Tomato Isolates Research Articles

Population Genetic Analysis of Tomato spotted wilt virus on Peanut in North Carolina and Virginia

Exploring the genetic diversity and evolutionary history of plant viruses is critical to understanding their ecology and epidemiology. In this study, maximum-likelihood and population genetics-based methods were used to investigate the population structure, genetic diversity, and sources of genetic variation in field isolates of Tomato spotted wilt virus (TSWV) from peanut in North Carolina and Virginia. Selected regions of the nucleocapsid, movement, and RNA-dependent RNA polymerase genes were amplified and sequenced to identify haplotypes and infer genetic relationships between isolates of TSWV with heuristic methods. The haplotype structure of each locus consisted of 1 or 2 predominant haplotypes and >100 haplotypes represented by a single isolate. No specific haplotypes were associated with geographic area, peanut cultivar, or year of isolation. The population was panmictic at the regional level and high levels of genetic diversity were observed among isolates. There was evidence for positive selection on single amino acids in each gene on a background of predominant purifying selection acting upon each locus. The results of compatibility analyses and the persistence of specific gene sequences in isolates collected over three field seasons suggest that recombination was occurring in the population. Estimates of the population mutation rate suggest that mutation has had a significant effect on the shaping of this population and, together with purifying selection, these forces have been the predominant evolutionary forces influencing the TSWV population in peanut in North Carolina and Virginia.

Molecular Variation Among Isolates of Verticillium dahliae and Polymerase Chain Reaction-Based Differentiation of Races

Verticillium dahliae is a soilborne fungal pathogen that causes vascular wilt in a variety of economically important crops worldwide. There are two races of V. dahliae that infect tomato and lettuce. Although race-1-specific resistance has been identified in both tomato and lettuce, no resistant sources are available for race 2. Molecular analyses were employed to characterize the genetic variability and race structure of 101 isolates of V. dahliae from a variety of hosts, mainly from central and coastal California, and 10 isolates exotic to this area. Analyses of the 16 simple sequence repeat (SSR) markers illustrated that tomato subpopulations from central California were distinct relative to the marigold subpopulations. In contrast, cotton and olive isolates showed admixture with tomato isolates. Analyses of both the ribosomal DNA intergenic spacer regions and SSR markers revealed high genetic variability among isolates but were unable to delineate races of V. dahliae. However, a polymerase chain reaction (PCR) assay was applied to amplify a race-1-specific amplicon from the isolates in many hosts from different geographic areas, and was coupled with virulence assays for validation of the data. Results of the PCR assay showed 100% concordance with the virulence assay to differentiate race 1 from race 2 of 48 isolates from tomato. The results indicate that the PCR assay can be applied to differentiate the two races to support our related aim of breeding host resistance, and further reveal insights into the distribution of races in tomato and lettuce cropping systems in California.

Evolutionary analysis of tomato Sw-5 resistance-breaking isolates of Tomato spotted wilt virus

Tomato spotted wilt virus (TSWV) causes severe economic losses in many crops worldwide and often overcomes resistant cultivars used for disease control. Comparison of nucleotide and amino acid sequences suggested that tomato resistance conferred by the gene Sw-5 can be overcome by the amino acid substitution C to Y at position 118 (C118Y) or T120N in the TSWV movement protein, NSm. Phylogenetic analysis revealed that substitution C118Y has occurred independently three times in the studied isolates by convergent evolution, whereas the substitution T120N was a unique event. Analysis of rates of non-synonymous and synonymous changes at individual codons showed that substitution C118Y was positively selected.

Natural Occurrence of Phytophthora infestans Causing Late Blight on Woody Nightshade (Solanum dulcamara) in New York.

