Tester Isolates Research Articles

Characterisation of Cryphonectria hypovirus 1 strains in Turkey and their transmission to various vegetative compatibility types of Cryphonectria parasitica

Characterization of the Cryphonectria parasitica population was initially done by a phenotypical assessment of 40 in vitro grown isolates obtained from 52 healing cankers collected from eight important chestnut-growing provinces of Turkey. The results of Bavendamm test, often correlated indirectly to hypovirulence, suggested 31 possibly hypovirulent and 9 virulent isolates. PCR tests amplified two regions of ORFs A and B of Cryphonectria hypovirus 1 (CHV-1) from 36 of 40 isolates. The PCR test confirmation was more sensitive than the Bavendamm test. Partial ORFA sequencing revealed 36 CHV-1 haplotypes belonging to Italian subtype (I), with all hypovirulent isolates being of EU-1 vc type. The CHV-1 from 10 native EU-1 isolates were first transferred to six European vc type testers, EU-2, EU-3, EU-5, EU-7, EU-26, and EU-44, having heteroallelism at one vic locus. The presence of the vic locus difference generally reduces virus transmission. The easiest and highest frequency virus transfer was obtained by vic4 and vic6 allelic differences, while the differences vic2 and vic7 made the transfer more challenging. Finally, in this study we successfully transferred CHV-1 to an EU-1 isolate obtained from the Bursa province to an EU-12 European tester isolate.

Characterization of three-nucleate Rhizoctonia AG-E based on their morphology and phylogeny

The genus Rhizoctonia has been classified into two main groups according to the number of nuclei. Binucleate Rhizoctonia strains have two nuclei in each cell, whereas multinucleate Rhizoctonia fungi were observed to have a variable number of nuclei ranging from 4 to 16 in each cell. In the study, twelve Polish isolates were tested. According to ITS1-5,8S-ITS2 rDNA sequences, the isolates were classified in the AG-E. Their affiliation to AG was confirmed by anastomosis reactions with tester isolates. The number of nuclei was counted with DAPI staining under a fluorescent microscope, and the diameter of the hyphae was also measured. Not all AG-E isolates had the same number of nuclei in their cells: one group among these fungi produced cells with a diverse number of nuclei, usually 3; however, this number ranged from 2 to 4, making the average number of nuclei close to 3. It can be assumed that all isolates with three nuclei belong to this group, which may greatly facilitate the preliminary identification of trinucleate isolates of Rhizoctonia spp. belonging to AG-E. Based on these characters, we call these isolates AG-E-3n isolates. The thiamine requirement is not helpful in classifying and describing the AG-E strains.

First Report of Armillaria root disease of Celtis laevigata caused by A. gallica in South Carolina, USA.

Celtis laevigata (sugarberry, southern hackberry) is an important, shade-tolerant, deciduous hardwood tree species that occurs naturally in flood plains, along streams and rivers, and in urban landscapes of the southeastern USA (Kennedy 1990). In recent years, dieback and mortality of C. laevigata have been commonly observed in some areas of South Carolina (SC) and Georgia (GA) (Poole et al. 2021). In April/May of 2018, the crown conditions and root systems were examined for three C. laevigata trees in North Augusta, SC. The crown of each tree was visually assessed using the method of Poole et al. (2021). Root samples were obtained by excavating two main roots ca. 2 meters away from the stem of each tree. Tree SB474 (N33 29.472, W81 59.082, elev. 55.8 m) exhibited > 66% crown loss and decaying roots with white mycelial fans and dark rhizomorphs characteristic of Armillaria. Tree SB913 (N33 29.830, W81 59.349, elev. 58.8 m) exhibited ca. 34-66% crown loss, while tree SB914 (N33 29.837, W81 59.338, elev. 57 m) appeared healthy with no apparent crown loss. Roots of trees SB913 and SB914 appeared healthy, although rhizomorphs were attached to the root surfaces. Roots and/or attached rhizomorphs were surface disinfested and plated n a basidiomycete-selective medium (Hendrix and Kuhlman 1962). Three Armillaria isolates, one from each corresponding tree, were paired with each other, and two genets were identified (SB474 and SB913 = SB914). The two genets (SB474 and SB913) were used in somatic pairing tests against three known tester isolates for each of the following species: A. solidipes, A. mellea, A. gallica, A. mexicana, and Desarmillaria caespitosa (=A. tabescens). Pairing of isolates SB474 and SB913 showed the highest compatibility with A. gallica (isolates ST22, ST23, and M70) with 100% and 89%, respectively. These isolates were definitively confirmed as A. gallica by translation elongation factor 1α gene sequences (tef1; Klopfenstein et al. 2017) (GenBank accession nos. OM993577 and OM993578 for SB474 and SB913, respectively). GenBank nucleotide BLAST showed tef1 similarity for both SB474 and SB913 isolates was highest for A. gallica (≥98.7%; GenBank accession nos. MT761696, MT761697, and KF156772). This is the first report of A. gallica associated with Armillaria root disease of C. laevigata. Rhizomorphs on the surface of apparently healthy tree roots and root colonization in severely declining trees are a common sign of A. gallica (Baumgartner and Rizzo 2001). Pathogen colonization of root surfaces may provide an opportunity for infection of highly damaged trees, resulting in root disease (Gregory 1985). Primary agents of C. laevigata dieback and mortality in SC and GA remain undefined, but continued study is needed to confirm the role of A. gallica in C. laevigata dieback and mortality. Although pathogenicity tests are impractical for Armillaria, these A. gallica occurrences in SC further adds to our knowledge of this pathogen's distribution in the southeastern USA, where it has also been confirmed in Tennessee in hardwood forests (Bruhn et al. 1997), SC on Hemerocallis sp. (Schnabel et al. 2005), and GA on a Rhododendron/span> sp. and Quercus rubra (Hanna et al. 2020). The distribution and host range of A. gallica is likely more widespread in the southeastern USA than existing records indicate. Documenting Armillaria distribution, including A. gallica, is essential for predicting climate-change impacts on Armillaria root diseases (Kim et al. 2022). Baumgartner, K., and Rizzo, D. M. 2001. Plant Dis. 85:947-951. Bruhn, J. N., et al. 1997. In 11th Central Hardwood Forest Conference, USDA, FS, NC-GTR-188, 49-57. Gregory, S. C. 1985. Plant Path. 34:41-48. Hanna, J. W., et al. 2020. Plant Dis. 105: 1226. Hendrix Jr, F. F., and Kuhlman, E. G. 1962. PI. Dis. Rep. 46:674-676. Kennedy, Jr., H. E. 1990. Silvics of North America: 2. Hardwoods. USDA-FS. Agriculture Handbook 654. Kim, M.-S., et al. 2022. Front. For. Glob. Change 4:740994. Klopfenstein, N. B., et al. 2017. Mycologia 109:75-91. Poole, E. M., et al. 2021. J. For. 119:266-274. Schnabel, G., et al. 2005. Plant Dis. 89:683.

