Tumor Necrosis Factor-alpha Promoter Research Articles

The 863C>A and 1031T>C Single Nucleotide Polymorphisms (SNPs) in the Tumor Necrosis Factor Alpha (TNF-α) Promoter Gene May Not Be Putative Predictors of HBV Endemicity

Background: Genetic polymorphisms within the gene loci of the promoter region of tumor necrosis factor (TNF) alpha have been associated with the pathogenesis of hepatitis B virus (HBV) infection. In Uganda, there is a wide variation in the HBV endemicity, ranging from low endemicity, through moderate endemicity, to hyper-endemicity. However, the underlying reasons for this disparity in HBV burden are not fully elucidated. Thus, we aimed to test the hypothesis that the TNF-α-863C/A and -1031T/C polymorphic sites may have an effect on the difference between the burden of HBV in our country. We screened 384 participants, from which a sample of 134 was drawn, to determine the HBV, TNF-α-863C/A, and TNF-α-863T/C genotypes. The nucleotide BLAST was used to match the unknown targeted sequence obtained from the Sanger sequence against the known deposited sequence. This process unveiled the base substitution mutation and the HBV genotypes. The odds ratio (OR) and Chi-square test of proportions were used for the analysis. All the analyses were performed using SPSS version 26.0 and MedCalc software version 20.010 at 95% CI. A p < 0.05 was considered statistically significant. Results: The prevalence of both the TNF-α-863C/A and the TNF-α-1031T/C genotypes and their alleles did not differ significantly by endemicity (p > 0.05). However, the prevalence of the nucleotide substitution mutations for TNF-α-863C>A and TNF-α-1031T>C was significantly low for all the study groups (p < 0.05). Conclusion: The TNF-α gene promoter at the TNF-α-863C/A and 1031T/C positions is conserved in our population and may not affect the endemicity of HBV infection. However, future research should focus on the use of nationwide samples in order to reach concreate determinations regarding the role of the TNF-α polymorphisms in the risk/resolution of HBV infections in an African or Black population.

Association of tumor necrosis factor-alpha promoter region gene polymorphism at positions -308G/A, -857C/T, and -863C/A with etanercept response in Iraqi rheumatoid arthritis patients.

This study aims to evaluate the association between polymorphisms in the promoter region of the tumor necrosis factor-alpha (TNF-α) gene at locations -308G/A, -857C/T, and -863C/A with the tendency of being non-responder to etanercept. Between October 2020 and August 2021, a total of 80 patients (10 males, 70 females; mean age: 50 years; range, 30 to 72 years) with rheumatoid arthritis (RA) receiving etanercept for at least six months were included. The patients were divided into two groups responders and non-responders, based on their response after six months of continuous treatment. Following polymerase chain reaction amplification of the extracted deoxyribonucleic acid, sequencing by Sanger method was performed to identify the polymorphism at the TNF-α promoter region. In the responder group, the GG genotype of (-308G/A) and the AA genotype of (-863C/A) were both significantly present. The CC genotype of (-863C/A) was significantly present in the non-responders group. The CC of (-863C/A) SNP was the only genotype that appeared to increase the likelihood of being resistant to etanercept. The GG genotype of (-308G/A) was negatively correlated with the likelihood of being a non-responder. The (-857CC) and (-863CC) genotypes were significantly more prevalent in the non-responders group. The presence of the (-863CC) genotype, alone or in combination with (-857CC), is linked to an increased likelihood of becoming a non-responder to etanercept. The GG genotype of -308G/A and the AA genotype of -863C/A significantly increase the likelihood of becoming responder to etanercept.

Does tumor necrosis factor alpha promoter -308 A/G polymorphism has any role in the susceptibility to sepsis and sepsis risk? A meta-analysis.

Sepsis is defined as an infection that causes the immune system to attack the body, subsequently leading to death. Some findings suggest that there is a high level of correlation between tumor necrosis factor (TNF) activity and susceptibility to sepsis. We used MEDLINE, Scopus and Web of Science databases to conduct an automated search covering the years 2000-2019. The Meta-analysis of Observational Studies in Epidemiology (MOOSE) criteria and Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA) guidelines were used for the meta-analysis. The selected studies were evaluated based on their focus on the TNF-α -308 A/G polymorphism, sepsis and sepsis mortality. Based on this inclusion criterion, 24 papers out of 782 were chosen for the meta-analysis. The meta-analysis was performed using Review Manager. The comparison of TNF1 and TNF2 among the patients was calculated in the 2 groups and the odds ratio (OR) was used to construct the forest plots. The meta-analysis of the OR in Asian and Caucasian populations does not prove the influence of TNF variant on sepsis risk.