Woody nightshade (Solanum dulcamara) is a common hedgerow herbaceous perennial in the United States, one of only three native Solanum spp. S. dulcamara is a known host of Phytophthora infestans (3), but infection is rarely reported. There is a U.S. record from Maryland (2); in 1947, Peterson (4) stated that this species had never been found blighted in its natural habitat, although in 1960 it was listed as a host of P. infestans in New York (1). The A2 mating type has not been reported on this host. On 2 July, 2009, leaf lesions similar to those of P. infestans on potato were found on wild S. dulcamara at Riverhead, NY. The plant was growing in a home garden within 10 m of potato and tomato plants infected with P. infestans. When two infected leaves of S. dulcamara were incubated for 24 h under high humidity, a pathogen growth developed around the lesion margins that was characterized by hyaline mycelium bearing lemon-shaped sporangia that released motile zoospores after chilling in water, which is consistent with P. infestans. The caducous and limoniform to ovoid sporangia were 39 to 50 μm (average 45 μm) × 26 to 28 μm (average 27 μm) with a length/breadth ratio of 1.66. No oospores were observed. Three isolates were obtained from this plant during July 2009. Growth on rye agar was indistinguishable from that of local tomato isolates of P. infestans. Detached leaflets of S. dulcamara and S. tuberosum, inoculated with the woody nightshade isolates and kept in a humid chamber, became infected and developed profuse sporulation within 5 days. The pathogen isolated was confirmed as P. infestans by morphological, biochemical, and molecular characteristics. Inoculations of attached leaves of potted S. dulcamara plants resulted in necrotic lesions with many sporangia; sporulation also developed on inoculated, attached, and detached tomato leaves. P. infestans was reisolated and identity confirmed as before. The three isolates were A2 mating type, metalaxyl-resistant, mitochondrial haplotype Ia. All were glucose-6-phosphate isomerase 100/122 and peptidase 100/100, as confirmed with single-spore isolates. RG57 fingerprint analysis confirmed that isolates from woody nightshade, tomato, and potato obtained from the same and nearby sites were identical. Although P. infestans in the United States belongs to the new population, which may infect a wider host range than the old US-1 clonal lineage, S. dulcamara infections have only been found when late blight is already widespread in neighboring fields and there is no evidence to suggest that woody nightshade acts as an overwintering host in the United States.

First Report of Tomato chlorotic dwarf viroid in Tomato in France.

Tomato chlorotic dwarf viroid (TCDVd) is a pospiviroid found naturally infecting tomato (Solanum lycopersicum L.) (3) and several ornamentals such as Brugmansia, petunia (1), and trailing verbena (4). Initially identified in North America (3), it has been reported from India, Europe (the Netherlands and United Kingdom), and Japan. At the end of 2007, 20 to 25% of tomato plants within a group of greenhouses in the Brittany Region of France were observed with top bunching, leaf curling, and epinasty symptoms. Reverse transcription (RT)-PCR with a primer pair specific for several pospiviroids (5'GGGGAAACCTGGAGCGA3' and 5'GGGGATCCCTGAAGCGC3') amplified the correctly sized fragment (approximately 360 bp) from total nucleic acid extracts from three symptomatic plants. The sequence of the uncloned amplification product (GenBank Accession No. EU729744) was determined, together with that of five cloned cDNAs. All sequences were highly related with a total of three mutations in these six sequences and they showed 96.9% (GQ169709 and AY372399) to 99.4% (AF162131) identity with TCDVd sequences present in GenBank. Identification of TCDVd was confirmed from the same plant samples by molecular hybridization with a Potato spindle tuber viroid (PSTVd)-specific probe (which cross-hybridizes with TCDVd to a certain extent) and by PCR with the PSTVd/TCDVd-specific 2A-1S primer pair (3) and sequencing of the amplified fragment. The French isolate is most closely related to the original tomato isolate from Canada (GenBank Accession No. AF162131). In a grow-out test involving 2,500 seeds from the original seed lot from which the symptomatic plants were derived, 2 of the 250 pools of 10 plants tested positive for TCDVd infection with the 3H1-2H1 primer pair (2). The sequence of the amplified product proved identical to the isolate detected in the original greenhouse plants, indicating a low level of seed transmission. As with other pospiviroids, which appear to be more and more frequently reported in greenhouse tomatoes, possible sources of infection include contaminated seeds, as seem to be the case in this first outbreak, and also transfer to tomatoes from infected ornamental hosts. This is, to the best of our knowledge, the first report of TCDVd in tomato in France.

An In Planta Method for Assessing the Role of Basidiospores in Rhizoctonia Foliar Disease of Tomato.

A tomato (Solanum lycopersicum) foliar blight disease of unknown etiology was observed in North Carolina (NC) during 2005 to 2006. Symptoms included necrotic lesions and blighted leaves, with signs of white mycelial growth on abaxial leaf surfaces. The morphology of isolates from symptomatic leaves was consistent with that of Rhizoctonia solani. Because the pattern of symptom expression suggested that basidiospores were the primary inoculum source, Koch's postulates were fulfilled using a method to generate basidiospores in planta. Isolates were characterized by morphology, DNA sequence analysis, hyphal anastomosis, and somatic hyphal interactions. Phylogenetic analyses and hyphal anastomosis criteria support placement of the isolates in R. solani anastomosis group 3 (AG-3). Tomato foliar blight isolates from NC form a single phylogenetic group with tomato isolates of R. solani AG-3 from Japan and are more closely related to R. solani AG-3 isolates from potato than tobacco. Isolates exhibited both compatible and incompatible hyphal interactions when paired in vitro. To our knowledge, this is the first detailed report of tomato foliar blight caused by R. solani AG-3 in North America. A comprehensive description of the technique employed for producing basidiospores is presented with potential utility for understanding foliar disease etiology in other Rhizoctonia pathosystems.