Genetic, Phenotypic, and Pathogenic Variation Among Athelia rolfsii, the Causal Agent of Peanut Stem Rot in China.

Peanut stem rot caused by Athelia rolfsii is a serious soilborne disease worldwide and is becoming increasingly important in China. A total of 293 A. rolfsii isolates were collected from four representative peanut producing provinces in northern, central, and southern China. These isolates were assigned to 45 mycelial compatibility groups (MCGs) through pairing testing. The MCG diversity among isolates was greater in the southern sampled provinces compared with the northern provinces. A high level of genetic variability was found among the isolates from Guangdong Province in southern China. Variations were found in mycelial growth rate and sclerotial number, size, and dry weight of isolates sampled from places in different latitudes. Size and dry weight of sclerotia were positively correlated with latitude (P < 0.01), but the number of sclerotia was negatively correlated with latitude (P < 0.01). All tester isolates were pathogenic on peanut but varied in disease index. Inter-simple sequence repeat analysis and unweighted pair-group method with arithmetic average clustering resulted in three distinct clusters that were associated with the geographical location of the collection sites and sclerotial traits but were not associated with virulence of these isolates. These findings imply that genetic diversity, morphological traits, and virulence among A. rolfsii isolates varied in diverse geographical regions in China, and genetic diversity and sclerotial traits might be affected by latitude.

First report of Armillaria cepistipes causing root disease on Populus trichocarpa (black cottonwood) in Oregon, USA.

Populus trichocarpa Torr. and Gray (black cottonwood) is an economically and ecologically important tree species native to western North America. It serves as a model tree species in biology and genetics due to its relatively small genome size, rapid growth, and early reproductive maturity (Jansson and Douglas 2007). Black cottonwood is susceptible to root rot caused by at least one species of Armillaria (Raabe 1962), a globally distributed genus that exhibits diverse ecological behaviors (Klopfenstein et al. 2017) and infects numerous woody plant species (Raabe 1962). However, several Armillaria spp. have been isolated from Populus spp. in North America (Mallet 1990), and the most recent report of Armillaria on P. trichocarpa used the now ambiguated name A. mellea (Vahl.) Quel. (see Raabe 1962). In April 2016, mycelial fans and rhizomorphs of an unknown Armillaria species (isolate WV-ARR-3) were collected from P. trichocarpa in a riparian hardwood stand ca. 5.5 km east of Springfield, Oregon, USA (44°3'21.133"N, 122°49'39.935"W). The host was dominant in the canopy, large in diameter (ca. 90-cm dbh) relative to neighboring trees, and exhibited minimal crown dieback (ca. < 5%). A mycelial fan was observed destroying living cambium beneath the inner bark, indicating pathogenicity. The isolate was cultured on malt extract medium (3% malt extract, 3% dextrose, 1% peptone, and 1.5 % agar) and identified as A.cepistipes on the basis of somatic pairing tests and translation elongation factor 1α (tef1) sequences (GenBank Accession No. MK172784). DNA extraction, PCR, and tef1 sequencing followed protocols of Elías-Román et al. (2018). From nine replications of somatic incompatibility tests (18 tester isolates representing six North American Armillaria spp.), the isolate showed high intraspecific compatibility (colorless antagonism) with three A. cepistipes tester isolates (78%), but low compatibility with the other Armillaria spp. (0 - 33%) that occur in the region. Isolate WV-ARR-3 yielded tef1 sequences with a 99% identity to A. cepistipes (GenBank Accession Nos. JF313115 and JF313121). A second isolate (WV-ARR-1; GenBank Accession No. MK172783) with a nearly identical sequence was collected from a maturing P. trichocarpa in a riparian stand ca. 8 km northeast of Monroe, Oregon (44°21'47.57"N, 123°13'14.415"W) along the Willamette River, downstream from the McKenzie river tributary where WV-ARR-3 was collected. Armillaria cepistipes has been reported on Alnus rubra (red alder) in Washington, USA (Banik et al. 1996) and on broad-leaved trees in British Columbia, Canada (Allen et al. 1996). It is generally considered to be a weak pathogen on broad-leaved trees in the Pacific Northwest, but it is also associated with pathogenicity on both coniferous and deciduous trees in Europe (e.g., Lygis et al. 2005). However, a recent phylogenetic study suggested that North American A. cepistipes is phylogenetically distinct from Eurasian A. cepistipes (Klopfenstein et al. 2017), butadditional studies are needed to determine the formal taxonomic status of North American A. cepistipes. To our knowledge, A. cepistipes has not been previously confirmed on P. trichocarpa in the U.S.A. or formally reported as a pathogen of any Populus species in North America. Continued studies are needed to determine the distribution, host range, and ecological role of A. cepistipes in riparian forests of the Pacific Northwest, while monitoring its populations under changing climates.