Identification of functional tumor necrosis factor-alpha promoter variants associated with Helicobacter pylori infection in the Sudanese population: Computational approach.

BACKGROUND Helicobacter pylori (H. pylori) is a ubiquitous bacterium that affects nearly half of the world’s population with a high morbidity and mortality rate. Polymorphisms within the tumor necrosis factor-alpha (TNF-A) promoter region are considered a possible genetic basis for this disease.AIMTo functionally characterize the genetic variations in the TNF-A 5’-region (-584 to +107) of Sudanese patients infected with H. pylori using in silico tools.METHODSAn observational study was carried out in major public and private hospitals in Khartoum state. A total of 122 gastric biopsies were taken from patients who had been referred for endoscopy. Genomic DNA was extracted. Genotyping of the TNF-A-1030 polymorphism was performed using PCR with confronting two-pair primer to investigate its association with the susceptibility to H. pylori infection in the Sudanese population. Furthermore, Sanger sequencing was applied to detect single nucleotide polymorphisms in the 5’-region (-584 to +107) of TNF-A in H. pylori-infected patients. Bioinformatics analyses were used to predict whether these mutations would alter transcription factor binding sites or composite regulatory elements in this region. A comparative profiling analysis was conducted in 11 species using the ECR browser and multiple-sequence local alignment and visualization search engine to investigate the possible conservation. Also, a multivariate logistic regression model was constructed to estimate odds ratios and their 95% confidence intervals for the association between TNF-A-1030, sociodemographic characteristics and H. pylori infection. Differences were statistically significant if P < 0.05. Statistical analyses were performed using Stata version 11 software.RESULTSA total of seven single nucleotide polymorphisms were observed in the TNF-A 5’-region of Sudanese patients infected with H. pylori. Only one of them (T > A, -76) was located at the in silico-predicted promoter region (-146 to +10), and it was predicted to alter transcription factor binding sites and composite regulatory elements. A novel mutation (A > T, +27) was detected in the 5’ untranslated region, and it could affect the post-transcriptional regulatory pathways. Genotyping of TNF-A-1030 showed a lack of significant association between -1030T and susceptibility to H. pylori and gastric cancer in the studied population (P = 0.1756) and (P = 0.8116), respectively. However, a significant association was detected between T/C genotype and H. pylori infection (39.34% vs 19.67%, odds ratio = 2.69, 95% confidence interval: 1.17-6.17, P = 0.020). Mammalian conservation was observed for the (-146 to +10) region in chimpanzee (99.4%), rhesus monkey (95.6%), cow (91.8%), domesticated dog (89.3%), mouse (84.3%), rat (82.4%) and opossum (78%).CONCLUSIONComputational analysis was a valuable method for understanding TNF-A gene expression patterns and guiding further in vitro and in vivo experimental validation.

Interleukin-10 and tumour necrosis factor alpha promoter region polymorphisms and susceptibility to urogenital schistosomiasis in young Zimbabwean children living in Schistosoma haematobium endemic regions.

BackgroundHost genetic factors can influence susceptibility, morbidity and mortality from schistosomiasis. The study explored the association between single nucleotide polymorphisms (SNPs) in interleukin-10 (IL-10) and tumour necrosis factor alpha (TNF-α) promoter regions and susceptibility to Schistosoma haematobium infection.MethodsUrine specimens were collected from 361 primary school children aged 5–15 years from schistosomiasis endemic areas of Manicaland and Mashonaland central provinces. Schistosoma haematobium was diagnosed using the urine filtration method. Only 272 participants provided adequate blood for genotyping. Genotyping was performed using the amplification refractory mutation system-polymerase chain reaction. The association between IL-10 and TNF-α SNPs and S. haematobium infection was analysed using the chi-square test.ResultsSchistosoma haematobium infection was confirmed in 26.8% of the participants. No significant difference in S. haematobium prevalence between men (51.6% of those infected) and women (48.4%) (χ2 = 0.008, df = 1, p = 0.928) was observed. The total IL-10 -1082 G, IL-10 -819 C and TNF-α -308G allele distribution between S. haematobium infected and uninfected participants was 50.7% and 51.5% (χ2 = 0.025, df = 1, p = 0.87), 54.3% and 60.6% (χ2 = 1.187, df = 1, p = 0.187) and 82.1% and 80.9% (χ2 = 0.099, df = 1, p = 0.753), respectively, and the differences were not significant.ConclusionInterleukin-10 -1082 G/A, IL-10 -819 C/T and TNF-α -308 G/A SNPs were not significantly associated with susceptibility to S. haematobium infection. The prevalence of schistosomiasis is still in the moderate range and is similar in boys and girls.

