Tomato Isolates Research Articles

Molecular Characterization and Pathogenicity of Groundnut Bud Necrosis Virus (Orthotospovirus arachinecrosis) Inducing Necrosis in Black Gram

Orthotospovirus arachinecrosis commonly known as Groundnut bud necrosis virus (GBNV), is the causal agent for necrosis disease in black gram. GBNV is the second most important challenge to black gram production in major growing areas following yellow mosaic disease. Symptoms of necrosis disease of black gram include severe downward curling and twisting of leaf lamina, veinal necrosis, petiole necrosis, bud necrosis, and necrotic streaks on the stem. Infection at early growth stages of black gram leads to plant death, while surviving plants exhibited stunted growth with a significant reduction in pod yield. The GBNV-BG isolate was maintained in pure form on cowpea cv. C-152, resulted in chlorotic and necrotic local lesions on primary leaves at seven days post-inoculation. The pathogenicity of GBNV on black gram (LBG-645) was further confirmed by artificial sap inoculation. Amplification of the coat protein gene of GBNV was confirmed through RT-PCR using gene-specific primers, producing an amplicon of 800 bp. Sequence analysis of the coat protein gene revealed that the present study isolates OQ683310 and OR295403 shared sequence identity of 98.0 % and 99.3 % respectively at the nucleotide level, with other isolates in the NCBI database. The phylogenetic analysis of the coat protein gene revealed that the isolates under this study were closely linked with the GBNV tomato isolate from Tamil Nadu (MN718651 and MZ505083).

Development of Attenuated Viruses for Effective Protection against Pepper Veinal Mottle Virus in Tomato Crops.

Tomato (Solanum lycopersicum) is the most important vegetable and fruit crop in the family Solanaceae worldwide. Numerous pests and pathogens, especially viruses, severely affect tomato production, causing immeasurable market losses. In Taiwan, the cultivation of tomato crops is mainly threatened by insect-borne viruses, among which pepper veinal mottle virus (PVMV) is one of the most prevalent. PVMV is a member of the genus Potyvirus of the family Potyviridae and is non-persistently transmitted by aphids. Its infection significantly reduces tomato fruit yield and quality. So far, no PVMV-resistant tomato lines are available. In this study, we performed nitrite-induced mutagenesis of the PVMV tomato isolate Tn to generate attenuated PVMV mutants. PVMV Tn causes necrotic lesions in Chenopodium quinoa leaves and severe mosaic and wilting in Nicotiana benthamiana plants. After nitrite treatment, three attenuated PVMV mutants, m4-8, m10-1, and m10-11, were selected while inducing milder responses to C. quinoa and N. benthamiana with lower accumulation in tomato plants. In greenhouse tests, the three mutants showed different degrees of cross-protection against wild-type PVMV Tn. m4-8 showed the highest protective efficacy against PVMV Tn in N. benthamiana and tomato plants, 100% and 97.9%, respectively. A whole-genome sequence comparison of PVMV Tn and m4-8 revealed that 20 nucleotide substitutions occurred in the m4-8 genome, resulting in 18 amino acid changes. Our results suggest that m4-8 has excellent potential to protect tomato crops from PVMV. The application of m4-8 in protecting other Solanaceae crops, such as peppers, will be studied in the future.

Updates on hosts and distribution of pepper yellow leaf curl Indonesia virus and squash leaf curl China virus in Central Java Province, Indonesia

Chili pepper, tomato, and squash cultivated in Magelang Regency, Central Java Province, Indonesia showed severe viral symptoms. Three samples were taken then molecularly tested against begomovirus, potyvirus, tobamovirus, and polerovirus. However, PCR test confirmed only begomovirus infections. BLAST analysis concluded that the chili pepper and tomato isolates were pepper yellow leaf curl Indonesia virus (PepYLCIV) while the squash isolate was squash leaf curl China virus (SLCCNV). The 552 bp partial AV1 gene sequences of the three isolates were given NCBI GenBank acc nos. OR924278-80. PepYLCIV OR924279 and OR924280 formed a subgroup with LC542629 from Bali in the phylogenetic tree constructed using MEGA11, and shared 95.8 – 96.7% identities at nucleotide (nt) and 98.4 – 99.5% at amino acid (aa) levels according to Sequence Demarcation Tool v1.2 software. Meanwhile, SLCCNV OR924278 was clustered, and shared 95.8 – 96.7% nt and 98.4 – 99.5% aa identities with three Malaysian isolates (MW248685, MW248687, and MW248689). Different plant species inoculated with SLCCNV OR924278 remained symptomless up to four weeks observation, suggesting that the isolate is not mechanically transmissible. This study contributed additional knowledge on molecular variation while expanding hosts and distribution of PepYLCIV and SLCCNV in Central Java Province.

First Report of Fruit Rot Caused by Fusarium luffae in Cherry Tomato in China.

