First Report of Meloidogyne enterolobii Infecting Ixora chinensis in China.

Abstract

Ixora chinensis is a common flowering ornamental shrub native to China and parts of south east Asia. It has been introduced to tropical and subtropical regions of the world. In August 2021, the lab received heavily galled roots of the cutting plants from Lishui Town（23°17'1.8564"S，113°5'34.89"W), Guangdong Province, China for disease diagnosis purpose. The roots of the plants presented galls similar to those associated with root-knot nematodes (RKN), Meloidogyne spp. Upon inspection, there were one to several females of RKN in each gall, and the egg masses were often completely embedded within the gall. Males were found in the galls. Symptoms included severely reduced growth of the plants coupled with leaf yellowing. Morphological and molecular analyses were conducted to identify the species present. Females and egg masses were collected from the roots, and egg mass was incubated in water at 25°C to obtain J2. Morphological measurements from 20 second-stage juveniles and perineal patterns from 20 adult females matched the original description (Yang and Eisenback 1983). The perineal patterns were round to oval with fine and dense stripes, the dorsal arches were moderately high to high, and mostly lacking lateral lines, but when present, the lines were not conspicuous. Measurements of J2s included stylet = 13.2 ± 0.5 µm (12.4 to 14.0 µm), DGO= 51.8 ± 3.0 µm (47.0 to 56.8 µm), tail = 51.8 ± 3.0 µm (47.0 to 56.8 µm), and hyaline tail terminus = 16.0 ± 2.0 µm (11.3 to 17.7 µm). Amplification and sequencing of the rDNA-internal transcribed spacer (ITS1_5.8S_ITS2) region with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/ TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992) and the D2-D3 region of the 28S rDNA with primers D2A/D3B (ACAAGTACCGTG AGGGAAAGT/TCGGAAGGAACCAGCTACTA) (Subbotin et al. 2006) was accomplished, respectively. A DNA fragment of 765 bp in length for the ITS region was obtained and the sequences (GenBank Accession Nos.OL444880-OL444882) were compared with those in GenBank using BLAST and showed 99.16%-99.87% identity with known sequences of M. enterolobii from China (MK850138, MK850135 and MT406251). The D2-D3 region sequence of the 28S rRNA (GenBank Accession Nos.OL455021-OL455023) were 99.21%-100% identical to M. enterolobill sequences obtained from China (MN017115，MN017118 and MT193450). Identification was also further confirmed by using PCR by a species-specific primer set Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). For pathogenicity tests, a single seedling (12-15 cm) from stem cutting of I. chinensis was maintained in 16-cm diameter pots with sterilized sandy loam. Six replicates were inoculated with 5000 freshly hatched J2s of the original population, and another six replicates without inoculation were established as control plants. The plants were maintained in a glasshouse at temperatures ranging from 25 to 30°C and relative humidity from 65 to 80%. After 60 days, all plants inoculated were stunted and yellowing, galling symptoms on root tips and secondary feeder root were similar to plants observed in the field, and the females and egg masses were obtained by dissecting gallsnematode. No gall symptoms were observed on control plants. These results confirmed the nematodes' pathogenicity. M. enterolobii is considered as one of the most damaging species of RKN, due to its wide host range, pathogenicity and ability to develop and reproduce on several crops carrying resistance genes (Castagnone-Sereno, 2012). To our knowledge, this is the first report of infection of M. enterolobii on I. chinensis. As cuttings are generally used for the propagation of I. chinensis, the spread of this nematode through infested soil and infected cutting seedling of I. chinensis is favored. Considering the increasing importance of the nematode in China, this report is essential for control measures of the nematode to be taken in order to avoid its spread to other regions or host crops.