Association Analysis of Tumor Necrosis Factor Alpha Promoter Polymorphisms and Vitiligo Susceptibility in South Indian Tamils

Tumor necrosis factor alpha (TNF-α) has been associated with the pathogenesis of several autoimmune diseases. Also, various studies in different ethnics showed an association between TNF-α gene polymorphisms and susceptibility to vitiligo. The paucity of genetic data led us to undertake this study to evaluate the association of five TNF-α SNPs (rs1799964, rs1800630, rs1799724, rs1800629, and rs361525) with the development of vitiligo in South Indian Tamils. A total of 264 vitiligo patients and 264 healthy controls were recruited and TNF-α genotyping was performed using amplification-refractory mutation system polymerase chain reaction and TaqMan allele discrimination assay. Circulatory TNF-α levels were measured by enzyme-linked immunosorbent assay. We observed that a single polymorphic allele A in the promoter region -308 (rs1800629) conferred significant risk to develop vitiligo (p = 0.0002, OR = 1.70, 95% CI = 1.28–2.25), whereas the other polymorphisms failed to contribute to disease risk (p > 0.05). From the constructed haplotypes, TCCAG was found to be a significant risk factor for vitiligo (p < 0.05). Also, a strong linkage disequilibrium was observed between the following SNPs: (1) rs1799964 and rs1800629 (2) rs1800630 and rs1799724 (D’ = 0.90). Analysis of the influence of genotype on phenotypes revealed that the A allele of rs361525 was a risk factor for vitiligo in females (p = 0.04, OR = 0.45, 95% CI = 0.21–0.95), whilst the rs1800629 allele conferred protection against early disease onset (p < 0.05). A statistically significant difference in plasma TNF-α levels was found between cases and controls (p < 0.05). The TNF-α -308A allele and TCCAG haplotype were identified as genetic risk factors for vitiligo susceptibility in South Indian Tamils.

A case-control study of tumor necrosis factor-alpha promoter polymorphism and its serum levels in patients with chronic obstructive pulmonary disease in Kashmir, North India.

Aim:Data about polymorphism in tumor necrosis factor-alpha (TNF-α) and its serum levels in chronic obstructive pulmonary disease (COPD) are conflicting. We aimed to evaluate the association of TNF-α-308 G > A polymorphism in patients with COPD in Kashmir (North India), a high burden area and also determined the serum TNF-α levels in these patients.Materials and Methods:One hundred spirometrically confirmed COPD patients and 163 controls resident from Kashmir valley (North India) were recruited. Genotyping of the promoter region of TNF-α was carried out using polymerase chain reaction-restriction fragment length polymorphism. The serum TNF-α was quantified using the Cytometric Bead Array flex system by flow cytometry. Results were subjected to appropriate statistical treatment and P < 0.05 was considered statistically significant.Results:Ninety-one COPD patients (91%) had G/G (wild homozygous) genotype and nine patients (9%) had G/A (heterozygous) genotype. Among the control population, 150 (92%) had G/G genotype and 13 (8%) had G/A genotype. The variant allele “A” was not detected in either of the two groups. Serum levels of TNF-α were significantly higher in patients compared to control group (8.0 ± 10.1 pg/ml vs. 3.3 ± 0.42 pg/ml, respectively, P = 0.0001).Conclusion:While serum levels of TNF-α are higher in COPD patients compared to the controls, there was no difference in the prevalence of TNF-α-308 polymorphism in the ethnic Kashmiri population with COPD.