Tomato (Solanum lycopersicum L.) is a fruit of great economic value that is grown worldwide. In November 2022, fruit rot symptoms were observed in cherry tomatoes (cv. Qianxi) in Jinan City of Shandong Province, China. Six cherry tomato samples (four symptomatic and two asymptomatic) were collected from commercial fields (approximately 1.2 ha) where the incidence of the disease ranged from 5 to 10%. The core and surface of the infected fruit were colonized and covered with white mycelia. Tissue pieces (5 mm × 5 mm) from the junction of healthy and diseased samples were surface-disinfected with 75% ethanol for 3 min, followed by 10% sodium hypochlorite for 5 min, and washed three times with sterile water. Tissue pieces were cultured on potato dextrose agar (PDA containing 200 mg/L timentin) at 28°C for five days. Four fungal isolates with similar morphological characteristics were obtained from each sample. Two representative isolates were collected and purified using the single-spore method. After five days on PDA at 28°C, FL1 and FL2 colonies showed abundant white to cream colored aerial mycelia with an average growth rate of 5 mm/day. On carnation leaf agar, FL1 was characterized by falcate macroconidia with pronounced dorsiventral curvature containing three to eight tapered apical cells and foot-shaped basal cells ranging in size from 25 to 74 μm × 3.6 to 6.8 μm (n=50). Microconidia and chlamydospores were not observed. These morphological characteristics were consistent with the description of F. luffae (Wang et al. 2019). DNA was extracted using the CTAB method. The nucleotide sequences of the translation elongation factor 1-α gene (TEF1) and the second largest RNA polymerase II subunit (RPB2) were amplified using specific primers EF1/EF2 and RPB2F/R, respectively (O'Donnell et al. 1998, 2010). FL1 and FL2 sequences were deposited in GenBank (TEF1: OQ427345 and OQ427346, RPB2: OQ427347 and OQ427348). Polyphasic identification indicated 100% similarity of FL1 and FL2 to F. luffae. A combined dataset of TEF1 and RPB2 was aligned using MAFFT v.7, and phylogenetic analysis was performed in MEGA v.7.0 using the maximum likelihood method. The cherry tomato isolates (FL1 and FL2) clustered together with the F. luffae reference strain NRRL31167 (100% bootstrap) and were identified on a morphological and molecular basis as F. luffae belonging to the Fusarium incarnatum-equiseti species complex. F. luffae was the only pathogen recovered from the infected fruit. To test for pathogenicity, healthy cherry tomato fruit were inoculated in a greenhouse (28°C, 12/12 h light/dark cycle, 90% relative humidity), six by wounded inoculation and six by nonwounded inoculation) with 10 μL conidial suspensions of isolate FL1 at 1 × 106 conidia/mL. Six wounded-treated cherry tomato fruit were used for the control. All cherry tomatoes were kept in a growth chamber at 28℃ with 90% relative humidity. After seven days, the inside of the wound inoculated fruit began to rot, expanding toward the surface and producing white mycelia. Two diseased cherry tomatoes were randomly selected for tissue isolation and F. luffae was re-isolated showing the same morphology as the FL1 isolate, thus fulfilling Koch's postulates. The nonwounded inoculated fruits and control cherry tomatoes remained asymptomatic with no pathogens recovered. This indicates that the wound is an important way for F. luffae to invade tomato, and fruit rot is caused by F. luffae's infection of tomato. To the best of our knowledge, F. luffae has caused fruit rot in muskmelon (Zhang et al. 2022), but this is the first report of fruit rot disease in cherry tomatoes caused by F. luffae in China. Since cherry tomatoes are an important commercial crop in China, F. luffae infection has the potential to pose a threat to the industry.

First report of Phytophthora infestans lineage EU23 causing potato and tomato late blight in South Africa.

In South Africa, potato (Solanum tuberosum) late blight epidemics from 1996 to 2007 were caused by Phytophthora infestans clonal lineage US-1 (McLeod et al. 2001; Pule et al. 2013). Similarly, surveys on tomatoes in the mid-1990s only identified the US-1 clonal lineage in South Africa (McLeod et al., 2001). On potatoes, populations from the Southern Cape and Western Cape regions consisted of persistent mefenoxam-resistant populations (McLeod et al. 2001; Pule et al. 2013). Limited mefenoxam (R-enantiomer of metalaxyl) screening in 2021 in the Western Cape showed that potato isolates were sensitive, which prompted our study. Potato late blight samples were collected in 13 potato fields in the 2021 to 2023 seasons in the Western Cape (n = 4), Free State (n = 7), Limpopo (n = 1) and Kwazulu-Natal (n = 1) Provinces, and one tomato sample in 2022 in the Limpopo Province. Fourteen samples, one per field, were simple sequence repeat (SSR) genotyped for 12 loci (Li et al. 2013) using as DNA template, FTA cards, or genomic DNA extracted from cultures. P. infestans isolations from lesions and DNA culture extractions were conducted as previously described (Pule et al. 2013). SSR genotyping revealed that all 14 P. infestans samples belonged to clonal lineage EU_23_A1 (EU23), which has a phenotype (A1 and metalaxyl sensitive) and SSR genotype matching the US-23 lineage (Saville et al., 2021). As expected, minor polymorphisms were detected among the samples at loci Pi02, G11, D13 and SSR4. Mefenoxam sensitivity testing of seven potato isolates from the Free State (n = 3) and Western Cape (n = 4), and one tomato isolate was conducted as previously described (Mcleod et al. 2001). All isolates were sensitive to mefenoxam since no infection and sporulation occurred at 3 µg/ml. This was expected since EU23 has been reported as mefenoxam sensitive in other countries (Kawchuk et al., 2011; McGrath et al., 2015). Replacement of the US-1 clonal lineage by EU23 suggests that the latter lineage is more aggressive or fit than US-1, but this must be verified especially on potatoes. On tomatoes, on the other hand, EU23 is known as a highly aggressive lineage (Kawchuk et al., 2011; McGrath et al., 2015; Saville et al., 2021). Therefore, population displacements may have first occurred on tomatoes from where the lineage spread to potatoes. In the Cape coastal potato production regions, population displacement may have been supported by the withdrawal of mefenoxam/metalaxyl from the region since 1996 because the EU23 lineage is mefenoxam sensitive, as opposed to the previously prevailing US-1 mefenoxam-resistant lineage. More severe potato late blight epidemics has not been observed in recent years in South Africa. However, tomato late blight has increased and is more prevalent in the Limpopo province. The source of the introduction of EU23 into South Africa is unknown. Only test-tube plants and/or greenhouse tubers may be imported into South Africa since 1997. Therefore, the illegal importation of planting material may have introduced the new genotype. Whether this could have occurred from neighbouring African countries is unknown since P. infestans genotyping has not been conducted in these countries. In Africa, EU23 has been reported in northern African countries (Tunisia, Algeria and Egypt) (Saville et al., 2021; El-Ganainy et al., 2023). Mefenoxam and metalaxyl applications will likely be effective again in the Western Cape, but more samples will have to be tested to confirm this. This will provide growers with a more cost-effective fungicide (metalaxyl) since alternative actives with comparable systemic and curative activity are more expensive.

