Root-knot Nematode Species Research Articles

Root-knot nematode species in Oita Prefecture and occurrence of resistance-breaking nematode populations on tomato

Root-knot nematode species in Oita Prefecture and occurrence of resistance-breaking nematode populations on tomato

Uniform Root Layer Application at Optimal Timing Can Effectively Improve Root-Knot Nematode Disease Control in Rui Yam

Root-knot nematode disease seriously threatens the production of Rui yams, making it important to explore effective management strategies, including the optimal time for disease control and efficient application techniques. In this study, we monitored the dynamics of a root-knot nematode J2 population in the soil using field sampling; moreover, we investigated the dynamics of root-knot nematode disease using a field sampling and visual in situ device based on identifying species of root-knot nematodes in Rui yams. Additionally, experiments pertaining to optimal application time and techniques were conducted in Ruichang and Nanchang. This is the first study to propose that chemical control should be optimally timed, with one application administered at the time of yam seedling flush, and another given approximately 60 days later. Applications of a 41.7% fluopyram suspension (1426 g.a.i./hm2) and a 30% fosthiazate microencapsulated suspension (2925 g.a.i./hm2) achieved disease control effects of 81.56–83.15% and 75.95–78.42%, respectively. Additionally, the comparative analysis demonstrated that using uniform root layer application technology at the optimal time produces a control effect exceeding 80%, which is significantly higher than conventional techniques such as drip irrigation and root irrigation. These results provide theoretical and technical support for the efficient control of root-knot nematode disease in Rui yams.

The Northern Root-Knot Nematode Meloidogyne hapla: New Host Records in Portugal.

Root-knot nematodes (RKNs), Meloidogyne spp., are a group of plant-parasitic nematodes (PPNs) of great economic significance worldwide. The northern root-knot nematode, Meloidogyne hapla, is one of the most important species of RKNs occurring in cold regions. In Portugal so far, M. hapla has been found parasitizing potato and fig trees. During surveys carried out in 2019-2022 in fields for horticultural and ornamental production, soil and root samples were collected. Roots were observed under a stereomicroscope to determine the presence of galls. Nematodes were extracted from the soil. Morphological features showed a high similarity and consistency with previous descriptions of the genus. For molecular analysis, total genomic DNA was isolated from single nematodes and used to amplify in multiplex reaction using the species-specific primers JMV1, JMV2 and JMVhapla, and for sequencing of the ITS region with the primers TW81/AB28. Multiplex PCR amplification produced a specific fragment of 440 bp and PCR amplification of the ITS region yielded a single fragment of 550 bp, as expected. The obtained sequences showed a similarity ranging from 99.8% to 100% with the sequences of M. hapla available in the database. The phylogenetic tree revealed that the isolates grouped with M. hapla isolates. From the 690 samples collected, M. hapla was detected in three different hosts (grapevine, eucalyptus and potato) in four districts of mainland Portugal and on Madeira Island. To our knowledge, this is the first report of M. hapla infecting the grapevine and eucalyptus in Portugal.

Distribution and prevalence of root-knot nematode species in greenhouse vegetables in northern Iraq

Bu çalışmanın amacı, Kuzey Irak’ın Süleymaniye, Erbil ve Duhok illerindeki sera sebzelerinde kök-ur nematodlarının (Meloidogyne spp.) dağılımının ve yaygınlığının belirlenmesidir. Yüz seksen yedi serada 2018 yılı Kasım ve Aralık aylarında sürvey yapılmıştır. Meloidogyne spp., perineal patternler ve esteraz fenotipi kullanılarak teşhis edilmiştir. Sürvey yapılan seraların %37’sinde Meloidogyne varlığı tespit edilmiş ve yaygınlık Süleymaniye’de %40, Duhok’da %38 ve Erbil’de %34’dür. Meloidogyne ile bulaşık seraların %64’ünde Meloidogyne javanica (Treub, 1885) ve %36’sında Meloidogyne incognita (Kofoid & White, 1919) (Tylenchida: Meloidogynidae) bulunmuştur. Sürvey yapılan ile göre, M. incognita ve M. javanica, sırasıyla Duhok’da seraların %23 ve %15’de, Erbil’de seraların %12 ve %22’de, Süleymaniye’de seraların %10 ve %30’da tespit edilmiştir. Meloidogyne spp., roka, karnabahar, hıyar, patlıcan, marul, domates ve kabakta bulunmuştur. Meloidogyne spp.’nin en yüksek yaygınlığı, çalışma alanındaki seralarda en yoğun yetiştirilen sebzeler olan hıyar (%58) ve domates (%33)’de tespit edilmiştir.