Universal Primers for Amplification of TNF-α -308 Promoter Region.

Genetic variation in the form of a single nucleotide polymorphisms (SNPs) in the tumor necrosis factor alpha (TNF-α) promoter region is known to influence the regulation of TNF-α production, transcription and translation and has been linked to several diseases. Primer sequences that amplify DNA flanking the -308 sequence are not universal, therefore, research on SNP conducted in this area still uses different primer pairs. The purpose of this research was to design and optimize universal primers to amplify DNA sequences covering the TNF-α -308 promoter area for other researchers to study the presence of SNPs in the -308 nucleotide and beyond. The peripheral blood samples for DNA preparation were obtained from 3 participants. The DNAs were extracted using available commercial kit. The candidate of universal primers were designed using BLAST and Primer3 softwares. Amplification of DNA region flanked by the designed primer pairs was performed using PCR method using available commercial kit. The study showed that there were significant differences between the 5 primary pairs studied. From the 5 pairs of primers, the TNF-α 1 primer pair (TNF-α 1F: AACCAGCATTATGAGTCTC and TNF-α 1R: AACAACTGCCTTTATATGTC) and the TNF-α 2 primer pair (TNF-α 2F: TGAAACCAGCATTATGAGT and TNF-α 2R: AACAACTGCCTTTATATGTC) produced single, distinct, sharp and thick bands. From this study it can be concluded that TNF-α 1 and TNF-α 2 primer pairs have the potential to be used as universal primers to study the SNPs in the TNF-α -308 promoter region.

Role of Tumor Necrosis Factor alpha promoter polymorphisms in interferon related side effects in chronic hepatitis B patients under interferon alpha 2b treatment

Objective(s). Interferon alpha therapy is associated with series of adverse effects leading premature discontinuation of treatment. Here we aimed to determine the effects of Tumor necrosis alpha promoter polymorphisms on interferon related side effects during interferon alpha 2b treatment in chronic hepatitis B patients&#x0D; Material and Method(s). This observational study enrolled 50 chronic hepatitis B patients, who were treated with interferon alpha 2b 10 tiw plus lamivudine 100mg/day at Selçuk University Meram Medical Faculty Department of Infectious Diseases and Clinical Bacteriology between 2006-2007. Patients were followed-up with complete blood count, transaminases and amylase monthly at out patient clinics of our department. All patients were asked to fill a questionnaire to evaluate the interferon related side effects at every visit. Tumor necrosis factor alpha -238 and -308 polymorphisms were investigated with PCR-Restriction fragment length polymorphisms.&#x0D; Result(s) and Conclusion Arthralgia was present in 93.8% of patients. Exhaustion, loss of appetite, mount dryness and fever are the leading complaints of the patients. Median complaint scores were 9, 9.5, 11 and 5 at 4th, 12th, 24th and 48th week visits, respectively. Thrombocytopenia and leucopenia were detected in 8 (16%) and 5 (10%) patients, respectively. One-third of the patients reported depressive mood however, depression was diagnosed in 5 (10%) patients. TNF alpha promoter 238GG and 308GG allele was present in 42/50 and 43/50 patients, respectively. No association was found between TNF promoter allele and certain patient-reported side effect, complaint score, hematological and psychological adverse effects. TNF alpha promoter polymorphisms do not contribute to occurrence of IFN alpha treatment related side effects.

Association of tumor necrosis factor alpha -238G/A and -308G/A promotor polymorphisms with clearance of Hepatitis B virus infection in Turkish population

Aim: Acute viral hepatitis B may lead to chronic hepatitis in 6% of adult population. We compared the frequency of Tumor necrosis factor alpha promotor polymorphisms in chronic hepatitis B patients and people with natural immunity against hepatitis B.&#x0D; Material and Methodology: Chronic hepatitis B patients and age matched control cases with natural immunity to hepatitis B virus were recruited 1:1 in this study. Tumor necrosis factor alpha -238G/A and -308G/A polymorphisms were studied with PCR-RFLP. χ2 test was performed in statistical analysis.&#x0D; Results: A total of 101 volunteers enrolled in two study groups. Thirty-eight men and 12 women constituted the chronic hepatitis B patient group and 40 men and 11 women recruited in natural immunity group. Frequency of -238G allele was 87.5% and 97% in chronic hepatitis B and natural immunity groups, respectively. Frequency of -308G allel was 93% and 92.1% in chronic hepatitis B and natural immunity groups, respectively. Frequencies of polymorphisms at positions -238 and -308 in the promotor of tumor necrosis factor alpha gene were not different between chronic hepatitis B and natural immunity groups.&#x0D; Conclusion: Tumor necrosis factor alpha promoter polymorphisms at -238 and -308 positions do not effect the outcome hepatitis B infection in Turkish population. Clearance of hepatitis B virus infection is multifactorial. Thus, further studies needed to identify genetic predisposition to chronic hepatitis B infection.