Genetic Diversity of Botrytis Cinerea Which Caused Gray Mold Disease in Strawberry and Some Other Vegetable Plants

The study aimed to isolate and identification the fungus Botrytis cinerea that caused gray mold disease, depending on its morphological and molecular characterizations. The results of isolation on PDA showed that 75 pure isolates were obtained from The pathogenic fungus B. cinerea is distributed as follows: Strawberry (45) isolates, eggplant (11) isolates, squash (3) isolates, cucumber (3) isolates, pepper (9) isolates, and tomato (4) isolates. DNA was extracted from 17 isolates of pathogenic fungus B. cinerea, the results of electrophoresis on 2% agarose gel, which included 17 isolates distributed in crops (strawberry 11 isolates, eggplant 4 isolates, squash and tomato one isolate each) was detected at 550 base pair(bp) of all the isolates using ITS1 and ITS4 primers. The results of detection and investigation of genetic variation of pathogenic Fungi isolates were clarified by determining the degree of kinship and drawing a phylogenetic tree An evolutionary and relationship tree was drawn using Snap Gene Viewer, When performing Allayment analysis of the isolates, the results showed that the isolates bearing the symbols (S3,S2,S1) isolated from strawberry fruits were identical to the SMGM003 strain registered in South Korea with a percentage of 100%, and isolates (S6,S5,S4) isolated from strawberry fruits are identical to the strain WMG recorded in South Korea, and isolates (S10,S9,S8) isolated from strawberry fruits are identical to the strain CIM13704 registered in China, and isolates (S11) isolated from strawberry fruits.

Possible Reasons Affecting Different Phytophthora infestans Populations in Tomato and Potato Isolates in Thailand

Late blight, caused by the oomycete Phytophthora infestans, is one of the most important diseases affecting tomato and potato production worldwide. In Thailand, the disease is widespread in the north and northeast, especially in the Chiang-Mai and Tak provinces. The mating type, metalaxyl sensitivity, mitochondrial DNA (mtDNA) haplotype, RG57 fingerprinting, and microsatellite were used to characterize the P. infestans populations. The study revealed that the P. infestans of tomato isolates in Thailand are of the same lineage as those from 1994 until 2002. The clonal lineages that were found in the potato populations have changed since 1994. The changes in P. infestans isolates in the potato populations have likely been the result of the import of seed potatoes to Thailand. Furthermore, the P. infestans populations in potatoes show resistance to metalaxyl, whereas those from tomato isolates show sensitivity to fungicides. The reasons for the different responses can be attributed to (i) the use of metalaxyl, (ii) the host preferences of P. infestans, and (iii) the migration of new genotypes from infected potato seeds.

Analysis of the Tomato Aspermy Virus Complete Genomes Suggests Reassortment in Russian Isolates from Chrysanthemum

Tomato aspermy virus (TAV, genus Cucumovirus from the family Bromoviridae) is one of the most common and harmful chrysanthemum viruses, causing severe flower distortion, size reduction and color breaking. Metatranscriptome sequencing of chrysanthemum plants of the Ribonette and Golden Standard cultivars from the collection of the Nikita Botanical Garden (Yalta, Republic of Crimea) generated TAV-related reads. The complete genomes of two Russian isolates of the virus were assembled from the reads obtained. This is the first report of full-length TAV genomes from Russia. Typically of cucumoviruses, the segmented TAV genome is represented by three single-stranded positive-sense linear RNA molecules with a length of 3412 (RNA1), 3097 (RNA2) and 2219 (RNA3) nucleotides. Five open reading frames (ORF) have been identified that encode replicase (ORF1), RNA-dependent RNA polymerase (ORF2a), silencing suppressor protein (OFR2b), movement protein (OFR3a) and the virus coat protein (ORF3b). The identity of the TAV genomes from the two chrysanthemum cultivars was 99.8% for all three viral RNAs, and with other TAV isolates from Genbank – 97.5–99.7 (RNA1), 93.8–99.8 (RNA2), and 89.3–99.3% (RNA3). Phylogenetic analysis showed that RNA1 and RNA3 of the Russian isolates were assigned to heterogeneous groups of TAV isolates found on various plant species in different regions of the world. At the same time, RNA2 clearly clustered with tomato isolates SKO20ST2 from Slovenia and PV-0220 from Bulgaria and, to a lesser extent, with the Iranian isolate Ker.Mah.P from petunia and the Chinese isolate Henan from chrysanthemum. The incongruence of phylogenetic trees reconstructed from different segments of the viral genome suggests pseudo-recombination (reassortment) in the Russian TAV isolates.

First report of Sw-5 resistance-breaking strain of tomato spotted wilt orthotospovirus infecting tomato in Texas.