First Report of Pepper veinal mottle virus Associated with Mosaic and Mottle Diseases of Tomato and Pepper in Mali.

The aphid-transmitted Pepper veinal mottle virus (PVMV; genus Potyvirus, family Potyviridae) has been reported as causing an epidemic in solanaceous crops, including eggplant, pepper, and tomato in Africa (4). In West Africa, PVMV has been detected in Senegal, Sierra Leone, Ivory Coast, Ghana, Togo, Burkina Faso, and Nigeria (2). In April 2009, leaf yellowing, mosaic, mottle, and curling symptoms indicative of viral infection were common on tomato (Solanum lycopersicum) and pepper (Capsicum annuum) plants in home gardens and fields in Mali. Symptomatic leaf samples were collected from two sweet pepper and two tomato plants from Baguineda, four tomato plants and one chili pepper plant in Kati, and three chili pepper plants from Samanko. All samples except two chili pepper from Samanko and two sweet pepper and two tomato from Baguineda tested positive for begomovirus by PCR with primers PAL1v1978/PAR1c715 (3). PVMV was detected by double-antibody sandwich (DAS)-ELISA using PVMV antibody (DSMZ, Braunschweig, Germany) in both Baguineda sweet pepper, one Baguineda tomato, and one Samanko chili pepper sample. Three PVMV ELISA-positive samples, one each of sweet pepper, chili pepper, and tomato, were also confirmed by reverse transcription (RT)-PCR and sequencing. The expected 1.8-kb viral cDNA was amplified from all three samples using the potyvirus general primer Sprimer1 (5'-GGNAAYAAYAGHGGNCARCC-3'), which was modified from the Sprimer (1) as upstream primer, and Oligo(dT) (5'-GCGGGATCCCTTTTTTTTTTTTTTTTTT-3') as downstream primer. The sequences obtained from chili pepper (GenBank Accession No. GQ918274), sweet pepper (GenBank Accession No. GQ918275), and tomato (GenBank Accession No. GQ918276) isolates, excluding the 3' poly-A tails, were each 1,831 nucleotides (nt) long, comprising the 3'-terminal of the NIb region (1 to 642 nt), the coat protein region (643 to 1,455 nt), and the 3'-untranslated region (1,456 to 1,831 nt). The sequences shared between 99.3 and 99.5% nucleotide identity with each other. A comparison of these sequences with corresponding sequences of potyviruses in GenBank revealed they had greatest nucleotide identity (96.5 to 96.6%) with a tomato isolate of PVMV from Taiwan (PVMV-TW; GenBank Accession No. EU719647), between 81.4 and 95.9% identity with other PVMV isolates, and only as much as 67.2% identity with other potyvirus isolates. Analysis of coat protein regions alone also revealed high nucleotide (96.6 to 96.8%) and amino acid (99.3 to 99.6%) identity with PVMV-TW. The PVMV Baguineda tomato isolate caused mosaic and mottle symptoms on tomato (line CLN1558A) and pepper (cv. Early Calwonder) plants following mechanical inoculation. To our knowledge, this is the first report of PVMV infecting plants in Mali and reinforces the need to take this virus into consideration when breeding tomato and pepper for this region.

First Report of Pepper as a Natural Host for Pelargonium zonate spot virus in Spain.

Pelargonium zonate spot virus (PZSV) was first reported on Pelargonium zonale (L.) L'Hér. ex Aiton and later on tomato in Italy, Spain, France (1), and the United States (2). In Spain, PZSV was first detected in 1996 in tomato plants of cv. Royesta from greenhouses in Zaragoza Province (3) and subsequently in tomato in the Catalonia and Navarra areas. In April 2006, symptoms of PZSV were found at high incidence on tomato in a greenhouse in Huesca, Aragón (northeastern Spain). Randomly distributed pepper plants (Capsicum annuum L.) of cv. Estilo F1 growing in the same greenhouse showed severe foliar chlorotic ringspots and line patterns similar to those observed in tomato. Samples from symptomatic peppers and tomatoes and one asymptomatic weed of Rubia tinctorum L. tested positive by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against PZSV (Agdia Inc., Elkhart, IN and DSMZ, Braunschweig, Germany) as did a Spanish PZSV isolate used as a positive control (3). Sap extracts from two tomatoes, three peppers, and the single R. tinctorum plant were mechanically inoculated to 22 indicator species, including pepper and tomato. On 17 of 22 species inoculated, sap from symptomatic tomatoes and peppers elicited local or systemic symptoms similar to those reported earlier for PZSV isolates (3). Systemic symptoms were mainly mosaic, chlorotic, and necrotic line patterns and ringspots on leaves of most indicator species, closely resembling those observed on the greenhouse pepper and tomato plants. Symptoms on inoculated tomatoes also included stem necrosis and death. Reactions of indicator species did not indicate the presence of any other pepper- or tomato-infecting viruses. Both field infected and mechanically inoculated plants of pepper cvs. Yolo Wonder and Doux des Landes were maintained in the greenhouse until the development of fruit symptoms. Only fruits of cv. Yolo Wonder showed dark green and slightly depressed circles on their surface. Local and systemic infection by PZSV was confirmed by DAS-ELISA in most inoculated plants. Total RNA from leaves of field or inoculated plants was used as template for amplification by reverse transcription (RT)-PCR with primers R3-F and R3-R that are specific for the PZSV 3a gene (2), and amplicons were sequenced directly. The sequences of 697 nt from pepper and tomato isolates from the same greenhouse were identical (GenBank Accession Nos. CQ178217 and CQ178216, respectively) and had 96.1% identity to nucleotides 384 to 1,080 in PZSV RNA-3 (NC_003651). Our results confirm the natural infection of pepper plants in Huesca by PZSV. To our knowledge, this is the first report of pepper as a natural host for PZSV, a significant finding considering the potential risks of PZSV dispersion whenever tomato and pepper coexist, particularly in greenhouses and nurseries.