Dihydrotestosterone activates AP-1 in LNCaP prostate cancer cells.

A cross-talk between androgen/androgen receptor signaling and the AP-1 transcription factor has been proposed. In this study, we asked whether activation of AP-1 modifies androgen-responsive gene transcription, and whether androgens effect AP-1-regulated gene transcription. We show that activation of AP-1 via expression of a constitutively active mutant of mitogen-activated/extracellular signal responsive kinase kinase (MEK) kinase-1 did not increase the activity of the androgen-responsive probasin promoter. Likewise, expression of a constitutively active mutant of the transcription factor c-Jun, which is a major constitutent of AP-1, did not increase the activity of the probasin promoter. In contrast, 5α-dihydrotestosterone (DHT) activated both the probasin promoter and the AP-1-regulated collagenase promoter in LNCaP prostate cancer cells. The AP-1 binding site within the collagenase promoter was identified as DHT-responsive element. In line with this, DHT increased the activities of the c-Jun promoter and the tumor necrosis factor alpha promoter, which both contain AP-1 binding sites. The signal transduction pathway coupling DHT stimulation with AP-1 activation required c-Jun, MAP kinases and androgen receptors, but was independent of transient receptor potential melastatin-8 (TRPM8) channels, proposed to function as ionotropic testosterone receptors. Expression of the GTPase activating protein RGS2 attenuated DHT-induced activation of AP-1, indicating that the DHT-induced signaling cascade involves G proteins.

Tumor necrosis factor-alpha promoter polymorphism 308 G/A is not significantly associated with esophageal cancer risk: a meta-analysis.

Many studies have investigated the association between Tumor necrosis factor-α-308 G>A (rs1800629) and the risk of esophageal cancer. However, their results are inconsistent. Therefore, we performed a meta-analysis of available data to investigate any possible association between this polymorphism and esophageal cancer risk. We searched PubMed, EMBASE, Web of Science, and the CNKI database for articles published up to 2016. Crude and adjusted odds ratio with 95% confidence intervals were calculated using fixed or random effects models. We used a dominant model (GA+AA vs GG), a recessive model (AA vs GG+GA), an over-dominant model (GG+AA vs GA), and allele frequency (G vs A) to identify any association. Eleven studies with 5617 participants were included in the meta-analysis. Our results suggest that TNF-α-308 G>A (rs1800629) is not significantly associated with a risk of esophageal squamous cell carcinoma and esophageal adenocarcinoma. For genetic association studies, negative results of meta-analysis have a high level of evidence, and these results are important in this era of high-throughput sequencing-based precision medicine.

Tumour necrosis factor alpha promoter polymorphism, TNF-238 is associated with severe clinical outcome of falciparum malaria in Ibadan southwest Nigeria