Occurrence of a new race of Meloidogyne enterolobii and avirulent M. incognita populations parasitizing cotton in western Bahia state, Brazil

Meloidogyne incognita is the root-knot nematode (RKN) species globally known to infect cotton plants, and the resistant cultivar IMA 5801B2RF has recently been released in Brazil for its control. In 2019, the first infection by M. enterolobii on resistant cotton was reported in Minas Gerais state, Brazil. In 2021, in our previous survey, this nematode species was detected again in Brazil in the municipality of São Desidério, western Bahia state on the same resistant cotton cultivar. In a continuous study, we have surveyed cotton fields from six municipalities in Bahia state, in areas supposedly cultivated with the resistant cotton; all the six populations from three different geographical origins were M. incognita, but M. enterolobii was not found again, confirming its restricted occurrence in western Bahia state. The RKN identifications were based on biochemical and molecular approaches and revealed the phenotype α-esterase Est En2 for M. enterolobii and Est I2 for M. incognita and typical SCAR patterns of these species, confirming the enzymatic identification. In soil and root analysis we detected second-stage juveniles (J2) of M. incognita in 21 samples (50% of occurrence) and Rotylenchulus reniformis in 13 samples (31%) extract from soil and roots and identified using taxonomic approaches. A bioassay with the resistant cotton cultivar in greenhouse conditions revealed a high reproduction of M. enterolobii (RF = 12.8) but did not allow reproduction of the field populations of M. incognita (RF < 1.0), showing that these populations of M. incognita were not virulent to this resistant cotton. There may have been an incorrect identification in the field cultivar and/or seed mixture in on-farm seed production. Our study provided the first report of a natural infection of a new race of M. enterolobii on cotton and highlighted the absence of virulent M. incognita populations on cotton in western Bahia state, Brazil.

Interaction Studies Between Meloidogyne Javanica and Fusarium Oxysporum f. Sp. lycopersici (Fol) Race 3 on Different Isolines of Tomato Cv. Tasti Lee.

The Mi gene in tomato confers resistance to Meloidogyne javanica, M. incognita, and M. arenaria, the most common tropical root-knot nematode (RKN) species found in Florida. Fusarium wilt (Fol) is another major problem in Florida tomatoes which may interact with RKN and cause more plant damage. To study the interactions between RKN, Fusarium, and Mi in tomato, two greenhouse experiments were conducted. Both experiments used different isolines (with and without I-3 and Mi genes) of the tomato cultivar Tasti Lee®. In the first experiment, all four isolines were subjected to two levels of RKN (~10,000 eggs/pot and no eggs) and two levels of Fol (1000 cc soil with 1,000 cfu/g at planting and no Fol), both applied at planting. In the second experiment, the two isolines without I-3 were exposed to the same two levels of RKN as described above and three levels of Fol (50 ml Fol with 1×106 cfu/m at planting, at 10 DAT, and no Fol). Fol reduced root-knot infection and reproduction when both Fol and RKN were inoculated at planting but not when Fol was inoculated 10 days later. Plant damage from Fol was exacerbated in the presence of RKN, especially when both pathogens were present at planting. Isolines with I-3 grew better in Fol-inoculated soil but had no effect when Fol and RKN were both present. Isolines with Mi gene reduced RKN infection and reproduction but did not affect plant damage caused by Fol. In summary, while RKN reproduction was reduced in the presence of Fol, the overall plant damage was more severe when both pathogens were present.

First Report of Meloidogyne enterolobii Infecting Ixora chinensis in China.

