Two-step Assay Research Articles

Isothermal Background-Free Nucleic Acid Quantification by a One-Pot Cas13a Assay Using Droplet Microfluidics.

High sensitivity and specificity nucleic acid detection has been achieved by the Cas13a collateral effect in combination with a separate recombinase polymerase amplification (RPA). However, these emerging methods cannot provide accurate quantification of nucleic acids because the two-step assay performance may be compromised if the RPA and Cas13a reactions are simply unified in a single step. In this work, we first addressed the challenges associated with enzymatic incompatibility and the macromolecular crowding effect in the one-pot assay development, making the consolidated RPA-Cas13a assay a facile and robust diagnostic tool. Next, we found that the one-pot reaction cannot precisely quantify the targets at low concentrations. Thus, by leveraging droplet microfluidics, we converted the one-pot assay to a digital quantification format, termed Microfluidics-Enabled Digital Isothermal Cas13a Assay (MEDICA). Due to the droplet compartmentation, MEDICA greatly accelerates the reaction and enables relative detection in 10 min and the end-point quantification in 25 min. Moreover, MEDICA facilitates the droplet binarization for counting because of background-free signals generated by trans-cleavage reporting of Cas13a. Our clinical validation highlights that CRISPR-based isothermal assays are promising for the next generation of nucleic acid quantification methods.

First report of Apium virus Y in wild carrot (Daucus carota ssp. carota) in Spain

Apium virus Y (ApVY), a member of the genus Potyvirus, infects cultivated, weedy, and wild Apiaceae species, in which it may be asymptomatic (Eastwell et al., 2008) or cause symptoms such as leaf mosaic, interveinal chlorosis, vein clearing, deformation and/or stunting. Since its first identification in Australia where it is considered endemic (Moran et al., 2002), ApVY has also been reported in Germany, Slovenia, New Zealand and the USA (EFSA, 2022). Natural infection of ApVY has been reported in celery, coriander, dill, parsley, Ammi majus and Conium maculatum, while other Apiaceae species as well as some Chenopodiaceae, and Nicotiana benthamiana have been reported as experimental hosts (EFSA Panel on Plant Health, 2022). In June 2021, six carrot populations (five cultivated carrot fields and a wild carrot population) were sampled near Segovia, Central Spain. From each population, leaf samples were randomly collected from fifty plants, including asymptomatic and symptomatic (reddening or chlorosis), and pooled into one sample. Double-stranded RNAs were extracted from each pool and converted to complementary DNA (Marais et al., 2018) before being sequenced (2 × 125 nt paired reads; Illumina Hiseq2500), yielding between 2 and 6.5 million reads per sample. Analysis of the obtained sequence data by mapping reads on viral reference genomes using CLC Genomics Workbench v22.0 revealed a high number of reads from the wild carrot population (331,258 reads or c. 13% of the total) mapping at high stringency (>90% identity over >95% of read length) on the genomic RNA sequence of ApVY (GenBank Accession No. HM363516). De novo assembly of reads from the wild carrot population and contig BlastX annotation allowed the identification of 15 contigs of between 360 and 2,530 nt which could be scaffolded and extended by successive rounds of mapping of remaining reads into two complete, 9,916 nt-long genomic sequences of ApVY. These two sequences are 95.1% identical and share 84.8-86.2% identity with other full-length ApVY genomic sequences available in GenBank. To confirm the presence of ApVY in the sampled wild carrot population, a two-step RT-PCR assay with detection primers (ApVY_458_F: 5′ACGCCATGCATTTCAAGTGTCC3′ and ApVY_458_R: 5′ATGTGTTCGTGATCAGGGTGC3′) designed to generate a 458 nt amplicon was used on the dsRNAs extracted from the pooled sample. Sanger sequencing of the amplicon (OM801196) showed it to be identical to one of the sequences obtained by Illumina sequencing. To our knowledge, this is the first reported case of natural ApVY infection in wild carrot and the first report of the virus in Spain, enabling us to increase the information on ApVY's distribution throughout Europe and suggesting this pathogenic virus might pose a problem at some point in carrot crops. Given the mixed infection status of the pool of plants sampled in the wild carrot population as evidenced by the HTS results, it is not possible to evaluate the pathogenicity of ApVY in this host. Efforts are clearly needed to evaluate its presence and potential impact in cultivated carrot crops. This study was funded by the European Union through a Horizon 2020 Marie Skłodowska-Curie Actions Innovative Training Network (H2020 MSCA- 60 ITN) project “INEXTVIR” (GA 813542).

