Allium Cepa Var Research Articles

Genetic Diversity of Shallot (Allium cepa var. aggregatum) Based on Morphology and Molecular Markersetik Bawang Merah (Allium cepa var. aggregatum) Berdasarkan Marka Morfologi dan Molekuler

Bawang merah di Indonesia pada umumnya diperbanyak secara vegetatif, tetapi bawang merah yang tersebar tersebut beragam bentuknya sehingga diduga memiliki keragaman genetik yang tinggi. Penelitian ini bertujuan mengidentifikasi keragaman morfologi menggunakan 21 karakter bawang merah serta keragaman molekuler menggunakan penanda RAPD. Hasil penelitian menunjukkan bahwa karakter morfologi membagi 40 genotipe bawang merah menjadi 2 kelompok utama pada koefisien ketidakmiripan 0.59 yaitu kelompok A (38 genotipe) dan B (2 genotipe), sedangkan analisis morfologi berdasarkan 14 karakter morfologi umbi menunjukkan adanya dua kelompok utama pada koefisien ketidakmiripan 0.50 yaitu kelompok A dan B, masing-masing terdiri atas 36 dan 4 genotipe. Analisis berdasarkan penanda molekuler menunjukkan dua kelompok utama pada koefisien ketidakmiripan 0.41 yaitu kelompok A (3 genotipe) dan B (37 genotipe). Marka RAPD menghasilkan 229 pita polimorfik DNA dengan total 100% dan primer informatif adalah SBN2, OPE11 dan SBN9. Pengelompokkan dari 40 genotipe dalam penelitian ini tidak berhubungan dengan asal geografis. Genotipe BM12, BM19, BM78 dan BM01 memiliki ukuran daun yang panjang, ukuran dan diameter umbi besar dan memiliki intensitas warna dasar kulit umbi kering yang gelap. BM63 dan BM24 memiliki perilaku daun yang tegak, panjang daun sedang, ukuran dan diameter umbi sedang. Genotipe potensial ini dapat dikembangkan untuk meningkatkan varietas bawang merah di Indonesia.
 Kata kunci: genotipe, koefisien ketidakmiripan, RAPD, primer informatif

Assessments of rooting, vegetative growth, bulb production, genetic integrity and biochemical compounds in cryopreserved plants of shallot

Shallot (Allium cepa var. aggregatum), a small bulb onion, is widely grown in the world. We previously reported a droplet-vitrification for cryopreservation of in vitro-grown shoot tips of shallot genotype ‘10603’. The present study further evaluated rooting, vegetative growth, bulb production and contents of biochemical compounds, as well as genetic stability in cryo-derived plants. The results showed no significant differences in rooting, vegetative growth, bulb production and contents of soluble sugars and flavonols between the cryo- and in vitro-derived plants. Analyses of ISSR and AFLP markers did not detect any polymorphic bands in the cryo-derived plants. These results indicate rooting and vegetative growth ability, biochemical compounds and genetic stability were maintained in cryo-derived plants. The present study provides experimental evidences that support the use of cryopreservation method for long-term preservation of genetic resources of shallots and other Allium species. Rooting, vegetative growth, bulb production, genetic stability and biochemical compounds were maintained in cryopreserved plants of shallot. Our results support use of cryopreservation for long-term preservation of shallot germplasm.

Potensi Kolonisasi Mikoriza Arbuskular dan Cendawan Endofit untuk Pengendalian Layu Fusarium pada Bawang Merah

