Tungsten Tube Research Articles

An impact of the material and diameter of tubes in the flowing liquid cathode atmospheric pressure glow discharge system on its analytical performance – Preliminary study

Tubes of different diameters and materials were tested as solution (tungsten, molybdenum, titanium, corundum, quartz, and graphite) and gas (tungsten, molybdenum, and titanium) delivery tubes for the flowing liquid cathode atmospheric pressure glow discharge (FLC-APGD) microplasma system. For work purposes, FLC solutions both with and without the addition of formic acid were tested and the results were compared. Additionally, to elucidate the impact of various combinations of tubes on the excitation conditions in the discharge, the excitation (Texc(H)), rotational (Trot(OH)), and vibrational (Tvib(OH)) temperatures, as well as the electron number density were all determined. It was found that certain combinations of the tubes affected the discharge stability, therefore, either the precision was poor or the discharge could not be maintained at all. As a result, detection limits (DLs) of the studied elements were assessed for some combinations of tubes in order to establish the impact of the discharge stability on the background fluctuations. It was noticed that certain materials of the tubes, namely tungsten and corundum, were superior in terms of their resistance to the conditions under which the discharge was sustained. The analytes signals were found to be slightly affected by changing tubes, however, it was shown that the tungsten and corundum tubes provided better results in terms of signals intensity, than the other ones. Additionally, the commonly used combination of glass and graphite tubes turned out to give the lowest analytes signals and relatively high DLs.

Gas-jet HFCVD synthesis of diamonds from mixtures of hydrogen with ethylene and methane

The gas-jet deposition method (a modification of the Hot Filament Chemical Vapor Deposition method (HFCVD)) was used to deposit some diamond structures on a molybdenum substrate from a hydrogen-ethylene mixture activated on hot tungsten. The experiments were performed for two lengths of activation reactors at different ethylene flow rates. For comparison, some diamond structures were synthesized from a hydrogen-methane mixture under similar conditions. The resulting structures were studied with the scanning electron microscopy and Raman spectroscopy methods. The reacting mixture flow through the heated catalytic channel was simulated by solving the Navier-Stokes equations accounting for homogeneous and heterogeneous chemical reactions. The reactor (hot tungsten tube) length and diameter effects as well as carbonaceous admixture supply effects were analyzed. The main diamond precursor's formation pathways were analyzed and the reaction chains' complexity was demonstrated. The simulation results are in good agreement with the experimental data. The numerical experiments made it possible to reveal the growth process key driving parameters.

Collaborative Robotic Wire + Arc Additive Manufacture and Sensor-Enabled In-Process Ultrasonic Non-Destructive Evaluation.

The demand for cost-efficient manufacturing of complex metal components has driven research for metal Additive Manufacturing (AM) such as Wire + Arc Additive Manufacturing (WAAM). WAAM enables automated, time- and material-efficient manufacturing of metal parts. To strengthen these benefits, the demand for robotically deployed in-process Non-Destructive Evaluation (NDE) has risen, aiming to replace current manually deployed inspection techniques after completion of the part. This work presents a synchronized multi-robot WAAM and NDE cell aiming to achieve (1) defect detection in-process, (2) enable possible in-process repair and (3) prevent costly scrappage or rework of completed defective builds. The deployment of the NDE during a deposition process is achieved through real-time position control of robots based on sensor input. A novel high-temperature capable, dry-coupled phased array ultrasound transducer (PAUT) roller-probe device is used for the NDE inspection. The dry-coupled sensor is tailored for coupling with an as-built high-temperature WAAM surface at an applied force and speed. The demonstration of the novel ultrasound in-process defect detection approach, presented in this paper, was performed on a titanium WAAM straight sample containing an intentionally embedded tungsten tube reflectors with an internal diameter of 1.0 mm. The ultrasound data were acquired after a pre-specified layer, in-process, employing the Full Matrix Capture (FMC) technique for subsequent post-processing using the adaptive Total Focusing Method (TFM) imaging algorithm assisted by a surface reconstruction algorithm based on the Synthetic Aperture Focusing Technique (SAFT). The presented results show a sufficient signal-to-noise ratio. Therefore, a potential for early defect detection is achieved, directly strengthening the benefits of the AM process by enabling a possible in-process repair.