First Report of Tomato chlorotic dwarf viroid in Greenhouse Tomatoes in Arizona

Tomato chlorotic dwarf viroid (TCDVd), a member of the genus Pospivroid, family Pospiviroidae, was first identified on greenhouse tomato (Solanum lycopersicum) in Canada (2). Since then, it has also been reported elsewhere, e.g., on tomato in Colorado (4). During 2006 in Arizona, tomato plants in a large greenhouse facility with continuous tomato production exhibited viroid-like symptoms of plant stunting and chlorosis of the young leaves. Symptomatic plants were often located along the edge of the row, indicating the presence of a mechanical transmissible agent. Approximately 4% of the plants in this greenhouse were symptomatic in 2008. Symptoms were distinctly different from those caused by Pepino mosaic virus (PepMV), a virus that was generally present in this greenhouse and also in our test samples. Other commonly occurring tomato viruses were ruled out by serological, PCR, or reverse transcription (RT)-PCR tests in multiple laboratories. RT-PCR with two sets of universal pospiviroid primers, PospiI-FW/RE and Vid-FW/RE (4), yielded amplicons of the expected sizes of 196 and 360 bp in three samples collected from symptomatic plants. Direct sequencing of the amplicons revealed that the genome was 360 nt and 100% identical to the type TCDVd from Canada (GenBank Accession No. AF162131) (2). Mechanical inoculation with leaf tissue extract from four samples to plants of the tomato 'Money-Maker' resulted in the same viroid-like symptoms and TCDVd was confirmed in these plants by RT-PCR and sequencing. In both 2007 and 2008, 18 samples were tested using primers PSTVd-F and PSTVd-R (1), which are capable of amplifying the full TCDVd genome. Analysis of the sequences from the amplicons revealed two genotypes of TCDVd. The first genotype (GenBank Accession No. FJ822877) was identical to the type TCDVd and found in 11 samples from 2007 and one from 2008. The second genotype (GenBank Accession No. FJ822878) was 361 nt, differing from the first by nine nucleotide substitutions, 2 insertions, and 1 deletion. This second genotype was found in 7 and 17 samples from 2007 and 2008, respectively, and showed the highest sequence identity (97%) to a Japanese tomato isolate (AB329668) and a much lower sequence identity (92%) to a U.S. isolate previously identified in Colorado (AY372399) (4). The origin of TCDVd in this outbreak is not clear. The genotype identified first could have been introduced from a neighboring greenhouse where the disease was observed before 2006 and where this genotype also was identified in 2007. The second genotype may have been introduced from infected seed since TCDVd has recently been shown to be seed transmitted in tomato (3). To our knowledge, this is the first report of natural occurrence of TCDVd in Arizona.

Phylogenetic analyses of plant-growth-promoting rhizobacteria isolated from tomato, lettuce, and Japanese pepper plants in Hyogo Prefecture, Japan

Approximately 30,000 fluorescent bacterial strains isolated from tomato, lettuce, eggplant, Chinese cabbage, and Japanese pepper plants at seven different locations in Hyogo Prefecture, were screened for plant-growth-promoting (PGP) activity to induce disease resistance against bacterial wilt in tomato. The 37 strains that had higher PGP activity were subjected to molecular phylogenetic analyses using the sequences of the 16S rRNA, gyrB and rpoD genes. Most of the strains were identified as Pseudomonas fluorescens or its close relative, P. putida, while a few strains were grouped with more distantly related bacterial species such as Enterobacter and Stenotrophomonas. The phylogenetic relationships among tomato and lettuce isolates mostly coincided with the source locality and host plants, with a few exceptions. In contrast, isolates from Japanese pepper plants did not form their own cluster but represented several different bacterial species.