Layu Fusarium merupakan penyakit penting pada bawang merah (Allium cepa var. aggregatum) yang disebabkan oleh Fusarium oxysporum f.sp. cepae. Pada penelitian ini, isolat biokontrol potensial cendawan endofit dan mikoriza diuji kemampuan kolonisasinya secara tunggal dan kombinasi untuk menekan perkembangan penyakit layu Fusarium. Percobaan dilakukan menggunakan rancangan acak lengkap dengan 8 perlakuan dan 5 ulangan. Kemampuan menekan patogen diamati dari persentase kolonisasi agens biokontrol, periode laten penyakit, insidensi penyakit, laju infeksi, dan area under the disease progress curve (AUDPC). Agens biokontrol yang diujikan berhasil bersimbiosis dengan akar tanaman bawang merah. Aplikasi tunggal mikoriza arbuskular paling baik dalam memengaruhi pertumbuhan tanaman dan menekan perkembangan penyakit layu fusarium pada bawang merah dengan periode laten penyakit terpanjang 21 hari dan menurunkan insidensi penyakit hingga 40%.

Performance of shallot (Allium cepa var. ascalonicum) derived from true seed under a dry condition area

To reduce the dependence of bulbs as planting material, the innovation technology of shallot (Allium cepa var. ascalonicum) cultivation with using true shallot seed (TSS) as planting material was tried. Four cultivars namely Bima Brebes, Trisula, Tuk Tuk, and Sanren were planted at Laleten Village, Malaka District, from April to December 2018. TSS seedlings were raised with a 10x15cm planting spacing or 2,000 plants/30m−2. The aim of this research was to evaluate the using TSS at the shallot cultivation in the areas where the farmers have never carried out such technology. The vegetative growth of all varieties is not significantly different. The productive plants are range from 70 to 75% of population, which the highest was Trisula. The bulbs number/plant highest in Bima Brebes. The number and fresh bulbs weight/bed were 2,293 – 4,601 bulbs and 19.8 – 31.5kgs, respectively. Bulbs weight loss during storage was about 48-65%, which the driest bulbs was Tuk Tuk. The estimated of fresh production was only 5.28 to 8.41 tons/ha. It means that in dry conditions with farmers have not mastered yet on shallot cultivation by using TSS as planting material, the productivity only reaches 20-40% of the production capacity.

Production risk, price and income analysis on shallot hatchery business (Allium cepa var. ascalonicum) (case: Medan Marelan District, Medan City)

This research aims to analyse the risk of production, price and income in the business of shallot hatchery in Medan Marelan district, Medan City. The study was carried out on 30 farmers who carried out hatchery cultivation in Medan Marelan district. The research method used to measure the risk of production, price and income uses variety, the standard deviation of the coefficient of variation (K V), and the lower limit of the highest yield. The results showed that the production risk was 0.23, price risk was 0.06 and income risk was 0.33. Production risk is caused by pests, diseases, and erratic weather. Price risk is caused by fluctuating prices. Income risk is caused by the amount of production, fluctuating prices, large farming costs and lack of market demand. The highest risk is income risk, followed by production risk and price risk.

Diseminasi Teknologi True Seed of Shallot dan Umbi Mini Bawang Merah di Karangploso, Malang, Jawa Timur

Shallots (Allium cepa var. aggregatum) is one of the vegetable commodities whose demand continues to increase in line with population growth. The purpose of this community service program to disseminate the results of research on how to produce true seed of shallot (TSS) then plant TSS to produce mini bulbs as seeds of shallots. The target audience was the farmers group Tani Mulya in Tawangargo Village, Karangploso Sub-District, Malang Regency, East Java. Activities step included preparation, socialization, demonstration plot of shallot bulbs planting to produce TSS and planting TSS, to produce mini bulbs as seeds of shallot. Batu Ijo variety grown to produce TSS, while planting of TSS used Tri Sula and Keta Monca varieties. This activitity was done well according to a Likert scale of 4.3 (good category = 4–4.9). Farmers were able to adopt the technology of TSS production and planting of TSS to produce shallot mini bulbs of seeds, with indication of the production of TSS and mini bulbs. The flowering of shallot plants 55.5 and TSS seed weight 10.16 g/m2. Bulbs seed of Batu Ijo variety produced large bulbs, while TSS from Tri Sula and Keta Monca varieties produced mini bulbs that can be used as seeds. The change of the shallot seeds technology from bulbs to TSS will be economically beneficial, because the TSS required less than bulbs, so the cost difference is quite large. TSS needs 3–5 kg/ha (TSS price IDR 1.200.000/kg), and bulbs seed needs 1–1.5 ton/ha (bulbs price IDR 30.000/kg), so the margin is IDR 24.000.000 per hectare.