First Report of the Armillaria Root-Disease Pathogen, Armillaria gallica, Associated with Several Woody Hosts in Three States of Central Mexico (Guanajuato, Jalisco, and Michoacan).

In July-August 2019, seven Armillaria isolates (derived from rhizomorphs and mycelial fans of infected roots) were collected in association with woody hosts in the central Mexico: states of Guanajuato (MEX204), Jalisco (MEX206, MEX208, MEX209), and Michoacan (MEX211, MEX214, MEX216). All seven isolates were identified as Armillaria gallica based on translation elongation factor 1α (tef1) gene sequences (GenBank accession Nos.: MN839636 - MN839642 for MEX204, MEX206, MEX208, MEX209, MEX211, MEX214, and MEX216) and somatic pairing tests against known tester isolates. GenBank nucleotide BLAST results showed tef1 similarity for all isolates was highest for with A. gallica (≥ 97%; GenBank Accession Nos. KF156775 and KF156772). In replicated pairings against three tester isolates each for A. gallica, A. mellea, and A. mexicana, all isolates showed the highest compatibility with A. gallica (67-100%), with lower compatibility against A. mellea and A. mexicana, with 3-11% and 2-11%, respectively. Variations in compatibility among different tester isolates could reflect cryptic speciation within A. gallica (Klopfenstein et al., 2017). In Tarimoro, Guanajuato, MEX204 was isolated from infected Quercus jonesii (20°13'46.2"N 100°42'51.1"W, elevation 2286 m) that displayed root disease symptoms/signs (wilting/defoliation and mycelial fans within the roots). In a forested area of Mazamitla, Jalisco, MEX206 was isolated from infected Quercus laevis (19°54´52"N 103°00´07"W, elevation 2564 m) with root disease symptoms/signs (e.g., wilting, foliar chlorosis, and mycelial fans within the root crown); MEX208 was isolated from infected Pinus pseudostrobus (19°54´53"N 102°59´54"W, elevation 2554 m) with basal resinosis and mycelial fans; and MEX209 was collected from a symptomless P. devoniana (19°54'13.1"N 103°00'14.1"W, elevation 2566 m). In Zinapecuaro, Michoacan, MEX211 (19°53'28.8"N 100°39'44.0"W, elevation 2587 m) was isolated from infected Malus domestica with root disease that resulted in mortality; in Hidalgo, Michoacan, MEX214 (19°46'49"N 100°39'25.2"W, elevation 2961 m) and MEX216 (19°46'58"N 100°39'24"W, elevation 2958 m) were isolated from infected P. devoniana and P. teocote, respectively, which both displayed root disease symptoms/signs (basal resinosis and mycelial fans). Previously, A. gallica was reported in the State of Mexico, Veracruz, Oaxaca, Mexico (Elías-Román et al. 2013; Klopfenstein et al. 2014), but this represents the first report of A. gallica in Guanajuato, Jalisco, and Michoacan, Mexico. In contrast to other regions of North America (e.g., Bruhns et al. 2000), A. gallica was demonstrated to be a virulent pathogen on peach (Prunus persica) in central Mexico (Elías-Román et al. 2013). Unfortunately, tree seedlings cannot be used for Armillaria pathogenicity tests in a greenhouse or nursery; however, all root-diseased trees in this report showed Armillaria mycelial fans under the bark of a living tree, which are reliable indicators of pathogenicity, and no other root diseases were found. This report demonstrates that A. gallica is distributed across central Mexico, where it is associated with disease on Quercus, Pinus, and Malus. Such information is critical to increase our understanding of Armillaria root disease across diverse geographic regions and climates.

First Report of Collar and Stem Rot Caused by Rhizoctonia solani AG1-IA on Sesbania sesban in India.