Ixora chinensis is a common flowering ornamental shrub native to China and parts of south east Asia. It has been introduced to tropical and subtropical regions of the world. In August 2021, the lab received heavily galled roots of the cutting plants from Lishui Town（23°17'1.8564"S，113°5'34.89"W), Guangdong Province, China for disease diagnosis purpose. The roots of the plants presented galls similar to those associated with root-knot nematodes (RKN), Meloidogyne spp. Upon inspection, there were one to several females of RKN in each gall, and the egg masses were often completely embedded within the gall. Males were found in the galls. Symptoms included severely reduced growth of the plants coupled with leaf yellowing. Morphological and molecular analyses were conducted to identify the species present. Females and egg masses were collected from the roots, and egg mass was incubated in water at 25°C to obtain J2. Morphological measurements from 20 second-stage juveniles and perineal patterns from 20 adult females matched the original description (Yang and Eisenback 1983). The perineal patterns were round to oval with fine and dense stripes, the dorsal arches were moderately high to high, and mostly lacking lateral lines, but when present, the lines were not conspicuous. Measurements of J2s included stylet = 13.2 ± 0.5 µm (12.4 to 14.0 µm), DGO= 51.8 ± 3.0 µm (47.0 to 56.8 µm), tail = 51.8 ± 3.0 µm (47.0 to 56.8 µm), and hyaline tail terminus = 16.0 ± 2.0 µm (11.3 to 17.7 µm). Amplification and sequencing of the rDNA-internal transcribed spacer (ITS1_5.8S_ITS2) region with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/ TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and the D2-D3 region of the 28S rDNA with primers D2A/D3B (ACAAGTACCGTG AGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Subbotin et al. 2006) was accomplished, respectively. A DNA fragment of 765 bp in length for the ITS region was obtained and the sequences (GenBank Accession Nos.OL444880-OL444882) were compared with those in GenBank using BLAST and showed 99.16%-99.87% identity with known sequences of M. enterolobii from China (MK850138, MK850135 and MT406251). The D2-D3 region sequence of the 28S rRNA (GenBank Accession Nos.OL455021-OL455023) were 99.21%-100% identical to M. enterolobill sequences obtained from China (MN017115，MN017118 and MT193450). Identification was also further confirmed by using PCR by a species-specific primer set Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). For pathogenicity tests, a single seedling (12-15 cm) from stem cutting of I. chinensis was maintained in 16-cm diameter pots with sterilized sandy loam. Six replicates were inoculated with 5000 freshly hatched J2s of the original population, and another six replicates without inoculation were established as control plants. The plants were maintained in a glasshouse at temperatures ranging from 25 to 30°C and relative humidity from 65 to 80%. After 60 days, all plants inoculated were stunted and yellowing, galling symptoms on root tips and secondary feeder root were similar to plants observed in the field, and the females and egg masses were obtained by dissecting gallsnematode. No gall symptoms were observed on control plants. These results confirmed the nematodes' pathogenicity. M. enterolobii is considered as one of the most damaging species of RKN, due to its wide host range, pathogenicity and ability to develop and reproduce on several crops carrying resistance genes (Castagnone-Sereno, 2012). To our knowledge, this is the first report of infection of M. enterolobii on I. chinensis. As cuttings are generally used for the propagation of I. chinensis, the spread of this nematode through infested soil and infected cutting seedling of I. chinensis is favored. Considering the increasing importance of the nematode in China, this report is essential for control measures of the nematode to be taken in order to avoid its spread to other regions or host crops.

Molecular Identification of Root-knot Nematode Species (Meloidogyne spp.) on Lavandin of Isparta and Burdur Provinces in Turkey

This study was conducted to identification and distribution Root-knot nematode species in lavender fields where Lavandin (Lavandula × intermedia Emeric ex Loisel. var. Super) was cultivated in an area of about 625 ha in Isparta and Burdur Provinces of Turkey. A total of 60 samples were collected in autumn of 2020. Root knot nematode species molecular identification was determined by species-specific primers from egg masses. The 17 samples taken from cultivated lavender fields were found to be infected with Root knot nematode. As a result of molecular identification, 12 of them were found to be Meloidogyne incognita, while 5 of them were found to be M. arenaria. This the first report of infestation of lavender by M. incognita in Turkey. It was determined that Keçiborlu district in Isparta Province where lavender is most cultivated was infected with Root-knot nematode. While 7 samples of M. incognita were detected in Keçiborlu district, 3 of them were M. arenaria.