First Report of Shallot Virus X and Shallot Latent Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield (Katis et al. 2012). Only onion yellow dwarf virus (OYDV) has been found in shallot in China (Su et al. 2019). Shallot virus X (SVX, genus Allexivirus, family Alphaflexiviridae) and shallot latent virus (SLV, genus Carlavirus, family Betaflexiviridae) were reported in many Allium species (Chodorska et al. 2014; Kanyuka et al. 1992). In 2018, symptoms consisting of severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin Province, China. The symptoms were found in all shallot fields investigated (27), and symptoms were noticed in 20 to 75% of plants. A total of 18 symptomatic plants were collected from nine shallot fields and tested by double antibody sandwich ELISA kit for SVX (DSMZ RT-1042) and TAS-ELISA kit (DSMZ RT-0514-0512/1) for SLV. SVX was detected in two out of 18 shallot samples, and SLV was detected in 15 out of 18 shallot samples. All SVX-positive samples were also SLV positive. The three SVX- and SLV-negative plants were positive for OYDV (using methods as Su et al. 2019) with chlorosis and yellowing. Presence of SVX and SLV in ELISA-positive shallot plants was further confirmed by reverse transcription PCR (RT-PCR). Total RNAs of 18 plant samples were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany), reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara). The SVX coat protein (CP) specific primer pair (svxu, 5′-ATGAACGAAGASGATTTGAATCG-3′; svxd, 5′-ARATCGTGKGGATGCATCAGAA-3′) and the SLV CP specific primer pair (slvu, 5′-GGTTCACTTTAGGTTTACAGC-3′; slvd, 5′-GYTTGATCAACATCGATTCTC-3′) designed to amplify complete CP gene of each virus were used for amplification. All SVX ELISA-positive shallot plants yielded an amplicon of the expected size (804 bp), and the SLV-positive plants yielded a 916-bp product each. One RT-PCR product per virus species were sequenced after T vector ligation with the pMD 18-T Vector Cloning Kit (Takara) and submitted to GenBank (accession nos. MK331812 for SVX and MK331810 for SLV). Pairwise comparison of the sequences with other isolates of these viruses available in GenBank showed that CP gene of SVX isolate shared the highest nucleotide/amino acid identities of 86.1/ 94.7 and 86/95.4% with the CP gene of SVX isolates NZ (EU835197) and Russian (JX310755) from New Zealand and Russia, respectively. The CP gene of SLV isolate Nongan-2 shared the highest nucleotide/amino acid identities of 83.0/95.6 and 83.0/95.6% with the CP gene of SLV isolate Xixia (AJ307034) and SLV isolate SLV-WOST87 (LC279526) from China and Japan, respectively. To our knowledge, this is the first report of SVX and SLV infecting shallot in China. All plants with SLV and SVX coinfection showed severe dwarfism symptoms compared with plants with a single infection of SLV. The spread of both viruses could threaten shallot production. Shallot asexual reproduction has been applied for more than 70 years in Jilin and Heilongjiang Provinces; virus detection and virus-free bulb application can avert further spread. Further investigation is necessary to prevent the spread of these pathogens to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

Droplet-vitrification for shoot tip cryopreservation of shallot (Allium cepa var. aggregatum): effects of PVS3 and PVS2 on shoot regrowth