Sesbania sesban (L.) Merr., (family Fabaceae) commonly called as "dhaincha" in India, is a multi-purpose crop used as a cover crop, as green manure, in the paper industry as well as animal fodder. The leaves of Sesbania contain high amounts of pinitol, which acts as an anti-diabetic agent (Misra and Siddiqi 2004). During July/August from 2017 to 2019, Sesbania plants exhibiting typical Rhizoctonia-like symptoms, including collar rot, wilting, and necrotic lesions on stems were regularly observed at ICAR-Central Potato Research Institute Regional Station, Meerut, Uttar Pradesh. The disease incidence ranged between 5 and 10% in a Sesbania crop being grown on 25 ha in Sesbania-potato rotation. Ten diseased plants were collected from different fields and brought to the laboratory for diagnosis. Affected stem pieces approximately 5 mm in size were surface sterilized with 2% sodium hypochlorite, washed twice in sterilized water and air dried. Four diseased pieces per plate were inoculated on 2% water agar amended with 2% streptomycin sulfate and incubated at 28±1℃ in the dark. All four affected pieces began to produce Rhizoctonia-like colonies after 48 h of incubation and in total eight isolates were purified and stored at 4℃ for further use. The colonies of eight isolates were evaluated and all were whitish during early growth and became light brown after 72 h. Dark-brown sclerotia appeared in the random pattern on PDA after 120 h. Microscopic observations showed that all isolates had hyphal branching at right angles with slight constriction at the base of the branch, presence of dolipore septum near the branching and multinucleate individual hyphae compartments (Sneh 1991). Based on these morphological characteristics, the fungus was identified as Rhizoctonia solani. All isolates were further characterized to determine anastomosis group (AG) by pairing with a known AG tester of R. solani AG-1-IA (ITCC 7650), AG-1-IB (ITCC 5650), and AG-3 (RS-20) procured from Indian Type Culture Collection, Division of Plant Pathology, ICAR-Indian Agricultural Research Institute, New Delhi and ICAR-Central Potato Research Institute, Shimla, Himachal Pradesh, India, respectively. All eight isolates showed positive anastomosis with a known AG-1-IA tester isolate while no anastomosis was observed with other known tester isolates (Carling 1996). Furthermore, a single ~265 bp amplicon was amplified with AG-specific primer, which was specific to R. solani AG1-IA group; confirms the AG-specific identity of the isolates (Matsumoto 2002). Amplification was not observed with AG1-IB, AG3 and AG2 specific primers (Khodayari et al. 2009). The selected four isolates were molecularly characterized by amplifying the internal transcribed spacer (ITS) and ribosomal DNA (rDNA) 5.8s regions by polymerase chain reaction using ITS1 and ITS4 primer pairs (White et al. 1990). The nucleotide BLAST (BLASTn) analysis of the resulting four sequences i.e. GenBank acc. no. MT105386, MT105387, MT105388, and MT105389 supported the identification of the isolates as AG-1-IA sub-group and showed 95.12%, 98.93%, 96.79%, and 98.04%, respectively, sequence homology with known cultures of R. solani AG1-IA isolated from rice in China (KC285893), and India (MK481078). To confirm pathogenicity, Sesbania plants were grown in pots and maintained in the greenhouse at 25℃ with a 12-h-light/dark photoperiod. After 35 to 40 days of growth, the stems of ten Sesbania plant were artificially inoculated with PDA plugs containing R. solani mycelia (Jia et al. 2007) and covered with aluminium foil. Plants inoculated with noncolonized agar plugs served as control. After 96 h of incubation, all the plants inoculated presented the typical collar and stem rot symptoms. No symptoms were observed in the control plants. R. solani was re-isolated cent percent from these ten infected plants fulfilling Koch's postulates. R. solani AG1-IA has been reported to cause sheath blight and banded leaf and sheath blight diseases of rice and maize, respectively (Ogoshi 1987). To our knowledge, this is the first report of Sesbania sesban infected by R. solani AG1-IA, and serve as a host for the pathogen. The result from our findings will be helpful for planning of crop rotations in an agro-ecosystem.

Rhizoctonia solani AG 11 isolated for the first time from sugar beet in Poland.

Two isolates of Rhizoctonia solani AG11 were isolated from sugar beet seedlings from South-west Poland. Both isolates gave C2 reactions in anastomose pairings with the tester isolates of AG11. The membership of both isolates to AG11 was confirmed by analysis of pectic isozyme profiles, and by verification that the internal transcribed spacer sequences of both isolates matched the references in the GenBank database. Both AG11 isolates formed white-beige to creamy-colored mycelium with wide concentric zonation. One of them formed light-colored sclerotia. The average daily rate of hyphal growth at 21 °C was 22.8 mm and 22.6 mm on PDA. They were mildly pathogenic to sugar beet seedlings due to the mycelial and secondary metabolites’ activity. The sensitivity to fungicides typically used in sugar beet protection was different for each isolate; one of them (isolate ID11) was less sensitive to thiram than the other (isolate ID3). This article discusses the worldwide occurrence of R. solani AG11, expands the currently known host range, shows its broad world distribution in regions of moderate climate, and confirms the isolates’ low frequency.

Sexual reproduction parameters in Fusarium verticillioides populations from maize in Brazil

Fusarium verticillioides is an important plant pathogen causing infections on ears and/or stalks of maize. This study aimed to compare sexual reproduction parameters in populations of F. verticillioides from distinct regions in the different Brazilian climatic zones where maize is grown. Fertility and effective population size were calculated from data generated by crossing field isolates with female fertile testers. Three hundred fungi isolates were obtained from maize kernels with Fusarium ear rot symptoms in different geographic regions of Brazil in the years 2012 and 2013. For the entire population, 231 out of 300 isolates were cross-fertile with tester isolates. MAT1–1 and MAT1–2 idiomorphs of the fertile isolates segregated in a 105:126 ratio. Female isolates (hermaphrodites) accounted for 96 out of 231 fertile isolates, while 135 were male-only isolates. The ratio of mating types within the population [Ne(mt)] was 99% of the count for the Brazilian population when the mating type idiomorphs were used as predictors to estimate the population size. However, when this calculation was made on the basis of the female fertile isolates, the Ne(f) was 83%. When the total population was divided by geographical/climatic regions, the frequencies of female fertile isolates were 33 out of 80 fertile isolates from the Northeast (equatorial tropical climate); 49 out of 73 fertile isolates from the Central-West (tropical climate); and only 14 out of 78 fertile isolates from the South (temperate climate), indicating that the sexual reproduction in F. verticillioides is likely favored by a tropical climate in Brazil. Brazilian populations of F. verticillioides show high fertility and high effective population size, suggesting the possibility of frequent sexual reproduction in the field, especially in populations from Tropical Climate regions of Brazil.