Tomato spotted wilt orthotospovirus (TSWV) is one of the most devastating plant viruses causing crop disease epidemics of global economic significance. A single dominant resistant gene 'Sw-5' offering a broad-spectrum resistance to multiple orthotospoviruses was introduced in tomato cultivars. However, multiple resistance-breaking strains of TSWV were reported worldwide (Ciuffo 2005; Zaccardelli et al. 2008; Batuman et al. 2017; di Rienzo et al. 2018). Symptoms suggestive of orthotospoviral infection including stunting, bronzing, and inward rolling of leaves, and concentric necrotic spots on leaves, petioles, and fruits were observed in two TSWV-resistant tomato cultivars ('BL163' and 'HT 2') planted in a tomato variety trial in Bushland, TX in 2022. Leaf tissues from 45 resistant tomato plants (symptomatic or asymptomatic) from both resistant cultivars were tested using a TaqMan probe-based qPCR assay targeting a 200bp region in nucleoprotein (N) of the TSWV (Gautam et al. 2022). While 25 of those samples tested positive for TSWV, only ten expressed characteristic disease symptoms described above. The possibility of mixed infection in those samples with other endemic viruses in the region viz., alfalfa mosaic virus, groundnut ringspot orthotospovirus, tobacco mosaic virus, tomato chlorotic spot orthotospovirus, tomato mosaic virus, tomato necrotic streak virus, tomato ringspot virus, and tomato torrado virus was discounted through RT-PCR analysis (Kumar et al. 2011; Verbeek et al. 2012; Bratsch et al. 2018). To test the RB phenotype of the observed putative TSWV-RB strains, three-week-old tomato plants from eight commercially available TSWV resistant cultivars and one non-resistant cultivar (n=10 each) were mechanically inoculated with leaf tissues collected from a single symptomatic plant from one of the field-grown resistant cultivars. The experiment was replicated twice. Hypersensitive response was observed on all inoculated leaves of resistant plants one week post inoculation. Furthermore, all eight resistant cultivars started expressing local and systemic TSW symptoms 12 to 16 days post inoculation (dpi), while non-resistant cultivar started expressing symptoms at 9 dpi. TSW incidence across all resistant cultivars was 30-70%, while in susceptible cultivar it was 90%. Symptoms exhibited by all resistant cultivars resembled those of symptoms observed in field collected plants. The expression of Sw-5 gene in all eight resistant cultivars and the lack thereof in a susceptible cultivar was confirmed using Sw-5b specific primers and using Actin as a housekeeping gene in qRT-PCR (Islam et al. 2022). The RB strains in Sw-5 resistant tomato in California (Batuman et al. 2017) had the C118Y mutation in the TSWV NSm protein, consistent with the original reporting of C118Y or T120N RB mutations in 11 TSWV isolates from Spain (NCBI accession # HM015517 & HM015518) (Lopez et al. 2011). The nucleotide and amino acid sequence analysis of NSm gene from Bushland RB isolates from four resistant cultivars (NCBI accessions # OP810513-14 [field], OQ247901-05 [mechanically inoculated]) shared 98.9 and 99.4% homology with the Californian NSm sequences of TSWV RB tomato isolate (KX898453 and ASO67371), respectively. While the Nsm C118Y or T120N RB mutations were absent in all Bushland TSWV RB isolates, they had six additional unique point mutations across the NSm (I163V, P227Q, V290I, N293S, V294I, K296Q), which could potentially be responsible for resistance breaking. Despite the lack of C118Y or T120N RB mutations, Bushland isolates were capable of disrupting Sw-5-mediated TSWV resistance in all eight commercial resistant tomato cultivars. This study suggests a new or a different class of fundamental mechanisms are likely to be responsible for resistance breaking in Sw-5b resistant tomatoes. The new RB strain/s of TSWV therefore pose a substantial threat to tomato production in TX and other tomato-growing regions of the US.

Genetic recombination among tomato yellow leaf curl virus isolates in commercial tomato crops in Kuwait drives emergence of virus diversity: a comparative genomic analysis

ObjectiveWhitefly-transmitted tomato yellow leaf curl virus (TYLCV) continues to be a major constraint to tomato production in Kuwait. However, very limited information is available about the population structure and genetic diversity of TYLCV infecting tomato in Kuwait.ResultsWhole genome sequences of 31 isolates of TYLCV, collected from commercial tomato crops grown in northern (Abdally) and southern (Al Wafra) parts of Kuwait, were deciphered. Eighteen isolates of TYLCV are identified as potential genetic recombinants. The isolates Abdally 6A and Abdally 3B reported in this study were identified to be potential recombinants. Compared to the 15 isolates from the Abdally area, and the three previously reported KISR isolates of Kuwait, six out of sixteen Al Wafra isolates showed an insertion of 19 extra nucleotides near the 5′-end. There are also four nucleotide variations before the 19-extra-nucleotides. The additional 19 nucleotides observed in nine isolates indicate that these isolates might have resulted from a single gene recombination/insertion event. Molecular phylogeny based on complete genome sequences of TYLCV isolates suggests transboundary movement of virus isolates due to geographic proximity. The information presented herein is quite useful for the comprehension of TYLCV biology, epidemiology and would aid in the management of disease in the long run.

First report of Tomato yellow mottle-associated virus infecting pepper (Capsicum annuum L.) in China.

