanced production of serotype-specific neutralizing antibodies, which can effectively neutralize all the four serotypes of DENV (DENV 1-4). The findings of this study reveal a new strategy for enhancing the immunogenicity of vaccine candidates and might pave the way for the development of a tetravalent vaccine against all the serotypes of Dengue Virus.

A retrospective analysis of serological & molecular testing data on dengue fever in Kolkata & adjacent districts during 2016-2019.

Regional Virus Research and Diagnostic Laboratory established at ICMR-National Institute of Cholera and Enteric Diseases (NICED) regularly receives samples for dengue screening and serotyping from patients of acute febrile illness (AFI) from Kolkata and adjacent districts. In this study, data over a three year period (August 2016-July 2019) was retrospectively analyzed to provide insight into the epidemiological trends of dengue fever in this region. Serological screening of dengue was performed by detection of NS1 antigen and/or immunoglobulin M (IgM) antibody. Dengue serotyping was done by conventional or real-time reverse transcriptase-PCR. The data were analyzed to describe the distribution of dengue with respect to age of patient, duration of fever on the day of blood collection and month of the year. Zip codes were used for spatial plotting. Out of the 24,474 samples received from Kolkata and its adjacent districts (Hooghly, Howrah, North and South 24 Parganas), 38.3 per cent (95% confidence interval: 37.7-38.9%) samples were screened positive for dengue. The correlation between age and dengue positivity was found to be weak. A combination of dengue NS1 antigen and dengue IgM antibody detection may be a better option for detecting dengue positivity compared to a single test. Most AFI cases were tested from August to November during the study period, with maximum dengue positivity noted during September (45.9%). The predominant serotype of 2016, dengue virus serotype 1 (DENV-1), was almost entirely replaced by DENV-2 in 2017 and 2018. Dengue continues to be an important cause of AFI in the region and round-the-year preventive measures are required for its control. Serotype switching is alarming and should be monitored routinely.

Molecular characterization of dengue viruses during an outbreak in Kolkata: A hospital-based study

Context: Dengue, a mosquito-borne viral infection in the tropical regions of the world, has recently become a major public health concern. In West Bengal, several outbreaks of dengue fever occurred in the past few years. In the present study, serological analysis, molecular detection, and serotyping of dengue virus were done to identify the serotype/s presently circulating in the region. Methods: The present study was conducted for a period of 1 year from November 2017 to October 2018 in the Department of Microbiology, ID and BG Hospital, Kolkata. 5240 blood samples collected from clinically suspected dengue fever cases were screened for dengue specific immunoglobulin M (IgM) antibody by MAC-ELISA and NS1 antigen by NS1 ELISA according to the duration of fever as per the National Vector Borne Disease Control Program guidelines. Molecular detection and serotyping were done in 70 NS1 positive samples by nested reverse transcription-polymerase chain reaction. Results: Total 5240 samples were tested for dengue. About 30.48% (1597) were serologically reactive for dengue infection (either IgM or NS1). Among these, 80.52% (1286) were NS1 reactive and 19.47% (311) were IgM reactive. Male predominance (66.37%) was observed throughout the study period. A post monsoon season peak was also noted in our study. DEN2 was found as most prevalent serotype presently circulating in the region. Conclusions: Laboratory-based active surveillance system is required which can forecast dengue epidemics by detecting increasing number of dengue cases or changing pattern in the prevalent serotype as a specific serotype (viz.DEN2) is associated with higher incidence of complications. This will help alert the public and physicians to diagnose properly and treat cautiously the complicated dengue cases.

Neurological infection by chikungunya and a triple Arbovirus co-infection in Mato Grosso, Central Western Brazil during 2019.