First Report of Root Rot on Strawberry Caused by Binucleate Rhizoctonia AG-A in Spain

Strawberry (Fragaria × ananassa Duch.) is an important crop in Spain. In January 2018, ‘Florida Fortuna’ strawberry plants exhibiting poor growth were observed in a fruit production field in Palos de la Frontera, Huelva (southwestern Spain). These plants were from nurseries in Avila Province (Spain) that had soils with a high clay content. Affected plants showed varying degrees of stunting, black necrosis on basal petioles, brown to dark-brown discoloration in roots, and few new roots emerging from the crown. Two foci were found and surveyed (six plants per focus). Petiole, crown, and root pieces of symptomatic plants were surface sterilized in 1% sodium hypochlorite for 2 min, rinsed in sterile distilled water, and air-dried in a laminar flow cabinet. Disinfested pieces were transferred to Petri dishes containing potato dextrose agar (PDA) and incubated for 7 days at 25°C. Five fungal isolates were recovered. Colonies were white to pale brown and had floccose aerial mycelia. Two isolates were purified by cutting hyphal tips from their margins. Microscopic examination showed morphological characters coinciding with Rhizoctonia (Sneh et al. 1991). Nuclear staining with acridine orange solution (20 μl/ml), prepared in acetic acid buffer, pH 7.2, for 15 min (Seema et al. 2012) showed two nuclei per cell in the hyphae of the two isolates. Mean hyphal diameter was 4.79 µm. No sclerotia were formed after 20 days on PDA at 25°C. The morphological characteristics of the isolates resembled those of binucleate Rhizoctonia (BNR). Species identity was confirmed for one isolate by sequencing the intergenic spacer (ITS) region of ribosomal DNA with the primers ITS1 and ITS4 (White et al. 1990). Identities of the resulting sequences were confirmed by BLAST analysis. The sequences were 100% identical to those of Ceratobasidium sp. AG-A KC782943 and were deposited as MH666073 in GenBank. Hyphal anastomosis tests were conducted by paring isolates with seven known tester isolates of BNR AG on 2% water agar. Anastomosis was observed with AG-A tester isolate. The isolates were identified as a BNR AG-A. To confirm the pathogenicity of the isolate, five runner strawberry plants ‘Rociera FNM’ and five ‘Rabida FNM’ were inoculated with PDA colonized plugs 1 cm in diameter located at the crown base. Five noninoculated plants were used as negative controls. Plants were grown in 200-ml pots with peat in a growth chamber at 25/22°C (day/night) with a 12-h photoperiod. Symptoms started appearing on inoculated plants 18 days after inoculation. All inoculated plants showed the same symptoms described above. Disease severity was scored as proportion of affected or senescent leaves. Inoculated ‘Rociera FNM’ plants showed 36% more affected leaves than noninoculated ones, while this difference in ‘Rabida FNM’ plants was 29%. Inoculated ‘Rociera FNM’ plants also had significantly lower dry weights (mean value: 3.91 g) than control plants (mean value: 8.02 g). The fungus was reisolated and confirmed to be Rhizoctonia sp. The BNR AG-A is one of the most common groups associated with root rot and a serious threat to strawberry production worldwide (Fang et al. 2013). To our knowledge, this is the first report of BNR AG-A causing root rot of strawberry in Spain. From now, growers will have to consider this pathogen for soil health management and for diseased plant diagnosis.

First Report of Root Rot on Strawberry Caused by Binucleate Rhizoctonia AG-K in Spain

Strawberry (Fragaria × ananassa Duch.) is an important crop in Spain. In January 2018, ‘Florida Fortuna’ strawberry plants exhibiting poor growth were observed in a fruit production field in Palos de la Frontera, Huelva (southwestern Spain). These plants were from nurseries in Avila Province (Spain) that had soils with a high clay content. Affected plants showed varying degrees of stunting, black necrosis on basal petioles, brown to dark-brown discoloration in roots, and few new roots emerging from the crown. Two foci were found and surveyed (six plants per focus). Petiole, crown, and root pieces of symptomatic plants were surface sterilized in 1% sodium hypochlorite for 2 min, rinsed in sterile distilled water, and air-dried in a laminar flow cabinet. Disinfested pieces were transferred to Petri dishes containing potato dextrose agar (PDA) and incubated for 7 days at 25°C. Five fungal isolates were recovered. Colonies were white to pale brown and had floccose aerial mycelia. Two isolates were purified by cutting hyphal tips from their margins. Microscopic examination showed morphological characters coinciding with Rhizoctonia (Sneh et al. 1991). Nuclear staining with acridine orange solution (20 μl/ml), prepared in acetic acid buffer, pH 7.2, for 15 min (Seema et al. 2012) showed two nuclei per cell in the hyphae of the two isolates. Mean hyphal diameter was 4.79 µm. No sclerotia were formed after 20 days on PDA at 25°C. The morphological characteristics of the isolates resembled those of binucleate Rhizoctonia (BNR). Species identity was confirmed for one isolate by sequencing the intergenic spacer (ITS) region of ribosomal DNA with the primers ITS1 and ITS4 (White et al. 1990). Identities of the resulting sequences were confirmed by BLAST analysis. The sequences were 100% identical to those of Ceratobasidium sp. AG-A KC782943 and were deposited as MH666073 in GenBank. Hyphal anastomosis tests were conducted by paring isolates with seven known tester isolates of BNR AG on 2% water agar. Anastomosis was observed with AG-A tester isolate. The isolates were identified as a BNR AG-A. To confirm the pathogenicity of the isolate, five runner strawberry plants ‘Rociera FNM’ and five ‘Rabida FNM’ were inoculated with PDA colonized plugs 1 cm in diameter located at the crown base. Five noninoculated plants were used as negative controls. Plants were grown in 200-ml pots with peat in a growth chamber at 25/22°C (day/night) with a 12-h photoperiod. Symptoms started appearing on inoculated plants 18 days after inoculation. All inoculated plants showed the same symptoms described above. Disease severity was scored as proportion of affected or senescent leaves. Inoculated ‘Rociera FNM’ plants showed 36% more affected leaves than noninoculated ones, while this difference in ‘Rabida FNM’ plants was 29%. Inoculated ‘Rociera FNM’ plants also had significantly lower dry weights (mean value: 3.91 g) than control plants (mean value: 8.02 g). The fungus was reisolated and confirmed to be Rhizoctonia sp. The BNR AG-A is one of the most common groups associated with root rot and a serious threat to strawberry production worldwide (Fang et al. 2013). To our knowledge, this is the first report of BNR AG-A causing root rot of strawberry in Spain. From now, growers will have to consider this pathogen for soil health management and for diseased plant diagnosis.