Tomato yellow mottle-associated virus (TYMaV), is a member of the genus Cytorhabdovirus in the family Rhabdoviridae, which has been reported to infect tomato (Lycopersicon esculentum) (Xu et al. 2017), Solanum nigrum (Li et al., 2022) and Nicotiana benthamiana (Zhou et al. 2019). In July 2021, virus-like symptoms of chlorosis, mosaic, and ring spots were observed in pepper, tomato, and eggplant during a survey of viral symptoms in Huzhou City, Zhejiang Province, China. To identify viral agents potentially associated with these diseases, an Oxford Nanopore cDNA library from the mixed samples was generated and sequenced. Briefly, total RNA from 10 leaf tissue samples (3 pepper plants, 4 tomato plants, and 3 eggplant plants) was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and pooled in equal amounts (100 ng/l each). The library was constructed using a PCR-cDNA sequencing kit (SQK-PCS109; Oxford Nanopore Technologies, Oxford, UK) in accordance with the manufacturer's instructions. Approximately 8.6 million reads were obtained from the Oxford MinION platform. After removing adapters and low-quality reads using iVar v1.3.1 (Grubaugh et al., 2019), the clean reads were subjected to BLASTn search in the GenBank database. We identified sequences derived from potato virus X (PVX), potato virus Y (PVY), cucumber mosaic virus (CMV), pepper mottle virus (PepMoV), and TYMaV. Of these reads, 339 with lengths ranging from 375 to 8651 nt were mapped to the genome of TYMaV (GeneBank Accession No. KY075646.1) at a 98.2% query coverage. To identify TYMaV-infected plants in the pooled samples, all 10 samples were analyzed by two-step RT-PCR using AMV reverse transcriptase (Takara, Tokyo, Japan) combined with random primers N6 (Takara, Dalian, China) and high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan) with primer pairs: N-F 5'- CAGGGAGAGAATGTACAAGTTGATC'/N-R 5'- GACCTTGCTCATCTGATGCAAC -3', amplifying 420 bp of the 3'end of nucleoprotein (N) gene. A pepper sample showing chlorosis symptom was positive for the TYMaV infection, but negative for PVX, PVY, CMV or PepMoV infection when tested using the primers listed in table S1. To confirm the genome sequence of TYMaV Zhejiang isolate (TYMaV-ZJ), we carried out two-step RT-PCR with seven primer pairs (Table S1) designed based on the reference TYMaV genome (GeneBank accession number KY075646.1). PCR products were cloned into pLB vector (Tiangen, Beijing, China) and Sanger sequenced in both directions. At least five independent clones of each fragment were sequenced to avoid possible mutations introduced by PCT. The sequences were assembled into a nearlyfull-length genome of TYMaV -ZJ which was composed of 13344nt (GeneBank accession number OP296980). Pairwise sequence comparison revealed that TYMaV -ZJ genome shared 91.50% and 85.59% nt sequence identity with that of the TYMaV tomato isolate (KY075646.1) and the Solanum nigrum isolate (MW527091.1), which is higher than the species demarcation threshold of 75% for the genus Cytorhabdovirus (Walker et al., 2022). To the best of our knowledge, this is the first report of TYMaV infecting pepper.

İzmir ilinde domates ve biber bitkilerini etkileyen tomato spotted wilt virus (TSWV) ve cucumber mosaic virus (CMV) etmenlerinin moleküler karakterizasyonu

Objective: The objective of this study was to investigate tomato spotted wilt virus (TSWV) and cucumber mosaic virus (CMV) infections in tomato and pepper plants showing virus-induced symptoms in vegetable growing districts of İzmir, Turkey. Material and Methods: Surveys were carried out in tomato and pepper plantations in 2019 and 2021, and the incidences of these viruses in the collected leaf samples were determined by RT-PCR. Nucleotide identities and phylogenetic relationships of the TSWV and CMV isolates with other isolates retrieved from the GenBank database were determined. Results: The results of this study showed that tomato plants were infected at the same rate (21.50%) with TSWV and CMV. Out of the tested pepper samples, 64.15% were infected with TSWV and 25.47% with CMV. The results showed that, the identity rate of nucleoprotein region of TSWV isolates from tomato was 99-96% at nucleotide level while the isolates from pepper showed 100-95% identity. On the other hand, the capsid protein gene region of the tomato isolate of CMV had nucleotide identity rate of 98-95% with other isolates in GenBank, while that of its pepper isolates had 100-98% identity. Also, CMV isolates of this study showed close phylogenetic relationship with the CMV isolates of subgroup IB. Conclusion: This study revealed the prevalence of TSWV and CMV in symptomatic tomato and pepper samples in İzmir province and some molecular properties of them.

First report of potato virus S and potato virus Y in tomatoes from Croatia.