Neurological viral infection is frequently associated to enterovirus, herpesvirus and arboviruses. These infections may cause severe clinical outcomes, long lasting sequelae or death. Few studies have addressed viral neurological infections etiology in Brazil. Identification of viruses in the cerebral spinal fluid (CSF) of human neurological infections suspected of viral etiology during January and May 2019 in Midwestern Brazil. Clinical, laboratory and epidemiological information was gathered from medical records. In addition, an aliquot of the sampled CSF was subjected to viral RNA/DNA extraction, randomic dscDNA amplification by PCR, DNA purification and Ilumina HiSeq 2500 sequencing. Six viral genomes belonging to Chikungunya virus (CHIKV) East-Central-South African (ECSA) genotype (10.834-11.804nt in length) confirmed lately by RT-PCR for CHIKV envelope were present in all six liquor samples. These genomes present two mutations, nsP2:T31I and nsP3:A388V, shared with other Mato Grosso State strains from 2019, not present in sequences of the virus from previous years obtained in the State. One case was a triple co-infection also confirmed through RT-PCR, with Dengue virus serotype 4 genotype II (NS5; 874nt) and Oropouche virus genotype IA (segment S; 302nt). CSF was clear and colorless (5/6 patients), with >10% of lymphomononuclear cells (6/6), 1-99erythrocytes/mm3 (5/6), glucose levels >50mg/dl (4/5) e>10mg/dl of proteins (4/4). One patient evolved to death, and another, a newborn, presented sequelae after recovery. Despite herpesviruses and enteroviruses are frequent etiologies of neurological infections, the casuistic here reported was associated to arboviruses already known to be responsible for acute febrile illness outbreaks in the state of Mato Grosso, Midwestern Brazil.

Three highly variable genome regions of the four dengue virus serotypes can accurately recapitulate the CDS phylogeny

The circulation of the four-dengue virus (DENV) serotypes has significantly increased in recent years, accompanied by an increase in viral genetic diversity. In order to conduct disease surveillance and understand DENV evolution and its effects on virus transmission and disease, efficient and accurate methods for phylogenetic classification are required. Phylogenetic analysis of different viral genes sequences is the most used method, the envelope gene (E) being the most frequently selected target. We explored the genetic variability of the four DENV serotypes throughout their complete coding sequence (CDS) of sequences available in GenBank and used genomic regions of different variability rate to recapitulate the phylogeny obtained with the DENV CDS. Our results indicate that the use of high or low variable regions accurately recapitulate the phylogeny obtained with CDS of sequences from different DENV genotypes. However, when analyzing the phylogeny of a single genotype, highly variable regions performed better in recapitulating the distance branch length, topology, and support of the CDS phylogeny. The use of three concatenated highly variable regions was not statistically different in distance branch length and support to that obtained in CDS phylogeny.•This study demonstrated the ability of highly variable regions of the DENV genome to recapitulate the phylogeny obtained with the full coding sequence (CDS).•The use of genomic regions of high or low variability did not affect the performance in recapitulating the phylogeny obtained with CDS from different genotypes. However, when phylogeny was analyzed for sequences from a single genotype, highly variable regions performed better in recapitulating the distance branch length, topology, and support of the CDS phylogeny.•The use of concatenated highly variable genome regions represent a useful option for recapitulating genome-wide phylogenies in analyses of sequences belonging to the same DENV genotype.

Dengue virus infection: A review of advances in the emerging rapid detection methods

Dengue virus infections are increasing worldwide generally and in Asia, Central and South America and Africa, particularly. It poses a serious threat to the children population. The rapid and accurate diagnostic systems are essentially required due to lack of effective vaccine against dengue virus and the progressive spread of the dengue virus infection. The recent progress in developing micro- and nano-fabrication techniques has led to low cost and scale down the biomedical point-of-care devices. Starting from the conventional and modern available methods for the diagnosis of dengue infection, this review examines several emerging rapid and point-of-care diagnostic devices that hold significant potential for the progress in smart diagnosis tools. The given review revealed that an effective vaccine is required urgently against all the dengue virus serotypes. However, the rapid detection methods of dengue virus help in early treatment and significantly reduce the dengue virus outbreak.