Aggressiveness profiling of the coffee pathogen Colletotrichum kahawae

Colletotrichum kahawae is a specialized plant pathogen of arabica coffee in Africa, able to infect green berries. The economic impact of this pathogen means there is an urgent need to better understand its pathogenic lifestyle, in particular its aggressiveness. In this study, several quantitative traits including disease severity, latent period and incubation period were measured to concomitantly assess the aggressiveness of 26 C. kahawae isolates. The results show that the area under disease progression curve is the most informative variable, particularly when joined together with the index disease intensity 10 days after inoculation and latency period, while the incubation period is not a reliable trait to distinguish aggressiveness levels in C. kahawae. This study also confirms the suitability of hypocotyls and detached green berries to perform C. kahawae aggressiveness assays, revealing that hypocotyls are a more reproducible testing material. Based on isolate profiles, three aggressiveness classes were established (high, moderate and low). A cytological analysis of representative isolates from each class showed that aggressiveness can be related to the development of post‐penetration stages, rather than conidia germination and appressoria differentiation. This study provides, for the first time, the best metrics to evaluate C. kahawae aggressiveness, characterizing the profile of a broad range of isolates, and defining a set of parameters that can be used to classify new isolates. Furthermore, the collected information will contribute to the improvement of coffee breeding programmes, through the selection of tester isolates for prescreening of resistant coffee materials, and offers the opportunity to engage on future genotype–phenotype studies.

First Report of Damping-Off on Seedlings of Coffee Caused by Rhizoctonia solani AG-4 HG I, AG-1 IB and Binucleate Rhizoctonia AG-A in China

During July 2016, damping-off of coffee (Coffea arabica L.) was observed in a coffee nursery field (∼1 ha) from Baoshan, Yunnan Province, China. More than 10% of the seedlings showed symptoms of the disease. Symptoms on newly emerged plants consisted of wilting, brown necrosis of the lower taproot, and eventual death of the seedlings. Detached infected stems of 30 coffee seedlings with damping-off were placed on water agar after surface disinfection. These stems were soaked in 75% alcohol for 1 min, then soaked in 3% sodium hypochlorite for 3 to 5 mins, and finally rinsed three times with sterile water. After culturing at 28°C for 2 days, the mycelia that had grown around the stems were transferred to potato dextrose agar (PDA) for 7 days at 28°C in the dark to obtain the isolates. Out of the 20 isolates of Rhizoctonia spp. isolated from coffee with damping-off symptoms, 16 were Rhizoctonia solani, which included 10 and six isolates that anastomosed with the tester isolates of AG-4 and AG-1, respectively. After 14 days, cultures were olive buff, producing olive-brown or white-gray sclerotia in the outer part of the disc on PDA. The other four isolates that anastomosed with the tester isolates of AG-A were binucleate Rhizoctonia spp. (BNR) isolates with white mycelia and floccose aerial hyphae on PDA. All isolates anastomosed with their corresponding tester isolates producing a C2 hyphal reaction separately (Carling 1996). The 5.8S rDNA-ITS of a single isolate from each AG of R. solani and a single isolate of BNR were sequenced. The genomic DNA of the isolates were extracted with chelex-100 method. The primers used for amplification and sequencing were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCCGCTTATTGATATGC). The sequence of the AG-4 isolate (GenBank accession no. MF288588) exhibited 100% homology with the isolate of R. solani AG-4, subgroup HG I (AY154307). The sequence from the AG-A isolate (MF288589) showed 99% homology with BNR AG-A (AB196663 and AB196640). A BLAST search of obtained sequences (MF288587) revealed the isolates that shared the highest nucleotide sequence identity (99%) with those of other AG1-IB isolates available in GenBank. Coffee seedlings (cv. Typica) (∼10 cm high) were planted in potting soil at a density of one seedling per vinyl pot (8 cm diameter, 9 cm high). Three isolates of each AG of R. solani and BNR were used in pathogenicity test. Healthy coffee seedlings were separately inoculated at the stem base with plugs of three different isolates after they had grown for 2 days on PDA, while control plants were inoculated with plugs of sterile PDA. The inoculated plugs were covered with moist cotton batting to avoid drying out, and all plants were placed in a illuminated incubator with 100% RH at 30°C, 16 h day and ∼15°C, 8 h night. The experiments were conducted three times, each time with three replicates. At 7 days after inoculation, coffee plants showed similar symptoms to naturally infected plants while the control plants were still healthy. The most virulent strain was AG-4 HG I, causing lesions >1 cm, and the second virulent strain was AG-1IB causing lesions <1 cm, while the least pathogenic was AG-A, which caused a few brown or black speck lesions on the stem. Reisolations were carried out and confirmed the presence of R. solani or BNR AG-A from the diseased plants. AG-4 has been reported to infect coffee seedlings in Portugal (Sussel et al. 2001), while diseases of coffee caused by AG-1 IB and AG-A has not been reported. However, R. solani AG-1-ID has been reported to cause necrotic leaf spot on coffee in the Philippines (Priyatmojo et al. 2001). R. solani AG-4 HG II caused damping-off in coffee seedlings in Brazil (Kuramae et al. 2000). HG II and HG I were different subgroups of R. solani AG 4. To our knowledge, this is the first report of damping-off of coffee caused by R. solani isolates belonging to AG-4 HG I and AG-1 IB, and by BNR isolates belonging to AG-A.

