First Report of Onion Yellow Dwarf Virus on Shallot (Allium cepa var. aggregatum) in China

Abstract

Allium species are economically important crops in the world. Viruses are among the most important pathogens affecting their yield, especially those belonging to the genera Potyvirus, Carlavirus, and Allexivirus (Katis et al. 2012). Members of the genus Potyvirus are usually the most abundant and cause most of the damage induced. Onion yellow dwarf virus (OYDV) and Leek yellow stripe virus (LYSV) are often found in almost all Allium-cultivating regions and cause significant yield losses worldwide (Katis et al. 2012; Milosevic et al. 2015). In May 2017, severe leaf twisting, yellowing, and plant stunting were observed on shallot (Allium cepa var. aggregatum) in Jilin and Heilongjiang provinces of China. The disease was found in 77% of fields of shallot (total 12,000 ha) in 2017 and 2018. A total of 29 symptomatic plants were collected and tested using double antibody sandwich (DAS)-ELISA kits (DSMZ, Braunschweig, Germany) for the presence of OYDV and LYSV and a triple antibody sandwich ELISA kit (DSMZ) for shallot latent virus (SLV). OYDV was detected in 24 out of 29 shallot samples, and all were negative for LYSV and SLV. The virus was mechanically transmitted from an ELISA-positive sample to 10 plants of shallot using 0.01 M phosphate buffer (pH 7). All 10 mechanically inoculated plants of shallot developed symptoms identical to those observed on the original host plants 21 days postinoculation. All 10 inoculated plants were DAS-ELISA positive for OYDV. Presence of OYDV in ELISA-positive shallot plants was further confirmed by reverse transcription polymerase chain reaction (RT-PCR). Total RNAs were extracted using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany); reverse transcription and PCR were carried out with the PrimeScript II first Strand cDNA Synthesis Kit (Takara, Japan) and Premix Taq (Ex Taq version 2.0) (Takara, Japan). OYDV coat protein (CP) specific primer pair (U: GCCGGCCCAGGGGAGGATG; D: CATTCTGACTCCAAGCAGAG) designed to amplify the complete CP gene was used for amplification. All infected shallot plants yielded an amplicon of the expected size (774 bp), whereas no amplification products were obtained from healthy controls. The RT-PCR product derived from the isolate JL1-3 was sequenced after T vector ligation with a pMD18-T Vector Cloning Kit (Takara, Japan) and submitted to GenBank (accession no. KY347900). Pairwise comparison of the JL1-3 isolate CP sequence with other homologous sequences available in GenBank was conducted, and sequence analysis showed that CP gene of this Chinese isolate shared the highest nucleotide identity of 97 and 95% with the CP gene of OYDV isolates OYDV-AT and AC-41 (GenBank accession nos. JX433020 and Y11826) from Germany and Netherlands, respectively. To our knowledge, this is the first report of OYDV on shallot in China. Further investigation is necessary to prevent the spread of this pathogen to new locations and to new hosts (Naderi Saffar et al. 2013) in China.