Analytical performance of Compton/Rayleigh signal ratio by total reflection X‐ray fluorescence (TXRF): A potential methodological tool for sample differentiation

AbstractThe high sensitivity Compton and Rayleigh X‐ray scattering signals can be used to gain valuable information on the chemical composition of various matrices, by exploiting the ratio of those signals as a function of the effective atomic number (Zeff). Neither total reflection X‐ray fluorescence (TXRF) nor the effect of the experimental setup, including sample preparation, X‐ray excitation source selection, and band deconvolution procedure, has been assessed in this kind of approach. Here, a Compton/Rayleigh ratio and Zeff‐based TXRF method was set up and tested as an analytical tool for milk samples differentiation. The method was developed using a 90° scattering angle and assessed using different X‐ray excitation sources: a molybdenum tube (Mo Kα 17.5 KeV) and a tungsten tube (W Lα 8.5 KeV and W‐Brems 35 KeV). The evaluation of independent Compton and Rayleigh signals was performed by non‐Gaussian and Gaussian curve resolution methods, and both height and area‐based calculations were evaluated. Different sample preparation conditions were assessed. By using 11 standard materials, a calibration curve for Compton/Rayleigh ratio versus Zeff was established. The method was tested to determine the Zeff of milk samples, which enabled its use as a parameter to differentiate them. Good precisions were obtained with the Mo excitation source and the area‐based calculations, which allowed to differentiate undiluted milk samples by species, treatment, and fat content according to their Compton/Rayleigh ratio. This simple and rapid method has the potential to be used for the differentiation of various types of samples, including liquids, solids, and aerosols.

Ultrasensitive determination of mercury by solution anode glow discharge atomic emission spectrometry coupled with hydride generation

An innovative method for the ultrasensitive detection of mercury by solution anode glow discharge atomic emission spectroscopy (SAGD-AES) coupled with hydride generation (HG) was first investigated. In this method, the mercury vapor generated by the HG was transmitted to the SAGD through the miniature hollow tungsten tube for excitation and detected by a miniaturized spectrograph. A thorough parametric evaluation of the HG and SAGD system was performed, including the type and concentration of carrier acid, He flow rate, concentrations of NaBH4, discharge current and discharge gap. Under optimal operating conditions, the detection limit for Hg2+ achieved 0.03 μg/L, with a relative standard deviation of 1.1% at the Hg2+ concentration of 5 μg/L. Moreover, the correlation coefficient of the calibration curve was 0.9996 in the range between 0.1 and 10 μg/L. The accuracy and practicability of HG-SAGD-AES were verified by measuring GBW09101b (human hair), GBW10029 (fish), soil and rice samples. The results showed good agreement with the certified values and values from direct mercury analyzer (DMA).

Dry-ED milling of micro-scale contours with high-speed rotating tungsten tube electrodes

This paper presents machining results for dry-ED milling of micro-scale contours by use of a new machine tool, including a relaxation generator, designed for dry-EDM. To implement the dry-ED milling process tungsten tube electrodes were used. The gas is injected through the tubular tool electrode under high pressure. Additionally, a high-speed EDM spindle was used to overcome process instabilities and increase the material removal rate due to better flushing conditions. Further, fluid simulations of the flushing conditions are presented in this paper. It is found that the use of gaseous dielectrics enables much better machining results in terms of shape accuracy and tool wear. The simulations provide new insights in the flushing conditions when using gaseous dielectrics. The calculated fluid flow pattern shows a great agreement with the observed depositions of reattached molten material on the tool and workpiece surface. The results presented as well as the hardware introduced enable the industrial application of dry-EDM for the first time.