Mating types of Phytophthora colocasiae on the island of Upolu, Samoa

Taro leaf blight (TLB) caused by Phytophthora colocasiae is a damaging disease that destroyed Samoa’s taro industry following its introduction in 1993. The aim of this study was to determine the occurrence of the A1 and A2 mating types of P. colocasiae for a more comprehensive understanding of the risk the pathogen poses for the future of the taro industry in Samoa. In September 2015, 54 isolates of P. colocasiae were collected from taro leaf blight lesions from 13 farms around the island of Upolu, Samoa. The mating types of each isolate was determined by observation of oospore formation when paired with tester isolates of Phytophthora nicotianae of known mating types (A1 or A2). Fifty isolates were found to be A2 mating type and four did not form oospores with either mating type. No A1 or self-fertile isolates were found. These results suggest that the A1 mating type has not been introduced to the island of Upolu, preventing the formation of oospores between compatible mating types of P. colocasiae and lessening the risk of new and potentially more threatening genotypes of the pathogen from emerging through genetic recombination.&#x0D; Keywords taro leaf blight, Colocasia esculenta, taro, sexual reproduction

Vegetative compatibility groups in Colletotrichum coccodes from Turkey and their aggressiveness to potato

Black dot, caused by Colletotrichum coccodes, is a common disease of potato in Turkey, affecting tuber quality and yield. The objectives of the current study were to characterize vegetative compatibility groups (VCGs) of C. coccodes isolates from three regions in Turkey, and to assess the correlation between VCGs and aggressiveness of isolates on potato. A total of 147 C. coccodes isolates were recovered from plants showing typical black dot symptoms on stolons, roots and stems. The frequency of nitrate non‐utilizing (nit) nit1/nit3 and NitM phenotypes were 79% and 21%, respectively. Complementation between nit mutants of the isolates and eight European/Israeli EU/I‐VCG tester isolates was used to characterize the VCGs. Amongst the tested isolates, 33.3% were assigned to EU/I‐VCG6, 21.8% to EU/I‐VCG8, 15.7% to EU/I‐VCG4. EU/I‐VCG1, EU/I‐VCG3, EU/I‐VCG5 and EU/I‐VCG7 were classified at 1.4%, 3.4%, 4.8% and 5.4%, frequency, respectively. No isolate was assigned to EU/I‐VCG2 group, while 21 isolates (14.3%) were not assigned to any of the EU/I‐VCGs. The pathogenicity tests indicated significant differences in aggressiveness of the isolates with respect to sclerotia density on potato tissues. The highest densities of sclerotia on roots and crown were obtained with EU/I‐VCG6 isolates and the lowest with EU/I‐VCG1, EU/I‐VCG3 and EU/I‐VCG5 isolates. The results demonstrate that there is significant VCG diversity among C. coccodes isolates from potato plants in Turkey.

Identification of AG-V, a new anastomosis group of binucleate Rhizoctonia spp. from taro and ginger in Yunnan province

Binucleate Rhizoctonia (BNR) spp. isolates were collected from taro (Colocasia esculenta (L.) Schott) and ginger (Zingiber officinale (Willd.) Roscoe) (Yunnanxiaojiang cv.) in Yunnan province. These Yunnan (YN) isolates did not anastomose with any of the tester isolates of the known AGs of binucleate Rhizoctonia spp. The growth of YN cultures on PDA was appressed, mealy and matlike after 4 days of incubation, then turned white brown, producing brown to dark brown, irregularly shaped sclerotia were embedded in the PDA medium after 14 days. All attempts to induce basidiospore production were unsuccessful, but the length and sequence of the internal transcribed spacer (ITS1 + 5.8S rDNA + ITS2) regions of 5.8S rDNA from the YN isolates were identical in length and sequence to isolates of all the other AGs of binucleate Rhizoctonia /Ceratobasidium spp. The sequences of 5.8S rDNA-ITS from the YN isolates were unique among AGs of BNR. The YN isolates had sequence similarities of 94% with isolates of AG Fb and P, 93% with AG E, 91% with AG R, 79–94% with AG S, and 74–87% with AG A, Ba, Bb, Bo, C, DI, DII, DIII, Fa, G, H, I, K, L, O, and Q. Four isolates of AG YN caused minor virulence (lesions ≦1mm2) to ginger or taro in growth chamber studies. It was concluded that the YN isolates belong to a new anastomosis group AG-V of the Ceratobasidium spp..