A two-step bioluminescence assay for optimizing antibacterial coating of hollow-fiber membranes with polydopamine in an integrative approach

Pure-water filtration membranes are often fouled by bacterial biofilms. Antibacterial coatings for preventing biofilm formation on such membranes should not rely on leaching of inhibiting compounds but should only be effective on surface contact. Certified assays for antibacterial coatings do not sufficiently exclude leaching effects and involve nutrient-rich cultivation media that do not correspond to conditions in pure-water systems. In this study, a two-step bioluminescence assay was developed for optimizing an antibacterial coating of PES/PVP ultrafiltration hollow-fiber membranes with a polydopamine as a sustainable, bio-inspired material for preventing bacterial biofilm formation. In the first step, leaching of the antimicrobial coating was analyzed by a bioluminescence assay with supernatants generated by washing coated membranes. In the second step, bioluminescence of bacterial biofilms on coated and uncoated membranes was measured using a nutrient-poor medium resembling site-specific conditions. Based on this bioluminescence assay, an optimized protocol for the coating process could be established by acidic polymerization of dopamine using 2 g/L sodium periodate and 4 g/L dopamine at 40 °C for 20 min reaction time. With coatings produced in this way, bioluminescence was reduced on coated membranes only while the corresponding supernatants exhibited no inhibitory effects.

Multiplex size marker (YEAST PLEX) for rapid and accurate identification of pathogenic yeasts.

BackgroundMultiple yeast species can cause human disease, involving superficial to deep‐seated infections. Treatment of these infections depends on the accurate identification of causative agents; however, reliable methods are not available in many laboratories, especially not in resource‐limited settings. Here, a new multiplex assay for rapid and low‐cost identification of pathogenic yeasts is described.MethodsA two‐step multiplex assay named YEAST PLEX that comprises of four tubes and identifies 17 clinically important common to rare yeasts was designed and evaluated. The set also provides PCR amplicon of unidentified species for direct sequencing. The specificity of YEAST PLEX was tested using 28 reference strains belonging to 17 species and 101 DNA samples of clinically important non‐target bacteria, parasites, and fungi as well as human genomic DNA. The method was further analyzed using 203 previously identified and 89 unknown clinical yeast isolates. Moreover, the method was tested for its ability to identify mixed yeast colonies by using 18 mixed suspensions of two or three species.ResultsYEAST PLEX was able to identify all the target species without any non‐specific PCR products. When compared to PCR‐sequencing/MALDI‐TOF, the results of YEAST PLEX were in 100% agreement. Regarding the 89 unknown clinical isolates, random isolates were selected and subjected to PCR‐sequencing. The results of sequencing were in agreement with those of YEAST PLEX. Furthermore, this method was able to correctly identify all yeasts in mixed suspensions.ConclusionYEAST PLEX is an accurate, low‐cost, and rapid method for identification of yeasts, with applicability, especially in developing countries.

Rapid Detection of Gram-Positive and -Negative Bacteria in Water Samples Using Mannan-Binding Lectin-Based Visual Biosensor.

Waterborne bacterial infection is a health threat worldwide, making accurate and timely bacteria detection crucial to prevent waterborne disease outbreaks. Inspired by the intrinsic capability of mannan-binding lectin (MBL) in recognizing the pathogen-associated molecular patterns (PAMPs), a visual biosensor is developed here for the on-site detection of both Gram-positive and -negative bacteria. The biosensor was synthesized by immobilization of the MBL protein onto the blue carboxyl-functionalized polystyrene microparticles (PSM), which is then used in a two-step assay to detect bacterial cells in water samples. The first step involved a 20 min incubation following the MBL-PSM and calcium chloride solution addition to the samples. The second step was to add ethanol to the resultant blue mixture and observe the color change with the naked eye after 15 min. The biosensor had a binary (all-or-none) response, which in the presence of bacterial cells kept its blue color, while in their absence the color changed from blue to colorless. Testing the water samples spiked with four Gram-negative bacteria including Acinetobacter baumannii, Escherichia coli, Klebsiella pneumoniae, and Pseudomonas aeruginosa and two Gram-positive bacteria of Enterococcus faecalis and Staphylococcus aureus showed that the biosensor could detect all tested bacteria with a concentration as low as 101.5 CFU/ml. The performance of biosensor using the water samples from a water treatment plant also confirmed its capability to detect the pathogens in real-life water samples without the need for instrumentation.