Tumour necrosis factor (TNF) – α has been shown to play an important role in the pathogenesis of falciparum malaria. Two TNF promoter polymorphisms, TNF-308 and TNF-238 have been associated with differential activity and production of TNF. In order to investigate the association between TNF-308 and TNF-238 and the clinical outcome of malaria in a Nigerian population, the two TNF polymorphisms were analysed using Sequenom iPLEX Platform. A total of 782 children; 283 children with uncomplicated malaria, 255 children with severe malaria and 244 children with asymptomatic infection (controls) were studied. The distribution of TNF-308 and TNF-238 genotypes were consistent with the Hardy-Weinberg equilibrium. Distribution of both TNF polymorphisms differed significantly across all clinical groups (TNF-308: p=0.007; TNF-238: p=0.001). Further tests for association with severe malaria using genotype models controlling for age, parasitaemia and HbAS showed a significant association of the TNF-238 polymorphism with susceptibility to severe malaria (95% CI=1.43–6.02, OR=2.94, p=0.003237) The GG genotype of TNF-238 significantly increased the risk of developing cerebral malaria from asymptomatic malaria and uncomplicated malaria (95% CI=1.99–18.17, OR=6.02, p<0.001 and 95% CI=1.78–8.23, OR=3.84, p<0.001 respectively). No significant association was found between TNF-308 and malaria outcome. These results show thegenetic association of TNF-238 in the clinical outcome of malaria in Ibadan, southwest Nigeria. These findings add support to the role of TNF in the outcome of malaria infection. Further large scale studies across multiple malaria endemic populations will be required to determine the specific roles of TNF-308 and TNF-238 in the outcome of falciparum malaria infection.

Association of the tumor necrosis factor-alpha promoter polymorphism with change in triacylglycerol response to sequential meals.

BackgroundReported associations between Tumor Necrosis Factor-alpha (TNFA) and the postprandial triacylglycerol (TAG) response have been inconsistent, which could be due to variations in the TNFA gene, meal fat composition or participant’s body weight. Hence, we investigated the association of TNFA polymorphism (−308G → A) with body mass index (BMI) and postprandial lipaemia and also determined the impact of BMI on the association of the polymorphism with postprandial lipaemia.MethodsThe study participants (n = 230) underwent a sequential meal postprandial study. Blood samples were taken at regular intervals after a test breakfast (t = 0, 49 g fat) and lunch (t =330 min, 29 g fat) to measure fasting and postprandial lipids, glucose and insulin. The Metabolic Challenge Study (MECHE) comprising 67 Irish participants who underwent a 54 g fat oral lipid tolerance test was used as a replication cohort. The impact of genotype on postprandial responses was determined using general linear model with adjustment for potential confounders.ResultsThe -308G → A polymorphism showed a significant association with BMI (P = 0.03) and fasting glucose (P = 0.006), where the polymorphism explained 13 % of the variation in the fasting glucose. A 30 % higher incremental area under the curve (IAUC) was observed for the postprandial TAG response in the GG homozygotes than A-allele carriers (P = 0.004) and the genotype explained 19 % of the variation in the IAUC. There was a non-significant trend in the impact of BMI on the association of the genotype with TAG IAUC (P = 0.09). These results were not statistically significant in the MECHE cohort, which could be due to the differences in the sample size, meal composition, baseline lipid profile, allelic diversity and postprandial characterisation of participants across the two cohorts.ConclusionsOur findings suggest that TNFA -308G → A polymorphism may be an important candidate for BMI, fasting glucose and postprandial TAG response. Further studies are required to investigate the mechanistic effects of the polymorphism on glucose and TAG metabolism, and determine whether BMI is an important variable which should be considered in the design of future studies.Trial registration NCT01172951.

Tumor necrosis factor alpha promoter polymorphism studies in pregnant women

AimsThe aim of this study was to explore the possible association between the −850C/T polymorphism in the tumor necrosis factor alpha (TNF-α) gene promoter, and pregnancy-associated diseases such as gestational diabetes mellitus (GDM) and preeclampsia (PE), in south Indian women. GDM and PE are common complications that occur during pregnancy and are the leading causes of perinatal mortality. To date, the mechanisms that initiate GDM and PE in humans have remained elusive. MethodsThis prospective case-control study was carried out with 505 pregnant women: 140 women had GDM, and 105 with PE. Remaining 260 women were age- and frequency-matched controls. TNF-α (–C850T) genotyping was determined by polymerase chain reaction with restriction fragment length polymorphism (PCR-RFLP) analysis. ResultWe found no statistically significant difference in the genotypic and allelic distribution between GDM women and controls (for CT + TT vs. CC, χ2 = 0.3919; p = 0.61; Odds Ratio (OR) = 0.76 (95% CI: 0.203–1.876)). No significant differences was observed in the allele and genotype frequency between PE women and controls (for CT + TT vs. CC, p = 0.31; OR = 0.55 (95% CI: 0.171–1.784); T vs. C, p = 0.71; OR = 0.94 (95% CI: 0.680–1.3)). ConclusionFrom our results, we conclude that the (–C850T) promoter polymorphism has no role in the propensity of pregnant women from south Indian populations to develop GDM or PE.