Potato virus Y (PVY, genus Potyvirus) is an economically important aphid-transmissible virus with a very wide host range reported in many tomato-growing areas (Rivarez et al. 2021). Potato virus S (PVS, genus Carlavirus) has a limited host range (Lin et al. 2014) and occurs in tomato (Predajňa et al. 2017), mostly in mixed infections with other viruses. In 2021, greenhouse tomatoes from Vidovec (46° 17' 3.4'' N, 16° 15' 37.0'' E) in the northwestern and Sedlarica (45° 54' 23.0'' N, 17° 12' 0.5'' E) in the eastern regions of Croatia were surveyed for virus-like diseases. In total, 30 plants were sampled (12 from Vidovec and 18 from Sedlarica) showing symptoms of mild mottling, leaf rugosity and mild bronzing followed by leaf necroses later in the season. Nucleic acids were extracted from leaves by adapted CTAB procedure (Murray and Thompson 1980) and DNase treated. Four representative samples from Vidovec and four from Sedlarica were pooled for high throughput sequencing (HTS). After rRNA depletion (RiboMinus™ Plant Kit for RNA-Seq, Invitrogen) and polyA tailing, two location specific libraries (PCR-cDNA sequencing kit, Oxford Nanopore Technologies) were prepared for nanopore HTS on MinION Mk1C device. From Vidovec samples, 459,285 raw reads (mean length 354 nt) were obtained and 206,718 (mean length 446 nt) from Sedlarica and mapped (Minimap2, v.2.17) against Kraken2 viral genome sequences database (https://benlangmead.github.io/aws-indexes/k2). The number of reads mapped to PVS genome was 1004 from Vidovec (coverage depth 1.56) and those mapped to PVY genome were 781 (coverage depth 0.99) and 57 (coverage depth 1), from Vidovec and Sedlarica, respectively. The PVS complete consensus genome from Vidovec (ON468562, 8485 nt) had 99.09% nucleotide identity (BLASTn) to a potato isolate from the Netherlands (MF418030). The PVY consensus genome sequences from Vidovec (ON505007, 9698 nt) and Sedlarica (ON505008, 9698 nt) had respectively 98.37% and 98.48% identities to a tomato isolate from Slovakia (MW685827). Reverse transcription polymerase chain reaction (RT-PCR) was performed for all 30 samples and amplicons were Sanger sequenced, with primers PVS-7773F/PVS-3'endR for a 720 nt PVS genome portion spanning the 3'-part of the CP and a complete 11K gene (Lin et al. 2014) and PVY-2F/2R primers for a 510 nt portion of PVY CP gene (Aramburu et al. 2006). Only one tomato out of 12 ('Borana') from Vidovec harbored PVS in the mixed infection with PVY. Two additional tomatoes from Vidovec and two from Sedlarica were infected solely by PVY. Amplicon sequences of PVS (ON651427) and PVY (ON707000-4, ON734067-8) had 100% identity with the HTS assembled sequences. The PVS isolate from Croatia grouped with PVSO (ordinary) strain in phylogenetic analysis and the PVY isolates from both sites grouped with the PVY-NTN strain (Cox and Jones 2010). Although PVY is considered to be widespread in tomato (Nikolić et al. 2018; Rivarez et al. 2021), this is its first report from Croatia. PVS, newly reported from Croatia here, is probably not associated with the symptoms recorded because the same symptomatology was observed in the singly and mixed infected 'Borana' tomato plants. The occurrence of PVY in the geographically distant (100 km apart) Vidovec and Sedlarica, suggests that it is widespread in the continental Croatia where tomatoes are commercially grown in plastic greenhouses. Further analyses are needed to elucidate PVY and PVS epidemiology and impact on the local tomato production.

Analysis of the Complete Tomato Aspermy Virus Genomes Suggests Reassortment in Russian Isolates from Chrysanthemum

Tomato aspermy virus (TAV, genus Cucumovirus from the family Bromoviridae) is one of the most common and harmful chrysanthemum viruses, causing severe flower distortion, size reduction, and color breaking. Metatranscriptome sequencing of chrysanthemum plants of the Ribonette and Golden Standard cultivars from the collection of the Nikita Botanical Garden (Yalta, Republic of Crimea) generated TAV-related RNA reads. The complete genomes of two Russian isolates of the virus were assembled from the reads. This is the first report of full-length TAV genomes from Russia. Typically of cucumoviruses, the segmented TAV genome is represented by three single-stranded positive-sense linear RNA molecules of 3412 (RNA1), 3097 (RNA2) and 2219 (RNA3) nucleotides. Five open reading frames (ORF) have been identified that encode replicase (ORF1), RNA-dependent RNA polymerase (ORF2a), silencing suppressor protein (OFR2b), movement protein (OFR3a) and the coat protein (ORF3b). The identity of TAV genomes from the two chrysanthemum cultivars was 99.8% for all three viral RNAs; with other TAV isolates from GenBank it was 97.5-99.7% (RNA1), 93.8-99.8% (RNA2), and 89.3-99.3% (RNA3). Phylogenetic analysis showed that RNA1 and RNA3 of the Russian isolates were assigned to heterogeneous groups of TAV isolates found on various plant species in different regions of the world. At the same time, RNA2 clearly clustered with tomato isolates SKO20ST2 from Slovenia and PV-0220 from Bulgaria and, to a lesser extent, with the Iranian isolate Ker.Mah.P from petunia and the Chinese isolate Henan from chrysanthemum. The incongruence of phylogenetic trees reconstructed from different genome segments suggests pseudo-recombination (reassortment) in the Russian TAV isolates.

Morphological and molecular characterization of Podosphaera xanthii, causal agent of powdery mildew in husk tomato and watermelon

Objective: To determine the causal agent of powdery mildew in husk tomato and watermelon, as well as its morphological and molecular characterization. Design/methodology/approach: Leaves with powdery mildew symptoms were collected from husk tomato (Physalis ixocarpa) and watermelon (Citrullus lanatus) in Iguala, Guerrero, Mexico in 2018. From two isolates (Phyxa1 and Phyxa2) of husk tomato and two of watermelon (Citrus1 and Citrus2), the morphological characterization was carried out by assembling morphological structures and visualizing them under an optical microscope. For molecular characterization, the ITS region was amplified with the use of primers ITS1 and ITS4, PCR was performed and the products obtained were sequenced in the company Macrogen®. A phylogenetic analysis was performed with the resulting sequences and they were compared with other sequences available in GenBank. Results: It was determined that there is morphological and genetic variability between isolates from husk tomato and watermelon. The largest sizes of conidiophores and conidia were from Phyxa1 and Phyxa2 isolates, the smallest sizes were found in Citrus1 and Citrus2. The isolates presented a tendency to group according to the host, the Phyxa1 and Phyxa2 isolates were associated with Solanacea isolates, while the Citrus1 and Citrus2 isolates were grouped with isolates of the Cucurbitaceae family. Findings/conclusions: Podosphaera xanthii was shown to be the agent associated with powdery mildew in husk tomato and watermelon. The morphological and genetic variability of P. xanthii was determined, which was associated with the host of origin.