A two-step competition assay for visual, sensitive and quantitative C-reactive protein detection in low-cost microfluidic particle accumulators

Monitoring C-reactive protein (CRP) levels in point-of-care testing (POCT) scenarios is of great value in early diagnosis, prevention and treatment of inflammation in patient’s home, development country as well as other resource-limited settings. Here, we reported a sensitive, economic and simple biosensing approach for visual and sensitive CRP detection by trapping and accumulating microparticles in a photolithography-free, low-cost microfluidic chip. A competition assay among microparticles, magnetic nanoparticles and CRP antigen is utilized to quantify the CRP concentrations. When CRP antigen is present, fewer magnetic nanoparticles can bind to antibody-conjugated microparticles, leaving the free microparticles flowing and trapping in a microfluidic particle accumulation chip after magnetic separation, and forming a length-quantifiable visual bar, which is proportional to the concentrations of CRP in detection samples. Therefore, the target protein can be quantitatively detected by reading the length-quantifiable visual bar in a microfluidic channel by the naked eyes. Of note, a novel two-step competition assay was utilized to achieve the highly sensitive and specific CRP detection with a limit of detection (LOD) of ~ 32 pg/mL, and a wide detection range from 100 pg/mL to 10 µg/mL. The developed method also showed high selectivity, good accuracy and great stability to different temperature and incubation time. More importantly, the design of the sensor could be applicable for detecting any other biomarkers feasibly, thus providing a universal platform for visual, sensitive and economic clinical biomarker measurement by the naked eyes for POCT applications without any auxiliary equipment.

A Sensitive and Quantitative Assay to Enumerate and Measure Mycobacterium leprae Viability in Clinical and Experimental Specimens.

Mycobacterium leprae, the etiologic agent of leprosy, cannot be cultured on artificial media. This characteristic, coupled with its long generation time, presents a number of unique challenges to studying this pathogen. One of the difficulties facing both researchers and clinicians is the absence of a rapid test to measure the viability of M. leprae in clinical or experimental specimens. The lack of such a tool limits the understanding of M. leprae immunopathogenesis and makes determining the efficacy of drug treatments difficult. With this in mind, we developed a robust two-step molecular viability assay (MVA) that first enumerates the M. leprae in the tissue; then, this data is used to normalize bacterial RNA quantities for the second step, in which the expression of M. leprae esxA and hsp18 are measured. This assay is specific and sensitive enough to be used on most clinical samples. This protocol describes the steps required to extract DNA and RNA from M. leprae-infected tissue, enumerate M. leprae, and measure M. leprae viability based on the normalized expression of two M. leprae-specific genes (hsp18 and esxA). This protocol also outlines an optimal laboratory design and workflow for performing this assay. © 2022 The Leprosy Mission Nepal. Current Protocols published by Wiley Periodicals LLC. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Basic Protocol 1: DNA and RNA P purification from M. leprae-infected tissue Basic Protocol 2: Enumeration of M. leprae by RLEP qPCR on the DNA fraction Basic Protocol 3: Calculation of M. leprae per tissue and normalization of RNA Basic Protocol 4: Reverse-transcription of normalized RNA to generate cDNA Basic Protocol 5: Determination of M. leprae viability using HSP18 and ESXA qPCR on the cDNA Support Protocol 1: M. leprae qPCR primer/probe stock preparation Support Protocol 2: Preparation of plasmid stocks and standard curves.

Detection and quantification of antibody to SARS CoV 2 receptor binding domain provides enhanced sensitivity, specificity and utility