Tumour necrosis factor-alpha promoter polymorphism and its association with viral dilated cardiomyopathy in Indian population: a pilot study.

Tumour necrosis factor-α (TNF-α), a pro-inflammatory cytokine has been implicated in the pathophysiology of several viral infections. TNF-α promoter gene polymorphism is thus believed to play the modulating role in this disease pathogenesis. Several studies have shown the increased level of TNF-α in dilated cardiomyopathy (DCM). However, the role of the TNF-α promoter polymorphism is yet to be delineated in this regard. The present study for the first time tried to explore the association of TNF-α gene polymorphism with DCM of viral aetiology. Eighteen histopathologically proven DCM cases with viral genome positivity and 17 healthy controls were genotyped using polymerase chain reaction of TNF-α promoter gene followed by restriction fragment length polymorphism to determine the SNPs of -238G/A, -308G/A, -857C/T and -863C/A. Of the 18 DCM cases 4 (22.2%) were positive for adenovirus (AdV), 2 (11.1%) for enterovirus (EV) and 12 (66.7%) had co-infection. Six of the 18 DCM cases (35.3%) had -238G/A polymorphism, and 10 (55.5%) had -863 homozygous AA genotype. The association of these polymorphisms was statistically significant as compared to controls (P < 0.05). The present pilot study suggests the possible association of TNFα -238G/A and -863C/A polymorphism with DCM of viral aetiology.

The −308 G/A polymorphism in the tumor necrosis factor-α gene is not associated with development and progression of rheumatoid arthritis in Argentinean patients

A polymorphism in the tumor necrosis factor-alpha (TNF-α) promoter region has been associated with disease susceptibility and progression in rheumatoid arthritis (RA). The presence of an adenosine (TNF2 allele) instead of a guanine (TNF1 allele) at position -308 may be responsible for a general increase in the transcriptional activity of the TNF-α gene. Our aim was to evaluate the association of the TNF2 allele with the risk of disease development and/or progression of RA in an Argentine population cohort. Two hundred and twenty-three consecutive patients with RA according to the 1987 criteria of the American College of Rheumatology were included in the study. Clinical variables, Disease Activity Score 28, Health Assessment Questionnaire and Rheumatoid Arthritis Quality of Life were recorded. The radiographic erosions were determined by the method of Sharp/van der Heijde. A group of 111 healthy subjects matched by sex and age was used as a control. All samples were genotyped for the -308 G/A TNF-α polymorphism. No significant differences were observed either in the frequency of the TNF2 allele or in the genotypic distributions of the -308 G/A TNF-α polymorphism (P>0.05) between the control group and the RA patients. No association was found between the TNF2 allele and the variables related to the course and outcome of the disease (P>0.05). In this cohort of Argentinean patients with RA, the TNF2 allele was neither associated with susceptibility to the disease nor was it associated with the variables related to the course and outcome of the disease.

Tumor Necrosis Factor-A Polymorphisms and Colorectal Cancer Risk: A Meta-Analysis

Background and ObjectivesTumor necrosis factor-alpha (TNF-a) was related to inflammation and involved in the development of colorectal cancer. Polymorphisms located in TNF-a promoter region, such as 308G/A and 238G/A, could affect the risk of various types of cancer by regulating TNF-a production. In this study, a meta-analysis was performed to investigate the association between common polymorphisms of TNF-a promoter region and colorectal cancer susceptibility.MethodsSearching of several databases was performed for all publications on the association between TNF-a polymorphisms and colorectal cancer. Summary odds ratios (ORs) with their 95% confidence intervals (95% CIs) were calculated using random-effects models. Stratified analyses based on ethnicity and control population source were also conducted.ResultsOverall, TNF-a 308A polymorphism showed a significant association with increased risk of colorectal cancer in worldwide populations under homozygote comparison [AA vs. GG, OR (95% CI) = 1.46 (1.07–1.97)] other than heterozygote comparison [AG vs. GG, OR (95% CI) = 1.05 (0.93–1.19)]. TNF-a 238A was not associated with colorectal cancer risk under homozygote or heterozygote comparisons. In stratified analysis, significant association was observed only in Western populations [AA vs. GG, OR (95% CI) = 1.39 (1.01–1.91)] other than in Eastern populations under homozygote comparison. No significant difference was observed between population-based subgroup and hospital-based subgroup.Conclusions TNF-a 308A was moderately associated with an increased risk of colorectal cancer in Western populations, and TNF-a 238A polymorphism was not significantly associated with colorectal cancer risk.