Dengue Status in a Tertiary Care Rural Hospital

Introduction: Dengue is one the most common arthropod-borne virus-transmitted disease of the tropics. Though many remains asymptomatic, a huge population gets infected with some persons leading to a serious form of the disease. As rapid urbanization allows to thrive the Aedes albopictus mosquito which is mainly involved for the transmission of the disease, seasonal outbreaks are becoming a common fact to deal Acute Febrile Illnesses year after year. Aims/Objectives: To study the epidemiology of dengue through the serological, demographic profile, regional distribution, vectors and circulating serotypes. Materials and Methods: Demographic data and presenting symptoms of fever 10476 cases reported to the clinic were recorded. Suspected patients were tested for dengue, chikungunya, scrub typhus and malaria. Dengue-specific NS1 and IgM ELISAs were performed, followed by RNA extraction, PCR and sequencing to detect circulating DENV serotypes. Results: Of the 10476 fever patients tested from July to September 2021, 2767 cases were Dengue NS1 positive, while 2624 were Dengue IgM positive. Of the 200 samples analyzed, 19.1% had concurrent infection with multiple dengue serotypes DEN 1,2 & 3; 63.8% was DEN 1, and 18.2% was DEN 2. Conclusion: Wardha is endemic to Dengue, and concurrent infections with multiple DENV serotypes have become a frequent finding in this region. The most prevalent febrile illness nowadays is Scrub typhus or Dengue Fever in the rural part of central India, which has predominantly replaced typhoid fever and malaria. They may be asymptomatic or give rise to undifferentiated fever, Dengue Fever (DF), Dengue Haemorrhagic Fever (DHF), or Dengue Shock Syndrome (DSS). Annually, 100 million cases of dengue fever and half a million cases of DHF occur worldwide. It is essential to know the prevalent serotype and disease pattern for better recovery of the patients. Though much research is ongoing for a new vaccine against Dengue, reaching rural India will take time and effort. Early recognition and prompt initiation of appropriate treatment are vital if disease-related morbidity and mortality are to be limited.

Liver Pays Dengue Toll in Body Along with Wide Range of Gastrointestinal Complications Strongly Associated with DENV Serotype 2 Infection in Children

Background: Dengue is an arthropod-borne viral disease causing more than 50 million infections with ∼25,000 deaths annually, mostly children. Severe dengue associated with multi-organ failure and commonest being the liver, from asymptomatic elevated transaminases levels to acute liver failure, dengue has all properties of hepatic illness.

An overview of dengue viral infection circulating in Pakistan.

Dengue virus (DENV) is an RNA virus that infects approximately 2.5 billion people around the world. The incidence of dengue fever has rapidly increased at an alarming rate in the last few years and has affected thousands of people in Pakistan. This review explores the prevalence, serotypes and pathogenesis of dengue virus circulating in Pakistan. A systematic review of observational studies published between 1994 and December 2019 was performed. All records of the confirmed outbreak of dengue fever in Pakistan were reviewed and articles containing no primary data were excluded. Four identified serotypes of dengue virus (DENV 1-4) circulate in different regions of the world causing epidemics. The most prevalent serotype, which is still epidemic and dominant in Pakistan, is DENV-2. Many factors like over-population, rapid urbanization, travelling, lack of vector control in dengue endemic areas and inadequate health-care are responsible of dynamic and huge raise of dengue in Pakistan. Currently there is no specific treatment for prevention of dengue virus. Recently some antiviral compounds were being tested to eradicate this disease. There is a need to develop an efficient and safe vaccine for all four serotypes to combat dengue viral infection globally and particularly in Pakistan.

Завозные случаи лихорадки денге у жителей Республики Татарстан

The article presents an analysis of clinical-epidemiological and laboratory-instrumental data of 15 patients with dengue fever (DF), residents of the Republic of Tatarstan, who visited regions endemic for DF as tourists. To verify the diagnosis, PCR diagnostics of blood serum for dengue virus RNA and determination of dengue virus serotypes were carried out. The classical form of the disease of moderate severity was diagnosed in 14 (93.3%) patients. The clinical picture was characterized by an acute onset, fever, chills, myalgia, arthralgia. The total duration of the febrile period varied from 3 to 7 (4.1 (2.09)) days. In 7 (46.7%) patients, maculopapular exanthema of various localization was observed, in 43% it was hemorrhagic in nature and was accompanied by itching (28.6%). In 5 (33.3%) cases, dyspeptic syndrome developed. 4 (26.7%) patients were diagnosed with respiratory syndrome. Hematological changes were characterized by thrombocytopenia in 93.3% (105.6 (35.9) 109/l) and leukopenia in 86.7% (3.2 (1.9) 109/l) of patients. 7 (46.7%) patients had a moderate cytolytic syndrome with a predominance of ALT (61 (43.3) U/l) and AST (59.6 (36.9) U/l) activity in the early period of the disease. In 7 (46.7%) patients, an increase in the pulmonary pattern of both lungs with perivascular and peribronchial changes was diagnosed radiographically. Sonographic examination of the abdominal organs revealed an increase in the size of the liver and spleen in 3 (20%) patients. Thus, imported cases of DF in the Republic of Tatarstan were characterized by the development of the classical moderate form caused by serotypes 1-3. Due to the increased DF incidence in the Russian Federation and, in particular, in the Republic of Tatarstan, it is necessary to improve medical alertness in diagnosing the disease characterized by fever combined with arthralgia, myalgia and exanthema in people who returned from endemic countries. Due to the lack of vaccination in the Russian Federation, it is necessary to inform patients who recovered from DF about the risk of developing a hemorrhagic form of the disease in case of re-infection.