The present study described a droplet-vitrification cryopreservation for shoot tips of shallot (Allium cepa var. aggregatum), a small bulb onion. Shoot tips taken from in vitro stock shoots were precultured with 0.3 M and 0.5 M of sucrose, with 1 day for each concentration. Precultured shoot tips were treated with a loading solution containing 2 M glycerol and 0.6 M sucrose for 20 min and then exposed to plant vitrification solution 3 (PVS3) at 24 °C for 3 h of dehydration. Following exposure to PVS3, shoot tips were moved onto 5.0 µl PVS3 droplets on aluminum foil strips, followed by direct immersion into liquid nitrogen for 1 h. Frozen shoot tips were thawed by incubation in liquid MS medium containing 1.2 m sucrose for 20 min at room temperature, and then post-thaw cultured for shoot regrowth. Exposure of the shoot tips to PVS3 produced shoot regrowth (58%). Differential scanning calorimetry (DSC) detected 1.8% of freezable water in the shoot tips that had been dehydrated by PVS2, and no freezable water in those by PVS3 treatment. Exposure to PVS3 provided a broader safe temperature range (− 196 °C to − 88 °C), compared to that (− 196 °C to − 116 °C) of PVS2, for cryopreserved samples. Histological observations found that PVS3 dehydration allowed many cells in the apical dome and in the leaf primordia to survive following freezing in LN, while PVS2 dehydration resulted in much fewer surviving cells in the apical dome. The droplet-vitrification cryopreservation produced 56%, 72% and 32% shoot regrowth in cryopreserved shoot tips taken from in vitro shoots, adventitious buds regenerated from stem discs and field-grown bulbs, respectively. Advantages and disadvantages of the use of different source explants for cryopreservation were discussed. The droplet-vitrification cryopreservation produced 45% and 70% shoot regrowth in the additional two shallot genotypes ‘Kverve’ and ‘Lunteviga’. The results obtained in this study provide technical supports for setting-up cryo-bankings of genetic resources of shallots and other Allium species. Establishment of a droplet-vitrification cryopreservation of shallot shoot tips provided technical supports for long-term preservation of diverse genetic resources and cryotherapy for virus eradication in shallot plants.

The characteristic Performace of Quantitative Flowering Characters and Metabolomic Profile of Shallot (Allium cepa var. aggregatum) Induced by Vernalization

Proses pembungaan pada bawang merah (Allium cepa var. aggregatum) sangat dipengaruhi faktor internal dan eksternal tanaman. Induksi pembungaan dengan perlakuan vernalisasi dilakukan untuk mendorong inisiasi pembentukan bunga bawang merah. Penelitian bertujuan untuk menganalisis karakter kuantitatif pembungaan dan profil metabolomik bawang merah yang diberikan perlakuan vernalisasi pada stadia perkembangan umbi. Vernalisasi dilakukan pada suhu 8 0C selama 6 minggu terdiri atas empat taraf, yaitu umbi tanpa vernalisasi (S0), vernalisasi pada stadia embrio (S1), vernalisasi pada stadia tumbuh tunas 1 cm (S2), dan vernalisasi pada stadia tumbuh tunas 2 cm (S3). Perlakuan vernalisasi pada stadia awal pertumbuhan umbi mampu meningkatkan karakter jumlah anakan, jumlah umbel, diameter umbel, dan persen berbunga bawang merah dibandingkan vernalisasi pada stadia lainnya. Stadia awal pertumbuhan umbi merupakan stadia terbaik dalam menerima perlakuan vernalisasi. Semakin besar jumlah umbel dan diameter umbel semakin meningkatkan persen berbunga bawang merah. Karakter jumlah umbel dan diameter umbel dapat digunakan sebagai karakter seleksi untuk peubah persen berbunga bawang merah. Analisis metabolomik berhasil mengidentifikasi 104 metabolit spesifik dan mengelompokkan bawang merah menjadi 3 kelompok stadia. Vernalisasi pada stadia awal perkembangan umbi (stadia embrio dan tunas 1 cm) menunjukkan adanya perubahan fase reproduktif, yang dicirikan dengan adanya senyawa phytol dan 2 propanone.
 Kata kunci: metabolomik, analisis pengelompokan hierarkis, induksi pembungaan, korelasi