First Report of Tomato Leaf Curl Bangladesh Virus Associated with Leaf Yellowing Symptoms in Lablab purpureus in Bangladesh

First Report of Tomato Leaf Curl Bangladesh Virus Associated with Leaf Yellowing Symptoms in <i>Lablab purpureus</i> in Bangladesh

First Report of Capsicum chlorosis virus Infecting Chromolaena odorata in Yunnan, China.

Capsicum chlorosis virus (CaCV) is a negative sense ssRNA virus belonging to the genus Orthotospovirus in the family Tospoviridae. It was first discovered in Australia, and then reported in other places including Thailand, China, India, Greece, and United States (Zheng et al.2011; Melzer et al.2014; Chrysoula et al. 2018; Abudurexiti et al. 2019). CaCV infects plants of the families Amaranthaceae, Apocynaceae, Chenopodiaceae, Cucurbitaceae, Amaryllidaceae, Fabaceae and Solanaceae (Basavaraj et al. 2017; Basavaraj et al. 2020). Chromolaena odorata L. (commonly known as Feiji cao in China) is an invasive weedy herb that belongs to the genus Eupatorium (family Asteraceae), and is native to Central America. In May 2020, serrated chlorotic ring and chlorotic ringspots resembling symptoms of orthotospovirus infection (Supplementary Figure 1) was observed on the leaves of C. odorata plants in Honghe County, Yunnan. Three symptomatic leaf samples were collected and double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) was performed using antisera targeting Tomato spotted wilt virus (TSWV), Calla lily chlorotic spot virus (CCSV), Capsicum chlorosis virus (CaCV), and Tomato zonate spot virus (TZSV) (Proteintech Group, Inc., China). Buffer solution and healthy leaves were used as a blank and negative controls, respectively. All three symptomatic samples showed positive reactions with only CaCV antiserum (OD450 of 0.315-0.345 relative to 0.078 and 0.076 for healthy plants and the blank control, respectively. The total RNA extracted from the positive samples were further analyzed by reverse transcription-polymerase chain reaction (RT-PCR) using generic primers gL3637 (CCTTTAACAGTDGAAACAT) and gL4435c (CATDGCRCAAGARTGRTARACAGA) which were designed to amplify partial L segment encoding the RNA-dependent RNA polymerase (RdRP) of orthotospoviruses (Chu, et al. 2001). The expected ~800 bp DNA fragment was amplified from all three positive samples by RT-PCR. The amplified DNA was cloned and sequenced. BLAST search of the partial L RNA sequence (GenBank acc. nos. MW964378 to MW964380) revealed that they shared 86.2-97.4% nucleotide (nt) and 97.2-100% amino acid (aa) sequence identities with different isolates of CaCV available in GenBank with CaCV chili isolates (KU941834 to KU941836) from India sharing the highest aa identity of 100%. This confirmed the presence of CaCV in the symptomatic C. odorata plants. The 825 bp complete nucleocapsid protein (NP) of CaCV was also amplified from the samples using primers CaCV-F: ATGTCTAMCGTYAGGCAAC and CaCV-R: TYACACYTCWATAGAWGTACTAG) (Basavaraj et al. 2020), cloned, and sequenced to obtain complete S fragment-nucleocapsid protein (NP) with a size of 825 bp (MW964381 to MW964383). The pairwise comparisons of three fragments showed 85.1-98.3% nt and 87.6-99.6% aa sequence identities with different isolates of CaCV. Maximum-Likelihood phylogenetic trees inferred from the partial RdRP and complete NP aa sequences showed that the C. odorata isolates (CaCV-YN) clustered closely with CaCV tomato isolate from Taiwan and tomato (Yuxi-2013) isolate from China, respectively (Supplementary Figure 1). To our knowledge, this is the first time CaCV has been detected in C. odorata. This study will serve as an important reference for the study of host range of CaCV. Further studies will be required to determine whether thrips could transmit CaCV between C. odorata and other hosts of the virus.

First Report of Tomato Brown Rugose Fruit Virus on Greenhouse Tomato in Syria.