The differential impact of four tropical species of root-knot nematodes (Meloidogyne spp.) on biofortified cassava

Summary Cassava plays an important food security role in Africa. Although a hardy crop in general, average yields are low, while traditional cultivars tend to be low in nutrients and vitamins. Substantial efforts have therefore been made to improve the nutritional quality of cassava through the development of biofortified cultivars. Although root-knot nematodes (RKN) are among the various important constraints affecting production, details on the impact of different species of RKN on cassava productivity are scarce. In this study, six popular cultivars of biofortified cassava were evaluated for their response to M. arenaria, M. enterolobii, M. incognita, M. javanica and a combination of all four species, in pots. All tested cultivars were susceptible to the four Meloidogyne species, but some cultivars showed a tolerance to M. arenaria infection. Galling damage was observed on feeder roots of inoculated plants, with nematode reproduction factors ranging between 2.3 and 9.5. Plant height, stem girth and fresh plant mass were significantly lower for most cultivars by as much as 70% following RKN infection. The highest root galling and damage were observed in plants following inoculation with a combination of the four species. As individual species inoculations, M. incognita and M. javanica were the most damaging, with the least damage observed in plants inoculated with M. arenaria only. These results confirm the pathogenicity of M. arenaria, M. incognita and M. javanica and further illustrate the potential of M. enterolobii to impact cassava production, while combined species infections demonstrate the greater levels of damage that these may cause.

Silencing the conserved small nuclear ribonucleoprotein SmD1 target gene alters susceptibility to root-knot nematodes in plants.

Root-knot nematodes (RKNs) are among the most damaging pests of agricultural crops. Meloidogyne is an extremely polyphagous genus of nematodes that can infect thousands of plant species. A few genes for resistance (R-genes) to RKN suitable for use in crop breeding have been identified, but virulent strains and species of RKN have emerged that render these R-genes ineffective. Secretion of RKN effectors targeting plant functions mediates the reprogramming of root cells into specialized feeding cells, the giant cells, essential for RKN development and reproduction. Conserved targets among plant species define the more relevant strategies for controlling nematode infection. The EFFECTOR18 (EFF18) protein from M. incognita interacts with the spliceosomal small nuclear ribonucleoprotein D1 (SmD1) in Arabidopsis (Arabidopsis thaliana), disrupting its function in alternative splicing regulation and modulating the giant cell transcriptome. We show here that EFF18 is a conserved RKN-specific effector that targets this conserved spliceosomal SmD1 protein in Solanaceae. This interaction modulates alternative splicing events produced by tomato (Solanum lycopersicum) in response to M. incognita infection. The alteration of SmD1 expression by virus-induced gene silencing in Solanaceae affects giant cell formation and nematode development. Thus, our work defines a promising conserved SmD1 target gene to develop broad resistance for the control of Meloidogyne spp. in plants.

First Report of Meloidogyne enterolobii Infecting Cassava (Manihot esculenta) Resulting in Root Galling Damage in Africa.