Association of Tumor Necrosis Factor Alpha Promoter Polymorphism (TNF-α 238 G/A and TNF-α 308 G/A) with Diabetic Mellitus, Diabetic Retinopathy and Diabetic Nephropathy: A Meta-analysis

Aim: To examine the association between tumor necrosis factor alpha (TNF-α) polymorphism and risk for diabetic mellitus (DM), diabetic retinopathy (DR) and diabetic nephropathy (DN).Methods: Systematic searches of electronic databases such as PubMed, Medline, Web of knowledge and CNKI, as well as hand searching of the references of identified articles were performed. A total of 8979 subjects in 14 studies from 12 eligible publications were included in this meta-analysis (6 of 12 eligible studies were analyzed for TNF 238 G/A polymorphism and Type 1 DM (T1DM), 5 of 12 were analyzed for TNF 308 G/A polymorphism and DR in Type 2 DM (T2DM), and 3 of 12 were analyzed for TNF 308 G/A polymorphism and DN in T2DM). Pooled odds ratio (OR) with 95% confidence interval (CI) was calculated using fixed or random effects model. The I2 statistics were used to evaluate between-study heterogeneity. Sensitivity analysis was also performed.Results: The results showed no evidence for significant association between TNF 238 G/A polymorphism and T1DM (for AA + GA versus GG: OR = 0.95, 95% CI = 0.48–1.88, p = 0.89), and also no association between TNF 308 G/A polymorphism and DR and DN risk in T2DM (for AA + GA versus GG: OR = 1.04, 95% CI = 0.87–1.25, p = 0.68; OR = 0.88, 95% CI = 0.71–1.08, p = 0.21; respectively). In addition, the similar results were obtained in the subgroup analysis based on the ethnicity.Conclusions: In summary, results from this meta-analysis suggest that the TNF 238 G/A polymorphism was not associated with T1DM. No association between TNF 308 G/A polymorphism and DR and DN in T2DM was detected.

Anger induced by interferon-alpha is moderated by ratio of arachidonic acid to omega-3 fatty acids

ObjectiveAnger worsens in some patients during interferon-alpha (IFN-α) therapy. Elevated anger has also been associated with lower long-chain omega-3 (LCn−3) fatty acid levels. We examined whether fatty acids could influence vulnerability to anger during IFN-α exposure. MethodsPlasma arachidonic acid (AA), eicosapentaenoic acid (EPA), and docosahexaenoic acid (DHA) levels were determined prior to IFN-α therapy by mass spectroscopy. Repeated-measure analyses examined the relationship between AA/EPA+DHA and the subsequent development of labile anger and irritability in 82 subjects who prospectively completed the Anger, Irritability, and Assault Questionnaire (AIAQ) during the first eight weeks of IFN-α therapy. ResultsPrior to IFN-α therapy, AA/EPA+DHA did not correlate with either labile anger or irritability. Pre-treatment AA/EPA+DHA did correlate with the subsequent maximal increase in labile anger during IFN-α therapy (r=0.33; p=0.005). Over time, labile anger increased more in subjects with above median AA/EPA+DHA ratios (p<0.05). Of the 17 subjects ultimately requiring psychiatric intervention for anger, 14/17 had above-median AA/EPA+DHA ratios (p=0.009). There was also an interaction with the tumor necrosis factor-alpha (TNF-α) promoter polymorphism (A-308G), such that only those with both elevated AA/EPA+DHA and the A allele had increased labile anger (p=0.001). In an additional 18 subjects, we conversely observed that selective serotonin reuptake inhibitor treatment was associated with increased irritability during IFN-α therapy. ConclusionLCn−3 fatty acid status may influence anger development during exposure to elevated inflammatory cytokines, and may interact with genetic risk for increased brain TNF-α. LCn−3 supplements may be one strategy for minimizing this adverse side effect of IFN-α.