Accurate and sensitive detection of antibody to SARS-CoV-2 remains an essential component of the pandemic response. Measuring antibody that predicts neutralising activity and the vaccine response is an absolute requirement for laboratory-based confirmatory and reference activity.The viral receptor binding domain (RBD) constitutes the prime target antigen for neutralising antibody. A double antigen binding assay (DABA), providing the most sensitive format has been exploited in a novel hybrid manner employing a solid-phase S1 preferentially presenting RBD, coupled with a labelled RBD conjugate, used in a two-step sequential assay for detection and measurement of antibody to RBD (anti-RBD).This class and species neutral assay showed a specificity of 100 % on 825 pre COVID-19 samples and a potential sensitivity of 99.6 % on 276 recovery samples, predicting quantitatively the presence of neutralising antibody determined by pseudo-type neutralization and by plaque reduction. Anti-RBD is also measurable in ferrets immunised with ChadOx1 nCoV-19 vaccine and in humans immunised with both AstraZeneca and Pfizer vaccines. This assay detects anti-RBD at presentation with illness, demonstrates its elevation with disease severity, its sequel to asymptomatic infection and its persistence after the loss of antibody to the nucleoprotein (anti-NP). It also provides serological confirmation of prior infection and offers a secure measure for seroprevalence and studies of vaccine immunisation in human and animal populations.The hybrid DABA also displays the attributes necessary for the detection and quantification of anti-RBD to be used in clinical practice. An absence of detectable anti-RBD by this assay predicates the need for passive immune prophylaxis in at-risk patients.

Magnetic Nanoparticles Enhanced Surface Plasmon Resonance Biosensor for Rapid Detection of Salmonella Typhimurium in Romaine Lettuce.

Salmonella is one of the major foodborne pathogens responsible for many cases of illnesses, hospitalizations and deaths worldwide. Although different methods are available to timely detect Salmonella in foods, surface plasmon resonance (SPR) has the benefit of real-time detection with a high sensitivity and specificity. The purpose of this study was to develop an SPR method in conjunction with magnetic nanoparticles (MNPs) for the rapid detection of Salmonella Typhimurium. The assay utilizes a pair of well-characterized, flagellin-specific monoclonal antibodies; one is immobilized on the sensor surface and the other is coupled to the MNPs. Samples of romaine lettuce contaminated with Salmonella Typhimurium were washed with deionized water, and bacterial cells were captured on a filter membrane by vacuum filtration. SPR assays were compared in three different formats—direct assay, sequential two-step sandwich assay, and preincubation one-step sandwich assay. The interaction of flagellin and MNPs with the antibody-immobilized sensor surface were analyzed. SPR signals from a sequential two-step sandwich assay and preincubation one-step sandwich assay were 7.5 times and 14.0 times higher than the direct assay. The detection limits of the assay were 4.7 log cfu/mL in the buffer and 5.2 log cfu/g in romaine lettuce samples.

Establishing diagnostic algorithms for SARS-CoV-2 nucleic acid testing in clinical practice.

Coronavirus disease 2019 (COVID-19), which is caused by severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), has become a global pandemic. Our laboratory initially used a two-step molecular assay, first reported by Corman et al, for SARS-CoV-2 identification (the Taiwan Center for Disease Control [T-CDC] method). As rapid and accurate diagnosis of COVID-19 is required to control the spread of this infectious disease, the current study evaluated three commercially available assays, including the TaqPath COVID-19 Combo kit, the cobas SARS-CoV-2 test, and the Rendu 2019-nCoV Assay kit, to establish diagnostic algorithms for clinical laboratories. A total of 790 clinical specimens, including nasopharyngeal swabs, throat swabs, sputum, saliva, stool, endotracheal aspirate, and serum were obtained from patients who were suspected or already confirmed to have COVID-19 at the Taipei Veterans General Hospital from February to May 2020. These specimens were tested for SARS-CoV-2 using the different assays and the performance variance between the assays was analyzed. Of the assays we evaluated, the T-CDC method and the TaqPath COVID-19 Combo kit require lots of hands-on practical laboratory work, while the cobas SARS-CoV-2 test and the Rendu 2019-nCoV Assay kit are fully automated detection systems. The T-CDC method and the TaqPath COVID-19 Combo kit showed similar detection sensitivity; however, the T-CDC method frequently delivered false-positive signals for envelope (E) and/or RNA-dependent RNA polymerase (RdRP) gene detection, thus increasing the risk of reporting false-positive results. A manual test-based testing strategy combining the T-CDC method and the TaqPath COVID-19 Combo kit was developed, which demonstrated excellent concordance rates (>99%) with the cobas and Rendu automatic systems. There were a few cases showing discrepant results, which may be due to the varied detection sensitivities as well as targets among the different platforms. Moreover, the concordance rate between the cobas and Rendu assays was 100%. Based on our evaluation, two SARS-CoV-2 diagnostic algorithms, one focusing on the manual assays and the other on the automatic platforms, were proposed. Our results provide valuable information that allows clinical laboratories to implement optimal diagnostic strategies for SARS-CoV-2 testing based on their clinical needs, such as test volume, turn-around time, and staff/resource limitations.