Phenotypic and Genotypic Characterization ofPhytophthora infestansIsolates from China

A total of 288 (202 from potato and 86 from tomato) isolates of Phytophthora infestans were collected from 1998 to 2007 in China. The isolates were characterized based on mating type, in vitro metalaxyl sensitivity, virulence on potato differentials, allozymes of glucose-6-phosphate isomerase (Gpi), peptidase (Pep), and mitochondrial DNA (mtDNA) haplotype and examined by DNA-based simple sequence repeat (SSR) and random amplified polymorphic DNA (RAPD) fingerprinting. The majority (283 of 288) of the isolates were of the A1 mating type, the other three were the A2 mating type and two were the A1A2 mating type. Resistance to metalaxyl was frequently observed, with 248 (86.1%) resistant, 21 (7.3%) intermediate and 19 (6.6%) sensitive isolates identified. Virulence was assessed for 125 isolates on a set of 11 potato differentials and 61 races were detected. Most isolates were virulent on the differential genotype with gene R3, and all known virulence genes were found, with race 3.4.7.11 being the most common. This pattern did not appear to be associated with geographic origin, sample type, mating type or metalaxyl sensitivity. The dominant banding patterns for Gpi were 100/100/111 (176 isolates) and 100/100 (109 isolates), but genotypes 86/100 and 100/111 were also identified. All isolates tested were homozygous (100/100) at the Pep locus. The majority (205 of 288) of isolates tested was of mtDNA haplotype IIb, 76 were haplotype IIa and seven were the rare Ib haplotype. The genetic diversity of 60 representative isolates from China was assayed by two types of molecular markers, RAPD and SSR. A high level of polymorphism was found. The results demonstrated the diverse phenotypic and genotypic structure of the current populations of P. infestans in China.

Transgenic resistance by N gene of a Peanut bud necrosis virus isolate of characteristic phylogeny

The nucleocapsid protein (N) gene of a Tospovirus devastating tomato crop in the south Indian state of Tamil Nadu was cloned and characterized. The high identity of the cloned sequence to a Peanut bud necrosis virus (PBNV) tomato isolate (97.8/99.6% nucleotide/amino acid) and a PBNV peanut isolate (94.4/96.3% nucleotide/amino acid) identified the Tospovirus as an isolate of PBNV, designated PBNV Coimbatore tomato (PBNV CT) isolate. Phylogenetic analysis of PBNV CT N gene provided useful insights into the movement and evolution of PBNV within Indian Territory. The characteristic phylogeny of PBNV CT N gene implied its potential to be an efficient transgene to confer effective PBNV resistance on crop plants. The efficacy of PBNV CT N gene in conferring PBNV resistance was studied by generating tobacco (Nicotiana tabacum L. cv Wisconsin) lines transgenic to the sense or antisense version of the gene. Several transgenic lines showed transgenic mRNA and/or protein accumulation, ranging from very high to undetectable levels, accompanied by different degrees of PBNV resistance. The undetectable or very low levels of transgene transcripts in certain PBNV-resistant sense or antisense N gene transgenic lines suggested RNA-mediated resistance by post-transcriptional gene silencing (PTGS) mechanism. However, PBNV resistance of certain transgenic lines with high levels of N gene transcripts was suggestive of possible operation of RNA-mediated non-PTGS mechanism(s) of resistance in those lines. Moreover, the high levels of N protein in certain PBNV-resistant sense N gene transgenic lines suggested protein-mediated resistance. The results predict the potential of PBNV CT N gene to confer effective PBNV resistance on tomato and other economically important crops.

Identification of a New Begomovirus Associated with Yellow Leaf Curl Diseases of Tomato and Pepper in Sulawesi, Indonesia.