Analysis of flows by deposition of diamond-like structures

The Direct Simulation Monte Carlo (DSMC) method is used to simulate the hydrogen–methane mixtures flowing through a heated cylindrical tungsten tube and expanding into a low-pressure chamber in the substrate holder direction. The DSMC method takes into account heterogeneous reactions in the tube and on the substrate surface. The results of DSMC simulation are used for the chemical kinetics calculations, i.e., axial distributions of species concentrations in various H/C mixtures. The effects of various parameters (reactor configuration, flow rate, initial concentration of methane in the mixture with hydrogen, and pressure in the chamber) on species fluxes to the substrate, the degree of hydrogen dissociation, the degree of methane decomposition, and further conversion of CxHy components up to atomic carbon C are numerically studied. The developed method provides a possibility of solving similar problems for nonequilibrium flows.

BrachyView: Combining LDR seed positions with transrectal ultrasound imaging in a prostate gel phantom

PurposeBrachyView is a novel in-body imaging system which aims to provide LDR brachytherapy seeds position reconstruction within the prostate in real-time. The first prototype is presented in this study: the probe consists of a gamma camera featuring three single cone pinhole collimators embedded in a tungsten tube, above three, high resolution pixelated detectors (Timepix). MethodsThe prostate was imaged with a TRUS system using a sagittal crystal with a 2.5mm slice thickness. Eleven needles containing a total of thirty 0.508U125I seeds were implanted under ultrasound guidance. A CT scan was used to localise the seed positions, as well as provide a reference when performing the image co-registration between the BrachyView coordinate system and the TRUS coordinate system. An in-house visualisation software interface was developed to provide a quantitative 3D reconstructed prostate based on the TRUS images and co-registered with the LDR seeds in situ. A rigid body image registration was performed between the BrachyView and TRUS systems, with the BrachyView and CT-derived source locations compared. ResultsThe reconstructed seed positions determined by the BrachyView probe showed a maximum discrepancy of 1.78mm, with 75% of the seeds reconstructed within 1mm of their nominal location. An accurate co-registration between the BrachyView and TRUS coordinate system was established. ConclusionsThe BrachyView system has shown its ability to reconstruct all implanted LDR seeds within a tissue equivalent prostate gel phantom, providing both anatomical and seed position information in a single interface.

Design of a dual-resolution collimator for preclinical cardiac SPECT with a stationary triple-detector system.

One approach to preclinical single-photon emission computed tomography (SPECT) imaging that provides both high resolution and high sensitivity is based on imaging a mouse inside a collimating tube; many magnified pinhole projection images from a small target region, e.g., the heart, can be recorded simultaneously on multiple detectors with little multiplexing since each pinhole aperture's opening angle is restricted to view mostly the target organ. However, to obtain complete data for reconstruction, it may be necessary to scan the mouse through the target region of the tube. The authors are developing a different approach based on acquisition and reconstruction of both low-resolution and high-resolution projection data acquired sequentially through many pinholes embedded in two tungsten tube sections of different diameters, a "scout" section and a high-resolution section, placed end-to-end along the axis of a triple-head clinical SPECT scanner. This paper describes the design procedures used to determine the geometric parameters of two new collimator-tube sections, as well as one approach for joint reconstruction of data acquired from both sections. The high-resolution section was designed by projecting as many pinhole views of a simulated mouse heart as possible over each detector's camera, with no overlapping of heart projections and minimal overlapping between adjacent "hot" organ and cardiac projections. The authors then jointly optimized the geometric design of the scout section for a triple-detector camera system, as well as the number of maximum-likelihood expectation maximization (MLEM) iterations required to provide minimum mean-squared error of reconstructed voxel counts throughout a 7-cm axial range, with the constraints of fixed, 2.4-mm scout system resolution at the tube center for all apertures, limited multiplexing, and no detector motion. Simulated mouse projection data from both tube sections were then reconstructed to illustrate a simple approach for using high-resolution data to improve the whole-body scout images within a cylindrical region surrounding the heart. The 2-cm-inner-radius high-resolution tube section accommodated 87 platinum-iridium pinhole inserts, each with a 0.3-mm square aperture; their radial distances from the centerline of the system ranged from 2.2 to 3.0 cm. The optimal radial distance to the closest scout pinhole and optimal number of MLEM iterations were 4.4 cm and 35 iterations, respectively, and the radial distances of the 39 scout pinholes ranged from 4.4 to 4.8 cm; aperture sizes ranged from 1.1 to 1.7 mm transaxially and 0.9-1.5 mm axially. After including data from the high-resolution section viewing the heart region into whole-body mouse reconstructions from scout data, the authors obtained high-resolution images of the heart, embedded within lower resolution images of the body, with minimal artifacts. The authors have optimized a dual-resolution collimator tube that provides both whole-body projections of a mouse and more targeted projections centered on the heart that can be jointly reconstructed to obtain high-resolution images of the heart embedded within lower-resolution whole-body images.