Two-Step Competitive Hybridization Assay: A Method for Analyzing Cancer-Related microRNA Embedded in Extracellular Vesicles.

With an increased understanding of the role of microRNAs (miRNAs) in cancer evolution, there is a growing interest in the use of these non-coding nucleic acids in cancer diagnosis, prognosis, and treatment monitoring. miRNAs embedded in extracellular vesicles (EVs) are of particular interest given that circulating EVs carry cargo that are strongly correlated to their cells of origin such as tumor cells while protecting them from degradation. As such, there is a tremendous interest in new simple-to-operate vesicular microRNA analysis tools for widespread use in performing liquid biopsies. Herein, we present a two-step competitive hybridization assay that is rationally designed to translate low microRNA concentrations to large electrochemical signals as the measured signal is inversely proportional to the microRNA concentration. Using this assay, with a limit-of-detection of 122 aM, we successfully analyzed vesicular miRNA 200b from prostate cancer cell lines and human urine samples, demonstrating the expected lower expression levels of miRNA 200b in the EVs from prostate cancer cells and in the prostate cancer patient's urine samples compared to healthy patients and non-tumorigenic cell lines, validating the suitability of our approach for clinical analysis.

Rapid and Sensitive Detection of Salmonella spp. Using CRISPR-Cas13a Combined With Recombinase Polymerase Amplification.

Salmonella spp. is one of the most common foodborne disease-causing pathogens that can cause severe diseases in very low infectious doses. Rapid and sensitive detecting Salmonella spp. is advantageous to the control of its spread. In this study, a conserved short fragment of the Salmonella invA gene was selected and used to design primers and specific crRNA (CRISPR RNA) for establishing a one-tube and two-step reaction system for Salmonella spp. detection, by combining recombinase polymerase amplification (RPA) with CRISPR-Cas13a (Clustered Regularly Interspaced Short Palindromic Repeats associated protein 13a) cleavage. The established one-tube RPA-Cas13a method can complete the detection within 20 min and the two-step RPA-Cas13a method detection time within 45 min. The designed primers were highly specific to Salmonella spp. and had no cross-reaction with the other nine diarrheal bacteria. The one-tube RPA-Cas13a could detect the Salmonella genome with the limit of 102 copies, which was the same as real-time polymerase chain reaction (PCR), but less sensitive than two-step RPA-Cas13a (100 copies). The detection results of one-tube or two-step RPA-Cas13a and real-time PCR were highly consistent in clinical samples. One-tube RPA-Cas13a developed in this study provides a simple, rapid, and specific detection method for Salmonella spp. While two-step assay was more sensitive and suitable for samples at low abundance.

Kinomics platform using GBM tissue identifies BTK as being associated with higher patient survival.

Better understanding of GBM signalling networks in-vivo would help develop more physiologically relevant ex vivo models to support therapeutic discovery. A "functional proteomics" screen was undertaken to measure the specific activity of a set of protein kinases in a two-step cell-free biochemical assay to define dominant kinase activities to identify potentially novel drug targets that may have been overlooked in studies interrogating GBM-derived cell lines. A dominant kinase activity derived from the tumour tissue, but not patient-derived GBM stem-like cell lines, was Bruton tyrosine kinase (BTK). We demonstrate that BTK is expressed in more than one cell type within GBM tissue; SOX2-positive cells, CD163-positive cells, CD68-positive cells, and an unidentified cell population which is SOX2-negative CD163-negative and/or CD68-negative. The data provide a strategy to better mimic GBM tissue ex vivo by reconstituting more physiologically heterogeneous cell co-culture models including BTK-positive/negative cancer and immune cells. These data also have implications for the design and/or interpretation of emerging clinical trials using BTK inhibitors because BTK expression within GBM tissue was linked to longer patient survival.

Different Aspects of Classical Pathway Overactivation in Patients With C3 Glomerulopathy and Immune Complex-Mediated Membranoproliferative Glomerulonephritis.