Meloidogyne enterolobii is a highly polyphagous tropical species of root knot nematode. It has been recorded to be causing major damage to a range of economically important crops and is increasingly recorded from new locations. The morphological similarity and overlap of characteristics with other commonly occurring species, especially M. incognita, has confused its diagnosis using morphometrics. Cassava (Manihot esculenta) is an important crop across the tropics, including Africa, where it is among the most important root and tuber crop for food security. Cassava can be heavily infected by root knot nematodes, which can incur heavy production losses. The main species known to affect cassava are M. incognita and M. javanica (Coyne and Affokpon, 2018). With the exception of one report of M. enterolobii morphologically identified from cassava roots during a survey in Brazil (Rosa et al., 2014), there is no record with molecular confirmation of it infecting the crop. In the absence of any molecular or isozyme confirmation, diagnosis of M. enterolobii is difficult to determine. In the current study, the species responsible for substantial galling damage (Fig. 1A) on several cassava roots growing in Ibadan, Nigeria (7°22'39″ N; 3°54'21″ E) were diagnosed. DNA isolated from juveniles recovered using a modified Baermann method (Hooper, 1986) from these roots was used for PCR amplification of the mitochondrial Nad5 using primer pair, NAD5F2 (5'-TATTTTTTGTTTGAGATATATTAG-3') and NAD5R1 (5'-CGTGAATCTTGATTTTCCATTTTT-3'). The 515 bp PCR DNA product was sequenced on both strands (GenBank Accession No. MW965454) and found to be 100% identical to M. enterolobii with those in the DNA sequence database (KU372358, KU372359) (Janssen et al., 2016; Kolombia et al., 2017). In addition, M. incognita was also recovered from the galled roots and identified using the same primers (GenBank Accession No. MW965455) indicating a combined species infection (Fig. 2). Cultures of M. enterolobii, developed from single egg masses were maintained on tomato plants and used to assess infection on cassava in 10 L pots filled with steam sterilized loam soil in the screenhouse. Cassava cv. IITA-TMS-IBA070593 cuttings planted in June, 2018 and repeated in April, 2019 were inoculated with 1,000 juveniles per pot at three weeks after planting, and then maintained for four months before quantifying the nematode densities in both roots and soil. Nematode reproduction factor (RF), calculated from total nematode densities (n=8) from soil and roots was as high as 44.3, compared to uninoculated controls. Molecular diagnostics of M. enterolobii, as above, confirms unequivocally the host status of cassava to this nematode. This study reports for the first time the infection of cassava by M. enterolobii under field conditions in Africa and for the first time demonstrates the host suitability of cassava to this nematode (Fig. 1B). M. enterolobii is among the most commonly occurring root-knot nematode species in West Africa (dos Santos et al., 2019). It is therefore anticipated that M. enterolobii has long been infecting, especially in West Africa, but has been overlooked due to its morphological similarity with M. incognita. Given the high reproductive ability of M. enterolobii on cassava and its highly aggressive nature on a range of crops, it is likely that it is causing, or will result in, high levels of losses on cassava in Africa.

Pathogenicity and control of Meloidogyne spp. on some spinach, Swiss chard, and table beet plant cultivars

The pathogenicity of the root-knot nematodes Meloidogyne arenaria, M. incognita and M. javanica on spinach cvs. ‘Balady’, ‘Barkly’, ‘Orient’, ‘Pacific’ and ‘Solanicy’, Swiss chard cvs. ‘Balady’ and ‘Ford Hook’, and table beet cvs. ‘Asgro Wonder’, ‘Balady’, ‘Detroit Dark’ and ‘Detroit Spainal’ was determined in several greenhouse tests. The results show that the tested chenopodiaceous plant cultivars were either susceptible or highly susceptible to the tested root-knot nematode species except spinach cv. ‘Pacific’ and table beet cv. ‘Asgro Wonder’ which exhibited moderately susceptible reaction to M. arenaria and M. javanica. In a separate control experiment, the pathogenicity of M. incognita on spinach cv. ‘Balady’ was studied in a greenhouse experiment. Soil treatments with dried plant materials of Monterey cypress, Brazil pepper- tree, lime and China tree induced great reductions (81.4-91.8%) in the numbers of root galls and egg masses of M. incognita on infected spinach plants. On the other hand, treatments with plant materials of blue gum tree, California pepper - tree, lantana and pomegranate gave 49.8-69.3% reduction of root galls and egg masses of M. incognita on infected spinach plants.

Root-Knot Nematode Species Associated with Horticultural Crops in the Island of Azores, Portugal

Plant-parasitic nematodes (PPN) are an economically important group of plant pests present throughout the world. In particular, root-knot nematodes (RKN), sedentary endoparasites of a wide variety of economically important hosts with the ability to survive in temperate regions. During 2020–2021 an extensive survey of Meloidogyne spp. was undertaken on the island of São Miguel Azores, Portugal. A total of 80 samples comprising 23 species of plants were collected from 13 localities in 4 districts of the island. Samples included field and greenhouse vegetable crops. Bioassays were carried out to obtain females and juveniles for morphological and biochemical characterization of the isolates. The observed morphological features showed high similarity and consistency with previous descriptions of the genus. Concerning the biochemical characterization, the esterase (EST) phenotype displayed the patterns described for M. incognita, M. arenaria, and M. javanica. Meloidogyne incognita was found to be the most prevalent species with respect to both natural host range and geographical distribution, followed by M. arenaria and M. javanica. This is the first field survey that assesses the species of root-knot nematodes associated with horticultural crops in the Azores Island, contributing additional information on the distribution of this genus.