Geometric optimization of a solar cubic-cavity multi-tubular thermochemical reactor using a Monte Carlo-finite element radiative transfer model

In the present study, the optimization of a multi-tubular solar thermochemical cavity reactor is carried out. The reactor consists of a cubic cavity made of woven graphite, housing nine 2.54 cm diameter tungsten tubes. A heat transfer model is developed and implemented considering high-temperature radiative transfer at steady state. The temperature distribution on the receiver tubes is determined by using a hybrid Monte Carlo-finite volume approach. The optimization aims at maximizing average tube temperature by varying tube locations. Optimal tube distributions are explored by using a custom-made stochastic, multi-parameter, global optimization algorithm. A considerable increase in average temperature as well as improvement on temperature uniformity is found in the optimized tube arrays. Patterns among the different optimal distributions are found, and general features are discussed.

Electronic and structural properties of ultrathin tungsten nanowires and nanotubes by density functional theory calculation

The simulated annealing basin-hopping method incorporating the penalty function was used to predict the lowest-energy structures for ultrathin tungsten nanowires and nanotubes of different sizes. These predicted structures indicate that tungsten one-dimensional structures at this small scale do not possess B.C.C. configuration as in bulk tungsten material. In order to analyze the relationship between multi-shell geometries and electronic transfer, the electronic and structural properties of tungsten wires and tubes including partial density of state and band structures which were determined and analyzed by quantum chemistry calculations. In addition, in order to understand the application feasibility of these nanowires and tubes on nano-devices such as field emitters or chemical catalysts, the electronic stability of these ultrathin tungsten nanowires was also investigated by density functional theory calculations.

A new superimposed double-arc welding method with one arc submerged in the weld pool

This study presents a new double-gas tungsten arc welding heat source, with two arcs serially arranged on the same side of a workpiece. During welding, a tungsten tube and inert gas are additionally used to help the rear electric arcs burn at the bottom of the existing weld pool formed by the fore arc. Bead-on-plate welding experiments using this heat source are carried out to investigate the heating efficiency of the heat source and the influences of the arc current, the gas flow rate in the tube on the welding process. Results show that the heat source presents higher melting efficiency and stronger heat penetrability compared with normal double-gas tungsten arc welding. The interactions of the forces near the weld pool in the welding process are also analyzed. Observation of the arc behavior by a high-speed camera proves that the electromagnetic force between the two burning arcs stabilizes the burning arcs and thus the welding process.

Misfit strain of oxygen precipitates in Czochralski silicon studied with energy-dispersive X-ray diffraction

Annealed Czochralski Silicon wafers containing SiOx precipitates have been studied by high energy X-ray diffraction in a defocused Laue setup using a laboratory tungsten tube. The energy dispersive evaluation of the diffracted Bragg intensity of the 220 reflection within the framework of the statistical dynamical theory yields the static Debye-Waller factor E of the crystal, which gives access to the strain induced by the SiOx precipitates. The results are correlated with precipitate densities and sizes determined from transmission electron microscopy measurements of equivalent wafers. This allows for the determination of the constrained linear misfit ε between precipitate and crystal lattice. For samples with octahedral precipitates the values ranging from ε = 0.39 (+0.28/−0.12) to ε = 0.48 (+0.34/−0.16) indicate that self-interstitials emitted into the matrix during precipitate growth contribute to the lattice strain. In this case, the expected value calculated from literature values is ε = 0.26 ± 0.05. Further, the precise evaluation of Pendellösung oscillations in the diffracted Bragg intensity of as-grown wafers reveals a thermal Debye-Waller parameter for the 220 reflection B220(293 K) of 0.5582 ± 0.0039 Å2 for a structure factor based on spherically symmetric scattering contributions.