Whitefly-transmitted geminiviruses (family Geminiviridae, genus Begomovirus) cause severe disease epidemics of tomato and pepper in Indonesia. Four tomato-infecting begomoviruses have been reported from Java Island; Ageratum yellow vein virus (AYVV), Tomato leaf curl Java virus (ToLCJV), Tomato yellow leaf curl Indonesia virus (TYLCIDV), and Pepper yellow leaf curl Indonesia virus (PepYLCIDV) (4). The latter was also found to infect peppers. In 2006, symptoms typical of those caused by begomoviruses, leaf curling, blistering, yellowing, and stunting, were observed in tomato and pepper fields in North Sulawesi with incidence as high as 100%. Three symptomatic tomato leaf samples from each of two fields in the Langowan area and one from each of two fields in the Tompaso area, as well as one pepper sample from each of two fields in the Langowan area and two from a field in the Tompaso area were collected. Using the primer pair PAL1v1978/PAR1c715 (3), a begomovirus DNA-A was detected by PCR in all the tomato samples, in the two pepper samples from Langowan, and in one of the Tompaso pepper samples. A begomovirus DNA-B component or virus-associated satellite DNA were not found in any of the samples by PCR using the DNA-B general primer pairs DNABLC1/DNABLV2 and DNABLC2/DNABLV2 (2) and the satellite detection primer pair Beta01/Beta02 (1). The PCR-amplified 1.5-kb fragment from one positive sample each from the four tomato and three pepper fields were sequenced and found to have high nucleotide (nt) sequence identity (>95.0%). An abutting primer pair (IndV: 5'CCCGGATCCTCTAATTCATCCCT3'; IndC: 5'GACGGATCCCACATGTTTGCCA3') was designed to amplify the full-length genomes of the four tomato (GenBank Accession Nos. FJ237614, FJ237615, FJ237616, and FJ237617) and three pepper (GenBank Accession Nos. FJ237618, FJ237619, and FJ237620) begomoviruses. The sequences of all seven begomovirus isolates were 2,750 or 2,751 bp long and contained the conserved nonanucleotide sequence-(TAATATTAC), two open reading frames (ORFs) in the virion-sense and four ORFs in the complementary sense. Sequence comparisons using MegAlign software (DNASTAR, Madison, WI) showed the four tomato and three pepper isolates to have high nt identity (>95.1%). BLASTn analysis and comparison of the sequences with others available in the GenBank database ( www.ncbi.nlm.nih.gov ) show that the isolates of this study have the highest nt sequence identity (66.5%) with PepYLCIDV (Accession No. DQ083765) and less than 66.5% nt identity with other begomoviruses including those reported from Indonesia. On the basis of the currently accepted begomovirus species demarcation threshold of 89% nt identity, the tomato and pepper begomovirus isolates from North Sulawesi constitute a distinct species in the genus Begomovirus for which the name Tomato leaf curl Sulawesi virus (ToLCSuV) is proposed. Phylogenetic analysis shows the ToLCSuV isolates form a cluster distinct from other Indonesian begomoviruses as well as begomoviruses from the neighboring Philippines.

Capsicum chlorosis virus (Genus Tospovirus) Infecting Chili Pepper (Capsicum annuum) in India.

Chili pepper (Capsicum annuum L.) is one of the most important spice crops in India. In October of 2006, symptoms indicative of tospovirus infection were noticed in several commercial fields of chili pepper near Bangalore in Karnataka State. Chlorotic and necrotic spots and rings on leaves, apical necrosis, and leaf distortion were observed. Disease incidence was more than 20%. Mechanical inoculation with sap extracts from these symptomatic plants showed that the host range and symptomatology of the virus was similar to those described for Capsicum chlorosis virus (CaCV) (1,3). The virus reacted with antisera specific to Groundnut bud necrosis virus (GBNV) and Watermelon silver mottle virus of serogroup IV tospoviruses in antigen-coated plate ELISA. It did not react with antisera specific to Tomato spotted wilt virus, Impatiens necrotic spot virus, or Iris yellow spot virus in double-antibody sandwich-ELISA. Immunosorbent electron microscopy of infected sap using GBNV antiserum revealed the presence of strongly decorated quasi-spherical virus particles. Reverse transcription (RT)-PCR was conducted to further identify the virus. No amplification was observed from extracts of symptomatic plants (n = 10) by RT-PCR using GBNV-specific primers (4), indicating that the diseased chili was not infected with GBNV. However, a DNA fragment of approximately 850 bp was amplified by using primers specific to the nucleocapsid (N) gene of CaCV (CaCF 5'-CTATAGAWGTACTAGGCTTTGAGC-3' and CaCR 5'-CATGTCTAACGTCAGGCAACTTAC-3'). Direct sequencing of the amplicon (GenBank Accession No. EF625227) revealed a nucleotide sequence identity ranging from 85.5% with isolates from Thailand (GenBank Accession Nos. AY846366, AY647437, and AF134400) and China (GenBank Accession No. DQ355974) to 98.1% with isolates from Australia (GenBank Accession Nos. AY036057 and AY036058). Phylogenetic analysis of the N protein sequences showed that the chili pepper isolate from India formed a cluster with those from Australia. This cluster was distinct from the one formed by the peanut isolates from Thailand and a tomato isolate from India (2). To our knowledge, this is the first report of CaCV infection of chili pepper in India. The potential impact of CaCV on tomato and chili pepper production in India remains to be seen.

Role of recombination in the evolution of the model plant pathogen Pseudomonas syringae pv. tomato DC3000, a very atypical tomato strain.

