First Report of Damping-Off on Seedlings of Coffee Caused by Rhizoctonia solani AG-4 HG I, AG-1 IB and Binucleate Rhizoctonia AG-A in China

Abstract

During July 2016, damping-off of coffee (Coffea arabica L.) was observed in a coffee nursery field (∼1 ha) from Baoshan, Yunnan Province, China. More than 10% of the seedlings showed symptoms of the disease. Symptoms on newly emerged plants consisted of wilting, brown necrosis of the lower taproot, and eventual death of the seedlings. Detached infected stems of 30 coffee seedlings with damping-off were placed on water agar after surface disinfection. These stems were soaked in 75% alcohol for 1 min, then soaked in 3% sodium hypochlorite for 3 to 5 mins, and finally rinsed three times with sterile water. After culturing at 28°C for 2 days, the mycelia that had grown around the stems were transferred to potato dextrose agar (PDA) for 7 days at 28°C in the dark to obtain the isolates. Out of the 20 isolates of Rhizoctonia spp. isolated from coffee with damping-off symptoms, 16 were Rhizoctonia solani, which included 10 and six isolates that anastomosed with the tester isolates of AG-4 and AG-1, respectively. After 14 days, cultures were olive buff, producing olive-brown or white-gray sclerotia in the outer part of the disc on PDA. The other four isolates that anastomosed with the tester isolates of AG-A were binucleate Rhizoctonia spp. (BNR) isolates with white mycelia and floccose aerial hyphae on PDA. All isolates anastomosed with their corresponding tester isolates producing a C2 hyphal reaction separately (Carling 1996). The 5.8S rDNA-ITS of a single isolate from each AG of R. solani and a single isolate of BNR were sequenced. The genomic DNA of the isolates were extracted with chelex-100 method. The primers used for amplification and sequencing were ITS1 (TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCCGCTTATTGATATGC). The sequence of the AG-4 isolate (GenBank accession no. MF288588) exhibited 100% homology with the isolate of R. solani AG-4, subgroup HG I (AY154307). The sequence from the AG-A isolate (MF288589) showed 99% homology with BNR AG-A (AB196663 and AB196640). A BLAST search of obtained sequences (MF288587) revealed the isolates that shared the highest nucleotide sequence identity (99%) with those of other AG1-IB isolates available in GenBank. Coffee seedlings (cv. Typica) (∼10 cm high) were planted in potting soil at a density of one seedling per vinyl pot (8 cm diameter, 9 cm high). Three isolates of each AG of R. solani and BNR were used in pathogenicity test. Healthy coffee seedlings were separately inoculated at the stem base with plugs of three different isolates after they had grown for 2 days on PDA, while control plants were inoculated with plugs of sterile PDA. The inoculated plugs were covered with moist cotton batting to avoid drying out, and all plants were placed in a illuminated incubator with 100% RH at 30°C, 16 h day and ∼15°C, 8 h night. The experiments were conducted three times, each time with three replicates. At 7 days after inoculation, coffee plants showed similar symptoms to naturally infected plants while the control plants were still healthy. The most virulent strain was AG-4 HG I, causing lesions >1 cm, and the second virulent strain was AG-1IB causing lesions <1 cm, while the least pathogenic was AG-A, which caused a few brown or black speck lesions on the stem. Reisolations were carried out and confirmed the presence of R. solani or BNR AG-A from the diseased plants. AG-4 has been reported to infect coffee seedlings in Portugal (Sussel et al. 2001), while diseases of coffee caused by AG-1 IB and AG-A has not been reported. However, R. solani AG-1-ID has been reported to cause necrotic leaf spot on coffee in the Philippines (Priyatmojo et al. 2001). R. solani AG-4 HG II caused damping-off in coffee seedlings in Brazil (Kuramae et al. 2000). HG II and HG I were different subgroups of R. solani AG 4. To our knowledge, this is the first report of damping-off of coffee caused by R. solani isolates belonging to AG-4 HG I and AG-1 IB, and by BNR isolates belonging to AG-A.