Haploid Induction in Multiplier Onion (Allium cepa var aggregatum) through in vitro Gynogenesis

The haploid induction study is an effective method for inbred and hybrid development quickly. The optimization of media composition for specific indigenous genotypes was a critical factor. Two media namely, Gamborg’s medium (B5) and Murashige and Skoog’s medium (MS) with six different combinations of plant growth regulators were used to evaluate the gynogenic potential of six different genotypes of multiplier onion. Days for embryo induction was earlier in Acc. 1 (46-54), whereas Acc. 4 was the best responding genotype with a higher percent of embryo induction (0.76) followed by Acc. 15 (0.48). The embryo induction rate and survival rate of 0.21% and 54.54% respectively were recorded in B5 medium whereas in MS medium the induction and survival rate was 0.34 % and 34.86 % respectively. Embryo induction ranged from 0 to 1.41% in this study. Five haploids and one mixoploid in B5 medium, five haploids in MS medium were obtained. Ploidy status of the plants was confirmed by flow cytometry, cell cytology, and stomatal dimension analysis..

English

In the present investigation, effects of light quality emitted by light emitting light emitting diodes (LED), and selected photoperiods on the growth and biomass accumulation of shallot (Allium cepa var. aggregatum) have been studied. Two ratios of red and blue light namely, 2:1 and 1:1 and two photoperiods 16 h dark and 8 h light cycle and 12 h each alternating light and dark cycle were tested. The results showed that the growth of spring shallots and the accumulation of biomass were associated with the ratio of red and blue light as well as on the photoperiod. The plant height growth, growth rate and the accumulation of chlorophyll a were the fastest under an experimental condition of 16 h of illumination with a red and blue light ratio of 2:1. The synthesis of chlorophyll b was the fastest under an experimental condition of 12 h of illumination with a red and blue light ratio of 2:1. Key words: Shallots, light emitting diodes (LED), light, red and blue light quality, biomass.

Effect of Red Onion (Allium cepa var ascalonicum) Skin Ethanolic Extract on the Motility and the Adhesion Index of Pseudomonas aeruginosa and Macrophage Phagocytosis Index

Red onion skin (Allium cepa var ascalonicum) contains various ingredients that may function as antibacterial agents against microorganisms, as well as anti-inflammatory and immunomodulator agents for host cells, such as macrophages. Pseudomonas aeruginosa found in the oral cavity is commensal bacteria that may turn into opportunistic pathogen by utilizing its virulence factors such as motility and adhesion to the host cell. The purpose of this study was to investigate the effect of red-onion-skin ethanolic extract towards P. aeruginosa ATCC 9027 on the motility and adhesion ability, furthermore, to know its effect on the macrophage phagocytosis. The research was conducted into three parts of experiment using red-onion-skin ethanolic extract. Extract-induced bacterial motility test was carried out on semi-solid media, stained using 0.1% crystal violet, then the radial length of the bacterial movement was measured. The bacterial adhesion index to buccal cells was calculated after incubated for two hours and stained with Gram stain. Phagocytic activity of the host cells on P. aeruginosa was done by exposing the extract to the mouse peritoneal macrophages, then the phagocytosed bacteria were counted after Giemsa staining. Statistical test results from the three experiments showed significant differences between the test groups compared to the control groups (p <0.05). It was concluded that the red onion-skin ethanolic extract not only affects P. aeruginosa by reducing swarming motility and preventing bacterial adhesion to buccal epithelial cells, but also induces the host cells by increasing the ability of macrophage phagocytosis to these bacteria.

First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.