Pseudomonas syringae pv. tomato strain DC3000 (PtoDC3000) is one of the most intensively studied bacterial plant pathogens today. Here we report a thorough investigation into PtoDC3000 and close relatives isolated from Antirrhinum majus (snapdragon), Apium graveolens (celery), and Solanaceae and Brassicaceae species. Multilocus sequence typing (MLST) was used to resolve the precise phylogenetic relationship between isolates and to determine the importance of recombination in their evolution. MLST data were correlated with an analysis of the locus coding for the type III secreted (T3S) effector AvrPto1 to investigate the role of recombination in the evolution of effector repertoires. Host range tests were performed to determine if closely related isolates from different plants have different host ranges. It was found that PtoDC3000 is located in the same phylogenetic cluster as isolates from several Brassicaceae and Solanaceae species and that these isolates have a relatively wide host range that includes tomato, Arabidopsis thaliana, and cauliflower. All other analyzed tomato isolates from three different continents form a distinct cluster and are pathogenic only on tomato. Therefore, PtoDC3000 is a very unusual tomato isolate. Several recombination breakpoints were detected within sequenced gene fragments, and population genetic tests indicate that recombination contributed more than mutation to the variation between isolates. Moreover, recombination may play an important role in the reassortment of T3S effectors between strains. The data are finally discussed from a taxonomic standpoint, and P. syringae pv. tomato is proposed to be divided into two pathovars.

Biological and molecular characterization of tospoviruses in Thailand

Twenty-eight isolates of tospoviruses associated with tomato, pepper, cucurbits, peanut, and Physalis plants collected from fields in different regions of Thailand were characterized. On the basis of N gene and protein sequence relationships, three tospoviruses were identified, namely Watermelon silver mottle virus (WSMoV), Capsicum chlorosis virus (CaCV), and Melon yellow spot virus (MYSV). CLUSTAL analysis of selected N protein sequences showed different isolates of CaCV in three distinct clades. Based on necrosis symptoms on tomato and their 93% identity to CaCV isolates in the other two clades, CaCV-TD8, CaCV-AIT and CaCV-KS16-Thailand tomato tospovirus were designated as CaCV-tomato necrosis strain. A phylogenetic tree based on the 413-amino-acid Gc fragment of the CaCV-Pkk isolate supported the existence of three distinct CaCV clades. Vigna unguiculata produced concentric rings useful for discriminating the Thai CaCV peanut isolates from tomato or pepper isolates. By using reverse transcription polymerase chain reaction with species-specific primers, the three tospoviruses could be detected in mixed infections in watermelon and Physalis, as well as in the bodies of thrips vectors, Thrips palmi and Scirtothrips dorsalis, collected from fields.

First Report of Anthracnose Fruit Rot Caused by Colletotrichum acutatum on Pepper and Tomato in Bulgaria.

In the late summer of 2005, sporadic and unusual damage was observed on pepper (Capsicum annuum cv. Kurtovska kapia and local cv. Ribka) on two farms and tomato (Lycopersicon esculentum cv. Florida 47) fruits on one farm in the Plovdiv Region of Bulgaria. Dry, round, sunken zones (10 to 20 mm) were observed on pepper fruits that preserved their natural skin color even after black acervuli containing orange masses of conidia appeared. Eventually, the lesions turned brown, coalesced, and the fruits mummified on the plants. Tomato fruits developed similar symptoms, with less prominent discoloration and fewer acervuli. The pathogen was easily isolated from both hosts on potato dextrose agar where it formed white-to-gray colonies with salmon orange pigmentation on the reverse side of the plates. Conidia that formed were hyaline, fusiform, aseptate, and measured 13.3 to 17.4 × 3.5 to 5.5 μm and 11.6 to 15.5 × 4.1 to 5.0 μm for pepper and tomato isolates, respectively. Both cultural and morphological characteristics of the isolates were similar to those described for Colletotrichum acutatum (3). Koch's postulates were performed with two representative isolates from each host by artificial inoculation of healthy, green pepper and ripe tomato fruits from the respective cultivars. Fruits were wound inoculated with a sterile scalpel, and small agar plugs (3 to 4 mm) containing 7-day-old sporulating cultures were placed on each wound (five fruits per isolate), or by pipette tip-pricking and pipetting a 5-μl droplet of a conidial suspension (5 × 106 conidia ml-1) on each wound. The same number of wounded, noninoculated fruits was used as a control. Fruits were maintained in a humidity chamber at 22 to 25°C, and 4 days later, sunken necrotic zones were observed around the wounds of inoculated fruit, whereas control fruits remained symptomless. The pathogen was subsequently reisolated from the inoculated diseased tissues but not from the control fruits. Species-specific PCR (using primer pair CaInt2/ITS4) (2,4) of genomic DNA from three representative isolates (two from pepper and one from tomato) resulted in an amplification product of 490 bp, specific for C. acutatum, further confirming the identity of the pathogen. To our knowledge, this is the second report of C. acutatum in Bulgaria (1), and the first occurrence of that agent on tomato and pepper in this country.