Electrothermal atomic absorption spectrometric determination of cadmium in environmental samples with niobium wire preconcentration method

A preconcentration method by adsorption of cadmium on a niobium wire was developed for the environmental waters, followed by electrothermal atomic absorption spectrometry with a tungsten tube atomizer. After the preconcentration, the niobium wire was directly inserted into the tungsten tube atomizer. In the preconcentration (adsorption) process of cadmium, the optimal immersing time was 60 s. The effects of large amounts of concomitants on the preconcentration of cadmium were evaluated. When 103–104 fold excess of matrix elements existed in aqueous solution at pH 4 and 9, the cadmium response was profoundly affected by the matrix elements. However, the cadmium absorption signal was not significantly influenced at pH 7. Therefore, pH 7 was selected for the application into the real environmental samples. Under the optimal conditions, the detection limit (3S/N) for cadmium by the niobium wire preconcentration method was 7.0 pg mL−1 and the relative standard deviation was 6.8%. The method with preconcentration on a niobium wire was applied to the determination of cadmium in water and proved to be sensitive, simple and convenient. Because this preconcentration method can be utilized in the in situ treatment of trace cadmium in environmental water samples, it was unnecessary to carry the water samples to the analytical work place. The technique was shown to be useful for the determination of cadmium in environmental water samples at 0.1–1 µg L−1 levels.

Preconcentration of trace elements by adsorption onto a niobium wire for electrothermal atomization atomic absorption spectrometry with a tungsten tube atomizer

In the present work, a new preconcentration method of trace elements by adsorption onto a niobium wire has been developed for electrothermal atomization atomic absorption spectrometry (ETAAS) with a tungsten tube atomizer. Detection limits (pg·mL−1) by this method combined with ETAAS were 45 for bismuth, 7.0 for cadmium, 20 for copper, 1.3 for gold, 36 for lead, 65 for manganese, 9.5 for rhodium and 19 for silver.

Effect of the β Phase on Compressive Mechanical Property of CVD Tungsten

Abstract The high pure W (HPW) was deposited on the surface of purity Cu tubes through WF 6 reduction by H 2 adopting cold-wall atmospheric pressure CVD system. Results show that the compressive strength of the tungsten tube with the mixture phase deposited at 440 °C is much lower than that with only α phase deposited at 540 °C. The existence of β phase has a significant negative influence on the compressive property. After annealing treatment at 400 °C for 1 h, the β phase in the mixture will disappear, and its compressive strength reaches the level of the as-deposited α -W.

Synthesis of WS2 nanostructuresfrom the reaction of WO3 with CS2 and mechanicalcharacterization of WS2 nanotube composites

Tungsten disulfide (WS2) nanometer sheets, spheres, fibers and tubes were generated by a synthetic pathway that avoids the useof H2S as the source of sulfur and employs insteadCS2 vapor, carriedby an Ar or N2/H2 stream in a heated tubular furnace, for the reaction withWO3 precursor powders. The experiments were conducted at temperatures between 700 and1000 °C, while the reaction times expanded between 30 min and 24 h. Characterization methods used toanalyze the products of the synthesis include TEM, SEM, XRD and EDX. We found a strongcorrelation between precursor and product microstructure, although the temperature andreaction times play a critical role in the products’ microstructural features as well.WS2 inorganic fullerene (IF) nanospheres are generated in a wide window ofconditions, while nanotubes and nanofibers are only produced at hightemperatures or long reaction times. A proposed growth mechanism based on theCS2 synthetic approach is presented. Nanoindentation and nano-impulse techniqueswere used to characterize the mechanical properties of polymer matrix–WS2 nanotube composites, finding them superior to equivalent SWCNTcomposites. The improvements in toughness of nanocomposites based onWS2 can be attributed to geometrical and morphological effects that assisted several tougheningmechanisms such as crack pinning and the formation of an immobilized polymericinterphase around the nanotubes.