The rare and heterogeneous kidney disorder C3 glomerulopathy (C3G) is characterized by dysregulation of the alternative pathway (AP) of the complement system. C3G is often associated with autoantibodies stabilizing the AP C3 convertase named C3 nephritic factors (C3NeF). The role of classical pathway (CP) convertase stabilization in C3G and related diseases such as immune complex-mediated membranoproliferative glomerulonephritis (IC-MPGN) remains largely unknown. Here, we investigated the CP convertase activity in patients with C3G and IC-MPGN. Using a refined two-step hemolytic assay, we measured the stability of CP convertases directly in the serum of 52 patients and 17 healthy controls. In four patients, CP convertase activity was prolonged compared to healthy controls, i.e. the enzymatic complex was stabilized. In three patients (2 C3G, 1 IC-MPGN) the convertase stabilization was caused by immunoglobulins, indicating the presence of autoantibodies named C4 nephritic factors (C4NeFs). Importantly, the assay also enabled detection of non-immunoglobulin-mediated stabilization of the CP convertase in one patient with C3G. Prolonged CP convertase activity coincided with C3NeF activity in all patients and for up to 70 months of observation. Crucially, experiments with C3-depleted serum showed that C4NeFs stabilized the CP C3 convertase (C4bC2a), that does not contain C3NeF epitopes. All patients with prolonged CP convertase activity showed clear signs of complement activation, i.e. lowered C3 and C5 levels and elevated levels of C3d, C3bc, C3bBbP, and C5b-9. In conclusion, this work provides new insights into the diverse aspects and (non-)immunoglobulin nature of factors causing CP convertase overactivity in C3G/IC-MPGN.

Glucose-oxidase like catalytic mechanism of noble metal nanozymes

Au nanoparticles (NPs) have been found to be excellent glucose oxidase mimics, while the catalytic processes have rarely been studied. Here, we reveal that the process of glucose oxidation catalyzed by Au NPs is as the same as that of natural glucose oxidase, namely, a two-step reaction including the dehydrogenation of glucose and the subsequent reduction of O2 to H2O2 by two electrons. Pt, Pd, Ru, Rh, and Ir NPs can also catalyze the dehydrogenation of glucose, except that O2 is preferably reduced to H2O. By the electron transfer feature of noble metal NPs, we overcame the limitation that H2O2 must be produced in the traditional two-step glucose assay and realize the rapid colorimetric detections of glucose. Inspired by the electron transport pathway in the catalytic process of natural enzymes, noble metal NPs have also been found to mimic various enzymatic electron transfer reactions including cytochrome c, coenzymes as well as nitrobenzene reductions.

Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Ultrasensitive Detection of SARS-CoV-2 in Saliva and Viral Transport Medium Clinical Samples.

The COVID-19 pandemic has underscored the shortcomings in the deployment of state-of-the-art diagnostics platforms. Although several polymerase chain reaction (PCR)-based techniques have been rapidly developed to meet the growing testing needs, such techniques often need samples collected through a swab, the use of RNA extraction kits, and expensive thermocyclers in order to successfully perform the test. Isothermal amplification-based approaches have also been recently demonstrated for rapid severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) detection by minimizing sample preparation while also reducing the instrumentation and reaction complexity. In addition, there are limited reports of saliva as the sample source, and some of these indicate inferior sensitivity when comparing reverse transcription loop-mediated isothermal amplification (RT-LAMP) with PCR-based techniques. In this paper, we demonstrate an improved sensitivity assay from saliva using a two-step RT-LAMP assay, where a short 10 min RT step is performed with only B3 and backward inner primers before the final reaction. We show that while the one-step RT-LAMP demonstrates satisfactory results, the optimized two-step approach allows detection of only few molecules per reaction and performs significantly better than the one-step RT-LAMP and conventional two-step RT-LAMP approaches with all primers included in the RT step. We show control measurements with RT-PCR, and importantly, we demonstrate RNA extraction-free RT-LAMP-based assays for detection of SARS-CoV-2 from viral transport media and saliva clinical samples.