Electrophoretic karyotyping and mapping of pathotype-specific DNA sequences in Japanese isolates of Verticillium dahliae

The chromosome number and electrophoretic karyotype of Japanese isolates of Verticillium dahliae were investigated. In a genomic Southern blot analysis of seven isolates probed with a telomere consensus sequence (TTAGGG)5, 12 or 14 bands were observed. Furthermore, pulsed-field gel electrophoresis (PFGE) of these isolates revealed five or six chromosomal bands. A band (approx. 3.5 Mbp) common to all isolates apparently contained more than two chromosomes. From these results, we concluded that each isolate’s chromosome number is six (an eggplant pathotype isolate) or seven (all isolates of tomato and sweet pepper pathotypes). Although the chromosome sizes differed among isolates, karyotypes were similar within tomato and sweet pepper pathotypes. A small chromosome (approx. 1.8 Mbp) was observed only in the sweet pepper pathotype. Subsequent PFGE-Southern hybridization analyses revealed that the three DNA fragments specific to tomato pathotype are located on the same chromosome. These results suggest that the tomato-pathotype-specific DNA sequences might coexist on one chromosome.

Sequence analysis within the RNA 3 of seven Spanish tomato isolates of Parietaria mottle virus (PMoV-T) reveals important structural differences with the parietaria isolates (PMoV)

The genomic regions encoding the putative movement protein (MP), coat protein (CP) and intergenic region (IGR) of seven Spanish isolates of the Parietaria mottle virus which infects tomato plants (PMoV-T) were sequenced. Values for the genetic diversity of the PMoV-T isolates were 0.056, 0.047 and 0.013 for the CP, MP genes and IGR, respectively. Nucleotide and amino acid sequence comparison of the seven PMoV-T isolates with those of PMoV revealed significant differences. All of them had a cytosine deletion at position 1366, also confirmed in an Italian tomato isolate, which involves a start codon for the CP gene different from that for the PMoV sequence, resulting in a CP 16 amino acids shorter than the PMoV CP. The certainty of a cytosine deletion only associated to the tomato isolates or the possibility of a mistake in the PMoV published sequence are the two hypotheses that could explain this difference. Structural motifs highly conserved in Ilarviruses were identified in PMoV-T MP and CP. A stable hairpin structure is proposed for IGR, by the initiation site for subgenomic RNA 4 synthesis. Phylogenetic analysis of CP and MP amino acid sequences showed that Spanish PMoV-T isolates form a separate group from PMoV and other members of the Ilarvirus genus. Comparative analysis with different PMoV isolates including tomato isolates from other regions and isolates from different hosts are necessary to confirm this differentiation.

Diversidade patogênica e molecular de Ralstonia solanacearum da região amazônica brasileira

Foi avaliada a diversidade de isolados de Ralstonia solanacearum obtidos de tomateiro e de outras hospedeiras com sintomas de murcha bacteriana na região amazônica. Os isolados foram identificados quanto à biovar e separados em graus de virulência em plantas de tomate, pimentão e chicória da Amazônia (Eryngium foetidum). Dos 70 isolados, 53 pertenciam à biovar 1, quatro à biovar N2 e 13 à biovar 3, confirmando a predominância da biovar 1 em tomateiro no Estado do Amazonas. O agrupamento dos isolados mostrou três classes distintas de virulência em tomate, sendo 44,3% dos isolados altamente virulentos, 37,1% medianamente virulentos e 18,6% fracamente virulentos. O agrupamento em pimentão classificou 20% de isolados como altamente virulentos, 27,1% como medianamente virulentos e 52,9% como fracamente virulentos. Quando inoculados em chicória da Amazônia, somente o isolado de chicória provocou murcha nesta hospedeira, sugerindo uma especificidade pouco comum para R. solanacearum. Na caracterização molecular, 46 isolados de tomateiro e 18 de outras 10 hospedeiras, coletados em áreas de terra-firme e de várzea, foram comparados por BOX-PCR. Os perfis genômicos revelaram alto grau de polimorfismo entre os isolados, divididos em cinco grupos, sem correlação entre hospedeira de origem, biovar, ecossistema ou local de coleta. O isolado de chicória da Amazônia foi o mais divergente, com apenas 6,4% de similaridade em relação aos demais. Os isolados de tomateiro estavam representados em três grupos. Os quatro isolados de tomateiro da biovar N2 formaram um agrupamento distinto dos isolados das demais biovares presentes na Amazônia.