Minc03328 effector gene downregulation severely affects Meloidogyne incognita parasitism in transgenic Arabidopsis thaliana.

Minc03328 effector gene downregulation triggered by in planta RNAi strategy strongly reduced plant susceptibility to Meloidogyne incognita and suggests that Minc03328 gene is a promising target for the development of genetically engineered crops to improve plant tolerance to M. incognita. Meloidogyne incognita is the most economically important species of root-knot nematodes (RKN) and causes severe damage to crops worldwide. M. incognita secretes several effector proteins to suppress the hostplant defense response, and manipulate the plant cell cycle and other plant processes facilitating its parasitism. Different secreted effector proteins have already been identified in M. incognita, but not all have been characterized or have had the confirmation of their involvement in nematode parasitism in their host plants. Herein, we characterized the Minc03328 (Minc3s00020g01299) effector gene, confirmed its higher expression in the early stages of M. incognita parasitism in plants, as well as theaccumulation of the Minc03328 effector protein in subventral glands and its secretion. We also discuss the potential forsimultaneous downregulation of its paralogue Minc3s00083g03984 gene. Using the in planta RNA interference strategy, Arabidopsis thaliana plants overexpressing double-stranded RNA (dsRNA) were generated tospecifically targeting and downregulating the Minc03328 geneduring nematode parasitism. Transgenic Minc03328-dsRNA lines that significantly downregulated Minc03328 gene expression during M. incognita parasitism were significantly less susceptible. The number of galls, egg masses, and [galls/egg masses] ratio were reduced in these transgenic lines by up to 85%, 90%, and 87%, respectively. Transgenic Minc03328-dsRNA lines showedthe presence of fewer and smaller galls, indicating that parasitism was hindered. Overall, data herein strongly suggest that Minc03328 effector protein is important for M. incognita parasitism establishment. As well, the in planta Minc03328-dsRNA strategy demonstrated high biotechnological potential for developing crop species that could efficiently control RKN inthe field.

First report of Meloidogyne javanica pathogenic on hybrid lavender (Lavandula ×intermedia) in the United States.

Root-knot nematodes (RKNs), Meloidogyne spp., are some of the most economically important pathogens of cultivated plants. Meloidogyne javanica is one of the most destructive RKN species and is well known for its broad host range and the severe damage it causes to plant roots (Perry et al. 2009). In Feb 2018, four mature dead and dying hybrid lavender plants (Lavandula ×intermedia 'Phenomenal') were collected in Edgefield County, South Carolina, and suspected of having Phytophthora root and crown rot (Dlugos and Jeffers 2018). Greenhouse-grown plants had been transplanted in Dec 2016 and Jan 2017 into a sandy loam soil on a site that had been fallow or in pasture for over 30 years. Some plants began to turn gray and die in summer 2017, and approximately 40% of 1230 plants were symptomatic or dead by Feb 2018. Phytophthora spp. were not isolated from the collected plants but were isolated from plants collected on subsequent visits. Instead, all four plants had small, smooth galls on the roots. Lavender roots were examined microscopically (30-70×), and egg masses of RKNs were observed on the galls. Mature, sedentary RKN females were handpicked from galled roots, and perineal patterns of 10 specimens were examined and identified as M. javanica. Juveniles and eggs were extracted from lavender roots by the method of Coolen and D'herde (1972). To confirm species identification, DNA was extracted from 10 individual juveniles, and a PCR assay was conducted using species-specific primers for M. javanica, Fjav/Rjav (Zijlstra et al. 2000). A single amplicon was produced with the expected size of approximately 720 bp, which confirmed identity as M. javanica. To determine pathogenicity, M. javanica from lavender roots were inoculated onto susceptible tomato plants for multiplication, and severe gall symptoms occurred on tomato roots 60 days later. Nematodes were extracted from tomato roots and inoculated onto healthy, rooted cuttings of 'Phenomenal' lavender plants growing in pots of soilless medium in a greenhouse. Plants were inoculated with 0, 1000, 2000, 5000, or 10000 eggs and juveniles of M. javanica. Five single-plant replicates were used for each treatment, and plants were randomized on a greenhouse bench. Plants were assessed 60 days after inoculation, and nematodes were extracted from roots and counted. The reproduction factor was 0, 43.8, 40.9, 9.1, 7.7, and 2.6 for initial nematode populations 0, 1000, 2000, 5000, and 10000, respectively, which confirmed pathogenicity (Hussey and Janssen 2002). Meloidogyne javanica also was recovered in Mar 2018 from galled roots on a 'Munstead' (L. angustifolia) lavender plant from Kentucky (provided by the Univ. of Kentucky Plant Disease Diagnostic Laboratories), and an unidentified species of Meloidogyne was isolated in Aug 2020 from a 'Phenomenal' plant grown in Florida. COI mtDNA sequences from the SC (MZ542457) and KY (MZ542458) populations were submitted to Genbank. M. javanica previously was found associated with field-grown lavender (hybrid and L. angustifolia) in Brazil, but pathogenicity was not studied (Pauletti and Echeverrigaray 2002). To our knowledge, this is the first report of M. javanica pathogenic to L. ×intermedia in the USA, and the first time RKNs have been proven to be pathogenic to Lavandula spp. following Koch's Postulates. Further studies are needed to investigate the geographic distribution of M. javanica on lavender and the potential threat this nematode poses to lavender production in the USA.