Tomato (Solanum lycopersicum L.) is an important vegetable crop worldwide. In spring and autumn 2017, virus-like symptoms were observed on greenhouse grown tomato plants in the east of Akkar plain (south of coastal region, Tartous governorate, Syria). These symptoms were: mild to severe mosaic on the apical leaves, brown necrosis on sepals, receptacle and flower's cluster carrier, and severe symptoms of brown rugose and discoloration on fruit. During next growing seasons, disease spread was observed in most of Syrian coastal region with disease incidence ranged from 40% to 70% by 2020. Tomato brown rugose fruit virus (ToBRFV) was suspected as a main causal agent of the disease, especially since its first report in Jordan, a neighboring country (Salem et al. 2016), Palestine (Alkowni et al. 2019), Turkey (Fidan et al. 2019), Germany (Menzel et al. 2019), Italy (Panno et al. 2019), America (Camacho-Beltrán et al. 2019), Egypt (Amer and Mahmoud, 2020), and recently in Spain (Alfaro-Fernandez et al. 2021). In November and December 2020, seventy-one leaf samples from symptomatic plants (59 from Tartous and 12 from Lattakia governorates) and seven from asymptomatic ones (5 from Tartous and 2 from Lattakia) were collected and tested for the presence of ToBRFV by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA), using ToBRFV-commercial kit (LOEWE® Biochemia, Germany) following the manufacturer's instructions. Results showed, forty-three of symptomatic samples reacted positively (38 in Tartous and 5 in Lattakia) and none of asymptomatic ones. On the other hand, sap mechanical inoculation of 10 tomato cv. Mandaloun F1 (Enza Zaden, the Netherlands) plants using a positive tomato isolate gave systemic mosaic symptoms in all plants identical to those observed in the original plants in the field, after 13 days of inoculation, and necrotic local lesions on 10 plants of Nicotiana tabacum after 5 days, indicating the presence of a tobamovirus in general. ToBRFV infection was confirmed in all mechanically-inoculated plants by DAS-ELISA. Further tests were necessary to investigate ToBRFV presence, because of its serological relationships with another tobamoviruses. Six representative symptomatic samples (ELISA-positive) and two asymptomatic (ELISA-negative) samples were subjected to total RNA extraction using the SV-Total RNA Extraction kit (Promega, U.S.A.) following the manufacturer's instructions. The samples were tested by two-step reverse transcription-polymerase chain reaction (RT-PCR) using species-specific primers and protocols for most common tomato-infecting viruses, including: tomato chlorosis virus and tomato infectious chlorosis virus (Dovas et al. 2002), pepino mosaic virus (PepMV) and tomato torrado virus (Wieczorek et al. 2013), alfalfa mosaic virus (Parrella et al. 2000), tomato spotted wilt virus (Salem et al. 2012) and a pair of primers: ToBRFV-F2 (5'-CATATCTCTCGACACCAGTAAAAGGACCCG-3') and ToBRFV-R2 (5'-TCCGAGTATAGGAAGACTCTGGTTGGTC-3') targeting a region of the RNA dependent RNA polymerase (RdRp), of the ToBRFV genome (KT383474; Salem et al. 2016). First-strand cDNA synthesis was carried out using Moloney murine leukemia virus reverse transcriptase (M-MLV RT; Promega) and random primer according to the manufacturer's protocol, then followed by PCR with the seven species-specific primers. Only ToBRFV was detected among all tested viruses in symptomatic samples (ELISA-positive), and none of the tested viruses was detected in the asymptomatic plants. To confirm the presence of ToBRFV, two selected RdRp-specific PCR amplicons (872 bp) were purified and ligated into pGEM T-Easy Vector (Promega), and three clones were sequenced (GenBank accession nos. MZ447794 to 96). BLASTn analysis showed that the nucleotide sequences are 99.77-100% identical and shared around 99% identity to RdRp of ToBRFV isolate (MT118666) from Turkey available in the GenBank. Accordingly, the presence of ToBRFV was confirmed by bioassays on indicator plants, DAS-ELISA, RT-PCR, and further sequencing. To our knowledge, this is the first report of ToBRFV infecting tomato in Syria, and this requires special emphasis for further investigations because of the virus severity, easy transmission ability and absent of commercial resistance varieties till now.

Complete Genome Resources for Ralstonia Bacterial Wilt Strains UW763 (Phylotype I); Rs5 and UW700 (Phylotype II); and UW386, RUN2474, and RUN2279 (Phylotype III).

We share whole genome sequences of six strains from the Ralstonia solanacearum species complex, a diverse group of Betaproteobacteria that cause plant vascular wilt diseases. Using single-molecule real-time technology, we sequenced and assembled full genomes of Rs5 and UW700, two phylotype IA-sequevar 7 (IIA-7) strains from the southeastern United States that are closely related to the R. solanacearum species type strain, K60, but were isolated >50 years later. Four sequenced strains from Africa include a soil isolate from Nigeria (UW386, III-23), a tomato isolate from Senegal (UW763, I-14), and two potato isolates from the Madagascar highlands (RUN2474, III-19 and RUN2279, III-60). This resource will support studies of the genetic diversity, ecology, virulence, and microevolution of this globally distributed group of high-impact plant pathogens.[Formula: see text] Copyright © 2021 The Author(s). This is an open access article distributed under the CC BY-NC-ND 4.0 International license.

Species diversity, novel interactions and absence of well-supported host-guided phylogenetic groupings of Neotropical Alternaria isolates causing foliar lesions in Solanaceae.

To report the characterization of 120 Alternaria isolates inducing early blight-like foliar lesions in nine species of five Solanaceae genera collected across all macrogeographical Brazilian regions. Phylogenetic relationships were assessed via analyses of the Alternaria alternata allergenic protein-coding, glyceraldehyde-3-phosphate dehydrogenase and the calmodulin gene sequences. Most of the tomato isolates were placed into the Alternaria linariae cluster, whereas most of the potato isolates were grouped with Alternaria grandis. Novel host-pathogen interactions were also reported. Seventeen isolates were selected for morphometrical characterization, and a subsample of 13 isolates was employed in pathogenicity assays on tomato, potato, eggplant, scarlet eggplant, Capsicum annuum, Datura stramonium, Physalis angulata and Nicotiana tabacum. Eleven isolates were able to induce foliar lesions in tomatoes but none in C. annuum. Potato was susceptible to a subgroup of isolates but displayed a subset of isolate-specific interactions. Morphological traits were in overall agreement with molecular and host range data. Alternaria linariae and A. grandis were confirmed as the major causal agents of tomato and potato early blight, respectively. However other Alternaria species are also involved with early blight in solanaceous hosts in Brazil. The diversity and host-specific patterns of the Alternaria isolates from Solanaceae may have practical implications in establishing effective early blight genetic resistance and cultural management strategies especially for tomato and potato crops.