The genetic diversity and population structure of shallots (Allium cepa var. aggregatum) in Indonesia based on R gene-derived markers

Abstract. Herlina L, Reflinur, Sobir, Maharijaya A, Wiyono S. 2019. The genetic diversity and population structure of shallots (Allium cepa var. aggregatum) in Indonesia based on R gene-derived markers. Biodiversitas 20: 696-703. Molecular markers are very useful for determining plant genetic diversity, especially when they are associated with useful traits. In shallots, type of markers still very limited. Therefore, development of new molecular markers is challenging if the future demand for this crop is to be met. The present study reports the genetic diversity analysis of 36 accessions of shallots using molecular markers derived from partial R gene sequences. Six polymorphic R gene-derived markers (Acepa-1, Acepa-2, Acepa-3, Acepa-4, Acepa-5, and Acepa-6) were developed and applied to analyze the genetic diversity of shallots in Indonesia. These loci produced a total of 963 alleles with an average of 0.51 + 0.77 alleles per marker. The polymorphic information content value ranged from 0.2784 to 0.5236 with an average of 0.36015. The markers were able to differentiate the shallot genotypes into three major clusters, suggesting that shallots are characterized by poor levels of genetic diversity in Indonesia. After further validation, the markers will be very useful, serving as tools to support the breeding of disease-resistant shallot varieties.

Phytoremediation potential of Allium cepa var. aggregatum on different soils contaminated with heavy metals

Phytoremediation potential of Allium cepa var. aggregatum on different soils contaminated with heavy metals

PENGEMBANGAN FORMULASI AROMATERAPI PRODUK HERBAL YANG MENGANDUNG MINYAK ATSIRI BAWANG MERAH (Allium cepa var. aggregatum L )

The using of alternative and complementary therapies as a treatment is growing rapidly, one of them is aromatherapy. It is an alternative medicine that uses steam from essential oils. The aims of this study is making aromatherapy formulations use the essential oils of onion. The methods are distillationing essential oils use the water, with a sample of shallots. Furthermore, aromatherapy roll on formulations were made and tested include organoleptic and physical test formulation and preference test. The results obtained on average in each distillation amounted to 0.1%, then formulated with a concentration of essential oils of 1%, 2%, 3%, 4% and 5%. Moreover according to the skin pH, the results of the physical and homogeneity test were found a pH 6 that meets the standards, and from the preference test obtained a formula containing 3% of essential oils of shallots which are most in demand by respondents Keywords: Aromatherapy, onion (Allium cepa var. Aggregatum L ), formulation

Genetic Diversity Analysis Using Resistance Gene Analog-Based Markers to Support Morphological Characterization of Shallots

<p>Shallot (Allium cepa var. aggregatum) is one of the most important vegetable crops grown in Indonesia. The limited knowledge available on the genetic diversity and the threat of plant disease have been major problems to maintain high shallot production in Indonesia. Development of molecular markers linked to disease resistance is required for molecular breeding activity in this crop. This study aimed to assess the genetic diversity at conserved domain of resistance gene analog (RGA) in a set of 36 Indonesian shallot genotypes to complement morphological characterization. Twelve morphological and fifteen molecular markers traits were investigated in an attempt to characterize and to discriminate the Indonesian shallots genotypes. Characterization at orphological level indicated that phenotypic variance was highest for total bulb weight (TWB, cv = 99.39%) and the least for the plant height (PH, cv = 28.16%). The correlation analysis between traits showed that TWB and number of bulb (NB), TWB and bulb weight per plant (WB), NB and WB, and WB and PH were positively correlated. Molecular analysis revealed a total of 1,512 alleles with an average of 1.946 alleles per locus. The Polymorphism Information Content (PIC) values ranged from 0.253 to 0.676 and six out of 15 RGA markers were highly informative with PIC values ≥0.50. Based on cluster analysis, the 36 Indonesian shallot genotypes were clearly discriminated into six major groups. These results revealed that the RGA-based markers could support the morphological characterization in evaluating the genetic diversity of shallots. </p>