Energy-dispersive diffraction stress analysis under laboratory and synchrotron conditions: a comparative study

For a feasibility study of energy-dispersive residual stress analysis under laboratory conditions, an X-ray diffractometer that has been operated so far in the angle dispersive diffraction mode was equipped with a commercial tungsten tube and an energy-dispersive solid-state germanium detector. Starting from systematic investigations to find the optimum configuration regarding geometrical resolution, measuring time and stability of the applied detector system, different materials were characterized with respect to the near-surface residual stress state. The results achieved with the modified laboratory equipment within reasonable measuring times are in good agreement with synchrotron measurements performed on the same samples. With the example of a shot-peened Al2O3ceramic with a highly non-uniform near-surface residual stress distribution it is furthermore shown that the different size and shape of the diffracting gauge volume used for the laboratory and synchrotron measurements might have a significant influence on the experimentally obtained Laplace-space residual stress depth profiles σ||(τ).

Interaction of atomic H and CO with Cu(1 1 0) and bimetallic Ni/Cu(1 1 0)

Co-adsorption of hydrogen and CO on Cu(1 1 0) and on a bimetallic Ni/Cu(1 1 0) surface was studied by thermal desorption spectroscopy. Hydrogen was exposed in atomic form as generated in a hot tungsten tube. The Ni/Cu surface alloy was prepared by physical vapor deposition of nickel. It turned out that extended exposure of atomic hydrogen leads not only to adsorption at surface and sub-surface sites, but also to a roughening of the Cu(1 1 0) surface, which results in a decrease of the desorption temperature for surface hydrogen. Exposure of a CO saturated Cu(1 1 0) surface to atomic H leads to a removal of the more strongly bonded on-top CO ( α 1 peak) only, whereas the more weakly adsorbed CO molecules in the pseudo threefold hollow sites ( α 2 peak) are hardly influenced. No reaction between CO and H could be observed. The modification of the Cu(1 1 0) surface with Ni has a strong influence on CO adsorption, leading to three new, distinct desorption peaks, but has little influence on hydrogen desorption. Co-adsorption of H and CO on the Ni/Cu(1 1 0) bimetallic surface leads to desorption of CO and H 2 in the same temperature regime, but again no reaction between the two species is observed.

Direct Damage to the Backbone of DNA Oligomers Is Influenced by the OH Moiety at Strand Ends, by the Type of Base, and by Context

Previous studies on high molecular weight DNA found that backbone damage, as monitored by free base release, is relatively independent of the type of base; i.e., the yields of all four bases were nearly equal. This could be due to a lack of influence of any given base over damage to its own deoxyribose or it could be a consequence of averaging out disparities due to each base sampling a wide range of base contexts. This study is aimed at distinguishing between these two possibilities. Transparent films, prepared from palindromic oligodeoxynucleotides of d(CTCTCGAGAG), d(CTCTCGAGAGp), d(pCTCTCGAGAGp), d(GAGAGCTCTC), d(ACGCGCGCGT), d(AACGCGCGCGTT), d(CTCTCTTAATAATTATAATTATTAAGAGAG), and d(CTCTCTTAATATTAAGAGAG), were used for this investigation. The DNA films, hydrated to approximately 2.5 waters per nucleotide, were irradiated at RT under air using X-rays generated by a tungsten tube, immediately dissolved in nuclease-free water, and stored at 277 K for 24 h, and then unaltered free base release was measured using HPLC. Yields of free base release were based on a target mass consisting of the DNA and one counterion+2.5 H2O/nucleotide. The yields of each base, G(C), G(G), G(T), and G(A) were determined for each of the above sequences. The observed yields lead to the following conclusions: (i) base release at the oligomer ends is favored over release at internal positions (called the end effect), (ii) phosphorylation of the OH moiety at the oligomer ends quenches the end effect, (iii) the magnitude of the end effect is influenced by the base at the end and the bases proximal to it, and (iv) the release of base is influenced by the base and its context.