A revisited two-step microtiter plate assay: Optimization of in vitro multiplicity of infection (MOI) for Coliphage and Vibriophage

A 2-step microtiter plate assay was developed to simultaneously check wide values of MOIs of bacteriophages, ranging between MOI-0.0001 and MOI-10000 in the first step and optimize the most suitable MOI (lowest quantity of phage) for inhibiting the growth of the target bacteria in the second step. The results of the first step revealed that the effective MOI of coliphage-ɸ5 for controlling the growth of antimicrobial resistant (AMR) E. coli was between 4.36 and 43.6 for E.coli-EC-3; between 38.2 and 382 for E.coli-EC-7 and between 81.5 and 815 for E.coli-EC-11. The optimum MOI of coliphage-ɸ5 determined in the second step was 17.44, 191 and 326 for controlling the growth of E.coli-EC-3; E.coli-EC-7 and E.coli-EC-11, respectively. The effective MOI of vibriophage-ɸLV6 for controlling luminescent Vibrio harveyi in the first step was found to be between 18.3 and 183 and the optimum MOI as determined in the second step was 79. The sequential 2-step microtiter plate method yielded faster optimization of MOI and was economical compared to the conventional flask method. The measurement of OD values at 550 nm and 600 nm showed similar trend and replicate data from 5-wells and 3-wells yielded identical pattern indicating that the measuring absorbance data in 3-replicate wells at either OD550 or OD600 is sufficient to generate quantifiable phage lysis data. The 2-step microtiter plate assay finds application in phage therapy in human health care, agriculture and animal agriculture for determining the optimum MOIs for selected bacteriophages.

Single Molecule Assay for Ultrasensitive Detection of Cathepsin B in Human Blood.

Cathepsin B (catB) is a lysosomal cysteine protease expressed in several cells and organs, where it plays a role in protein degradation and turnover. Extracellular, secreted catB has utility as a biomarker for a host of pathological or physiological states, including a myriad of cancers or neurological diseases and injuries. Analytical or diagnostic assessment may be limited by biological sample volume availability. Pathologically relevant changes in catB levels may occur at low-moderate concentrations that require accurate measurement to differentiate from basal levels. Furthermore, biological samples like plasma and serum, often occlude accurate catB measurements because of background and high variance, vastly limiting the ability to detect catB as a peripheral biomarker. Techniques for ultrasensitive protein detection that require low volumes of sample are necessary. To overcome these challenges, a digital enzyme-linked immunosorbent assay (ELISA) was developed for differential detection of catB within less than 5 μL of serum and plasma using the single molecule array (SiMoA) platform, which offers 1000-times more sensitivity and vastly reduced variance compared to colorimetric tests. In buffer, curve-fitting estimated the limit of detection (LoD) to be ∼1.56 and ∼8.47 pg/mL using two-step or three-step assay configurations, respectively. After correcting for endogenous levels, the estimated LoD was ∼4.7 pg/mL in the serum or plasma with the two-step assay. The lower limit of quantitation was ∼2.3 pg/mL in the buffer and ∼9.4 pg/mL in the serum or plasma, indicting the ability to measure small changes above endogenous levels within blood samples.

Research Highlights.

Research Highlights.

Comprehensive epitope mapping using polyclonally expanded human CD8 T cells and a two-step ELISpot assay for testing large peptide libraries

The genetic diversity of circulating HIV-1 strains poses a major barrier to the design, development and evaluation of HIV-1 vaccines. The assessment of both vaccine- and natural infection-elicited T cell responses is commonly done with multivalent peptides that are designed to maximally capture the diversity of potential T cell epitopes (PTEs) observed in natural circulating sequences. However, depending on the sequence diversity of viral subtypes and number of the HIV immunogens under investigation, PTE estimates, including HLA-guided computational methods, can easily generate enormous peptide libraries. Evaluation of T cell epitope specificity using such extensive peptide libraries is usually limited by sample availability, even for high-throughput and robust epitope mapping techniques like ELISpot assays. Here we describe a novel, two-step protocol for in-vitro polyclonal expansion of CD8 T cells from a single vial of frozen PBMC, which facilitated the screening 441 HIV-1 Gag peptides for immune responses among 32 HIV-1 positive subjects and 40 HIV-1 negative subjects for peptide qualification. Using a pooled-peptide mapping strategy, epitopes were mapped in two sequential ELISpot assays; the first ELISpot screened 33 large peptide pools using CD8 T cells expanded for 7 days, while the second step tested pool-matrix peptides to identify individual peptides using CD8 T cells expanded for 10 days. This comprehensive epitope screening established the breadth and magnitude of HIV-1 Gag-specific CD8 T cells and further revealed the extent of immune responses to variable/polymorphic epitopes.