Epitope prediction and designing of receptor inhibitor of Dengue Envelope Protein: An in silico approach.

Dengue virus (DENV) is the causative agent of dengue fever (DF) and dengue hemorrhagic fever (DHF). It has four distinct serotypes (DENV-1, DENV-2, DENV-3, and DENV-4) based on their antigenic properties. Mostly, the immunogenic epitopes are present in the envelope (E) protein of the virus. Heparan sulfate (HS) acts as a receptor and interacts with the E protein of the virus thus facilitating the entry of dengue virus into human cells. This study focuses on epitope prediction on the E protein of the DENV serotype. The non-competitive inhibitors of HS were designed using bioinformatics. In the present study, epitope prediction of the E protein of DENV serotypes was performed using the ABCpred server and IEDB analysis resource. The interactions of HS and viral E proteins (PDB ID: 3WE1 and PDB ID:1TG8) were evaluated through AutoDock. Subsequently, non-competitive inhibitors were designed to bind the E protein of DENV better than HS. All the docking results were validated by re-docking the ligand-receptor complexes and superimposing them onto their co-crystallized complexes using AutoDock and visualizing them in Discovery Studio. The result predicted B-cell and T-cell epitopes on the E protein of DENV serotypes. The designed HS ligand 1 (non-competitive inhibitor) demonstrated potential binding with the DENV E protein, thereby inhibiting HS-E protein binding. The re-docked complexes were superimposed entirely onto the native co-crystallized complexes (low root mean square deviation values), which validates the docking protocols. The identified B-cell and T-cell epitopes of the E protein and non-competitive inhibitors of HS (ligand 1) could be used in the designing of potential drug candidates against the dengue virus.

Serotype Specific Sequence for Multi Test Line Nucleic Acid Lateral Flow Development

Dengue virus that causes dengue fever and dengue shock syndrome has 4 different serotypes. Serotyping is needed for diagnosing and surveillance activities of disease spreaders. Recently, the Nucleic Acid Lateral Flow (NALF) method has been developed to confirm the results of easy amplification without complicated equipment. The aim of this study was designing capture probe for serotyping dengue virus (DENV) using NALF method. We have conducted an analytical study to obtain four specific sequences of Dengue Virus serotypes to develop serotipe specific NALF. Several parameters were used to analyzed Dengue genome sequences i.e % GC content, target homology, length of 100% homology continue of non-specific bases, hybridization temperature, and secondary structure to estimate the probe's capture capability in the hybridization reaction. The capture probes were applied to NALF and assayed using single strand DNA sample to check its performance. The result of four specific sequence capture probes, DENV1, 2, 3, 4 were CACCAGGGGAAGCTGTACCCTGGTGGT, GTGAGATGAAGCTGTAGTCTCACTGG, GCACTGAGGGAAGCTGTACCTCCTTGCA, AGCCAGGAGGAAGCTGTACTTCTGGTGG. Application to fabricated NALF gave no cross hybridization with high stringency buffer assay.Keywords : capture probe; dengue virus; hybridization; nucleic acid lateral flow; serotyping

Effectiveness of planned teaching programme on knowledge regarding dengue fever and its preventive measures among adult population in selected urban slums

Background: Dengue fever is the most critical mosquito-borne disease in the world caused by one of any of four serotypes of dengue virus. There has been a 30-fold increase in global incidence over the past fifty years. Epidemics of dengue result in human suffering, strained health services and massive economic losses.Methods: Quasi experimental one group pre-test-post-test research design was adopted to conduct the study among forty adults aged between twenty to 40 years residing in Janta Nagri, Urban slum, Lucknow, Uttar Pradesh, who matched the inclusion criteria were selected through non-probability purposive sampling technique. On day one pre-test followed by planned teaching programme was conducted and after seventh day post-test was taken. The data was analysed using descriptive and inferential statistics.Results: The results revealed that the mean post-test knowledge score was higher than mean pre-test knowledge score with standard deviation 20.15±4.02 and 7.67±3.11 respectively. The improvement of knowledge score is the mean difference of 12.5 which shows that there was a significant change in knowledge level of adult population.Conclusions: The study concluded that the planned teaching programme was effective in improving the level of knowledge regarding dengue fever and its preventive measures.