Deciphering Resistance to Root-Knot Nematodes in Prunus for Rootstock Breeding: Sources, Genetics and Characterization of the Ma Locus

Root-knot nematode (RKN) species are predominant pests of crops, attacking stone fruit crops Prunus spp. under Mediterranean climate conditions worldwide. Natural resistance for rootstock breeding is a control method that is gaining interest as an alternative to the highly toxic nematicides. This review first reports an outline of the root-knot nematodes parasitizing stone fruit crops and the Prunus species and rootstocks. It then describes the main sources of resistance detected among the Prunus germplasm and focuses on the major resistance genes identified and their characteristics (spectrum, durability, histological mechanism, effect of temperature, interaction with other pests and diseases, etc.). In peach, besides the RMia reference gene, the new genes PkMi and Mf, also located on chromosome 2, need to be characterized regarding their spectrum and relationship. The two other Prunus reference genes, Ma from plum (complete spectrum) and RMja from almond (more restricted spectrum), are orthologs that belong to a TIR-NB-LRR (TNL) cluster on chromosome 7. The review finally summarizes the positional cloning of the Ma gene and the characterization of its unique TNL structure, encompassing a five-times repeated post-LRR domain. Deciphering how this structure is functionally involved in Ma’s remarkable biological properties is a real challenge for the future.

Deciphering bacteria associated with a pre-parasitic stage of the root-knot nematode Meloidogyne hapla in nemato-suppressive and nemato-conducive soils

Nematode-suppressive soils are characterized by the ability of soil microbial communities to reduce populations of plant-parasitic nematodes (PPN) either directly or by inducing systemic resistance in plants. Various microorganisms have been recognized as antagonists of PPN in suppressive soils using culture-dependent and culture-independent methods. However, the associations that PPN form with microorganisms in nematode-conducive soils have been poorly studied. Here we drenched tomato rhizospheres with microbial suspensions from nine different soils and followed their effects on plant growth and root invasion of the infective second-stage juveniles (J2) of the northern root-knot nematode species Meloidogyne hapla. Based on the number of invaded J2, four soils were determined as nematode-suppressive, while five soils were categorized as nematode-conducive. To reveal bacteria attached to the J2 cuticle in soils with varying suppressiveness, we incubated J2 in suspensions from three suppressive and three conducive soils, and analyzed J2-attached bacteria using amplicon sequencing of the V3-V4 region of 16S rRNA gene. Our results suggest that the soil origin had a major effect on the composition of J2-attached bacteria, while the highest bacterial abundance and richness were observed on J2 from two suppressive soils. In addition, the highest number of indicator amplicon sequence variants (ASVs) was associated with J2 in two suppressive soils, but they had a very distinct bacterial profile. Further studies are needed to resolve the complexity of nemato-microbial interactions in soil and to determine the exact function of nematode-attached microorganisms in suppressive and conducive soils and their role in nematode suppression and protection.