FORWARD CHAINING DALAM DIAGNOSIS PENYAKIT TUMBUHAN ALLIUM CEPA VAR AGGREGATUM

The agriculture department of Solok West Sumatra district especially Agricultural Extension Agency (BPP) of Lembang Jaya Sub-district, has decreased the productivity of onion every year. This plant has decreased because it often attacked by pests or diseases, and lack of knowledge about the symptoms of onion’s pests or diseases. To fix this problem, made an application to facilitate the farmers, to know the type of pest or disease from symptoms on the onion and solution of each type of diseases. The method used is Forward Chaining. Forward Chaining Method is collection of data from each symptom that appear on the Allium Cepa Var Aggregatum. Then, made a decision to get the results about the solution and type of disease on the Allium Cepa Var Aggregatum. The results of this study is to show the type of disease and solution that has been detected based on symptoms on the Allium Cepa Var Aggregatum.

Development and validation of UHPLC-HRMS methodology for the determination of flavonoids, amino acids and organosulfur compounds in black onion, a novel derived product from fresh shallot onions (Allium cepa var. aggregatum)

Black onion, a new derived product from fresh onion, has been developed by processing (aging) fresh shallot onion in a temperature- and humidity-controlled room without using any artificial additives. The aim of this study was to adapt, optimize and validate two ultra-high-performance liquid chromatography-high resolution mass spectrometry (UHPLC-HRMS) methodologies for the determination of flavonoids, amino acids and organosulfur compounds in black onion. UHPLC-HRMS methods involving RP-C18 and HILIC columns were adapted and validated in terms of specificity, linearity, limit of detection (LD) and quantification (LQ), precision inter- and intra-day, recovery and matrix effect. Linearity ranged from 0.012 to 12.5 ngμL−1 and from 0.1 to 75 ngμL−1 for flavonoid and amino acids and organosulfur compounds, respectively. LD varied from 0.004 to 0.06 ngμL−1 and LQ from 0.012 to 0.2 ngμL−1. The intra-day and inter-day precision for all compounds were less than 15% and the recovery ranged from 69 to 106%. The matrix effect ranged from 80 to 114% for flavonoids, amino acids and organosulfur compounds. The described methods were successfully applied for the correct separation and determination of 53 compounds in black onion. These results establish the value of these new two UHPLC-HRMS protocols in providing detailed compound profiles of black onion, highlighting their potential applicability to similar vegetables.

EFFECT OF RED ONION (ALLIUM CEPA VAR. AGGREGATUM G. DON) ON SERUM URIC ACID LEVEL AND TOTAL ANTIOXIDANT STATUS IN NORMAL AND INDUCED HYPERURICEMIC RATS

Objective: This study aimed to investigate the effect of onion (Allium cepa var. aggregatum G. Don) on serum uric acid level and total antioxidant status of normal and induced hyperuricemic rats.Methods: A total of 36 male Sprague-Dawley rats were divided equally into six groups, and 250 mg/kg of potassium oxonate was injected intraperitoneally on day 1, 3, and 7 to induce hyperuricemia in rats. 7 d consecutively of treatment were given to the rats by oral gavage. Serum uric acid level was measured 2 h after the induction on day 1, 3, 7, and 14. Blood plasma was obtained at day 14 to measure its total antioxidant status. The rats were sacrificed by taking out their liver and kidney for histopathological evaluation.Results: The results showed that onion juice lowered the serum uric acid level in dose-dependent manner. The highest dose (10.5 g/kg/day) appeared to possess the inhibitory effect almost similar to allopurinol. There was an increase in total antioxidant status in a hyperuricemic group treated with onion juice compared to control groups but insignificant. By viewing the histological profile, onion showed to have a protective effect toward the liver damage by hyperuricemia. However, this was not happened in kidney.Conclusion: Onion lowered the serum uric acid level, but its protective effect toward liver and kidney remained ambiguous. Further investigation with the increase of parameters and inclusion of analytical test of bioactive compound in red onion is recommended for the future studies.