Characterization and pathogenicity of Fusarium proliferatum andFusarium verticillioides, causal agents of Fusarium ear rot of corn

Fusarium ear rot is a significant disease of corn caused by several toxigenic Fusarium species including Fusarium proliferatum and Fusarium verticillioides. Forty-one Fusarium isolates were recovered from corn with Fusarium ear rot disease symptoms collected from Peninsular Malaysia. Isolates were classified into three described species known as F. proliferatum, F. verticillioides, and F. solani. Based on sexual compatibility test, four isolates from F. proliferatum (MATD-1) were crossed-fertile with tester isolate F. proliferatum D024853 (MATD-2), producing perithecia in the presence of ascospores. Meanwhile, the isolates from F. verticillioides (MATA-2) were crossed with tester isolate F. verticillioides A00149 (MATA-1), but were found producing 11 isolates with barren perithecia and three infertile isolates, whereas in 11 isolates of F. verticillioides (MATA-1), seven isolates produced barren perithecia with four nonfertile isolates. In the pathogenicity test, all isolates were found pathogenic and displayed disease symptoms with variation in severity. The highest disease severity index value was observed in F. proliferatum B68c at 4.67, which was obtained in an updated report on the mating type of F. verticillioides and F. proliferatum isolated from Fusarium ear rot disease.

New Anastomosis Group F (AG-F) of binucleate Rhizoctonia causing root and stem rot of Pistacia vera

A total of ten isolates of fungi with Rhizoctonia-like mycelia were obtained from infected roots and stems of Pistachio Pistacia vera grown in a commercial nursery in Rafsanjan, Iran, during the autumn of 2011. The infected seedlings showed symptoms of chlorosis that later turned to necrosis. All of the isolates were identified as binucleate Rhizoctonia on the basis of hyphal characteristics and nuclear number. They were tested for detection of the anastomosis group, optimum growth temperature, rDNA-ITS region traits and pathogenicity on pistachio seedlings in vitro and in vivo. The analysis of hyphal anastomosis reaction was carried out with the tester isolates of binucleate Rhizoctonia AG-A, AG-Ba, AG-G and AG-F as well as multinucleate Rhizoctonia AG4 as already detected on pistachio seedlings. The optimum temperature for growth of binucleate Rhizoctonia sp.was 35 °C. In in vivo test, the symptoms of root rot were observed 30 days after inoculation and mortality happened two weeks thereafter. According to molecular characteristics and anastomosis test groups, all isolates showed greatest similarity to anastomosis group AG-F. This finding is the first report of anastomosis group F (AG-F) of binucleate Rhizoctonia, as causal agent of root and stem rot disease of pistachio in the world and Iran.

Race spectra of Leptosphaeria maculans, the causal agent of blackleg disease of oilseed rape, in different geographic regions in northern Germany

The fungal pathogen Leptosphaeria maculans (LM), causing blackleg in oilseed rape (OSR), develops gene-for-gene interactions with OSR cultivars. Thus, virulent races can cause severe OSR yield losses in genotypes that depend only on the major resistance genes. LM race spectra were determined using 644 isolates collected from four OSR growing areas in northern Germany in autumn 2011 and 2012. Avirulence alleles (AvrLm) and race spectra of the isolates was identified with OSR cultivars harbouring the major genes Rlm1, Rlm2, Rlm3, Rlm4, Rlm7, and Rlm9. Thirteen LM races were determined, whereby 85 % of the collected isolates belonged to race AvrLm(5)-(6)-7-(8) (virulent to Rlm1–4 and Rlm9) and 10 % belonged to race AvrLm1-(5)-(6)-7-(8) (virulent to Rlm2–4 and Rlm9). Only six of 644 isolates (0.9 %) showed virulence to Rlm7. Using tester isolates that identify Rlm7, we showed that Rlm7 was absent in the most sown cultivars in northern Germany, explaining the low frequency of isolates being virulent to Rlm7. However, blackleg disease incidence (DI) increased significantly in the cultivar Exocet (harbouring Rlm7) between 2011/12 and 2012/13, whereas DI was the same in a susceptible control cultivar across all sampled regions and years. Our results show that Rlm7 is the only known major resistance gene in German OSR cultivars that is still effective against LM, but increasing deployment in commercial cultivars may foster resistance breakdown in the future.

Characterization of Field Isolates of Magnaporthe oryzae with Mating Type, DNA Fingerprinting, and Pathogenicity Assays.

Due to the harmful nature of the rice blast fungus, Magnaporthe oryzae, it is beneficial to characterize field isolates to help aid in the deployment of resistance (R) genes in rice. In the present study, 252 field isolates of M. oryzae, collected from rice fields of Yunnan Province in China, were assessed for mating type, DNA fingerprinting, and disease reactions to differential rice lines. In total, 94 isolates (37.3%) were MAT1-1 and 158 (62.7%) were MAT1-2 based on polymerase chain reaction assays, and some of them were verified with the tester isolates. All MAT1-1 and MAT1-2 isolates were virulent to some of the International Rice Research Institute-Japan International Research Center for Agricultural Sciences monogenic lines harboring 22 major resistance genes as differential varieties. Three simple-sequence repeat markers were used to examine genetic diversity in all isolates. The existence of regional patterns of genetic diversity, sexual reproduction potential, and pathogenicity suggests that M. oryzae populations have been independently asexually adapted in rice fields during crop cultivation.