Identification of Sweet Potato Germplasm Resistant to Pathotypically Distinct Isolates of Meloidogyne enterolobii from the Carolinas.

Meloidogyne enterolobii (syn. mayaguensis) is an emergent species of root-knot nematode that has become a serious threat to sweet potato (Ipomoea batatas) production in the southeastern United States. The most popular sweet potato cultivars grown in this region are highly susceptible to M. enterolobii. As a result, this pest has spread across most of the sweet potato growing counties in the Carolinas, threatening the industry as well as other crops in the region. The development and release of new sweet potato cultivars with resistance to M. enterolobii would help to manage and slow the spread of this pest. To support sweet potato resistance breeding efforts, 93 accessions selected from the U.S. Department of Agriculture germplasm collection and breeding programs in the United States were screened to identify 19 lines with strong resistance to M. enterolobii. The resistance in these accessions was tested against two M. enterolobii isolates that were collected from sweet potato production fields in the Carolinas. These isolates were found to have distinct pathotypes, with galling and nematode reproduction differences observed on cotton as well as sweet potato. This study is the first report of intraspecific pathotypic variation in M. enterolobii, and it identifies sweet potato germplasm with resistance against both pathogenic variants of this nematode.

Meloidogyne enterolobii development and reproduction in tomato plants treated with resistance inducers

Summary Meloidogyne enterolobii is a species capable of overcoming plant resistance moderated by the Mi-1 gene, which is effective against most species of root-knot nematode. This study evaluated the effect of induced resistance in tomato plants (Solanum lycopersicum ‘H-9553’) with the Mi-1 gene against the development and reproduction of M. enterolobii. Seedlings of tomato ‘H-9553’ were transplanted into pots, inoculated with 2000 eggs and second-stage juveniles (J2) of M. enterolobii and treated with Acibenzolar-S-Methyl, Bacillus subtilis, B. subtilis + B. licheniformis + Trichoderma longibrachiatum and extract of Reynoutria sachalinensis. The plants were collected at 5, 10, 15, 20, 25 and 30 days after inoculation (DAI) for the analyses of nematode penetration and development, and at 30 DAI for nematode reproduction. The use of B. subtilis increased fresh root weight when compared to the other treatments (20 DAI). There was a reduction in penetration of J2 in the roots of plants subjected to different resistance inducers. The population density of M. enterolobii was significantly reduced only when plants were treated with R. sachalinensis, indicating it as a potential resistance-inducing agent in tomato plants.

Genetic variation of Meloidogyne spp. of brinjal reveals their difference in pathogenicity and hatching

Brinjal (Solanum melongena L.) is an important vegetable worldwide and its production is hampered by the infestation of root-knot nematodes (Meloidogyne spp.). In an attempt to identify the Meloidogyne species involved in causing root-knot disease of brinjal by using molecular tools, plants showing knots/galls were collected from 22 brinjal growing locations that belong to different agro-ecological zones in Bangladesh. Nematode populations were maintained in a susceptible brinjal variety by inoculating with egg-masses developed on different varieties of brinjal roots collected from different locations. For molecular identification, DNA was extracted directly from galls developed in the roots of the inoculated plants. Randomly selected three galls from each location were crushed together in order to get DNA from mixed species of root-knot nematodes. Sequence Specific Amplified Region (SCAR) primers specific for Meloidogyne incognita, M. javanica or M. arenaria were used for PCR amplification. For 18 of the 22 locations, M. javanica was identified. At two locations M. incognita was found as a mixed population with M. javanica. M. arenaria was not found. PCR products were sequenced bi-directionally and their analysis revealed genetic variation among the populations. M. javanica was the predominant root-knot nematode species of brinjal in Bangladesh. Intra-specific variation of the SCAR suggested six phylogenetic groups of M. javanica. They showed significant differences in reproduction on brinjal and in their effect on root and shoot weight, while differences in hatching dynamics over five weeks were not significant. This population-dependent aggressiveness of the dominant root-knot nematode M. javanica on brinjal in Bangladesh should be considered for a more efficient management.