First Report of Meloidogyne enterolobii on Ginger (Zingiber officinale) in China

Abstract

Ginger (Zingiber officinale) is a widely grown commercial crop in China. Extensive root galling was observed on ginger plants from one commercial field in Longhai county (24°27′58.01″S, 117°39′21.68″W), Zhangzhou region, Fujian Province in July 2016. Examination of symptomatic roots revealed one or several females of Meloidogyne sp. within each gall with egg masses protruding through the root surface. The nematode population densities in the samples ranged from 382 to 853 eggs and second stage juveniles (J2) per 5 g of fresh roots. Females and egg masses were collected from the roots, and egg masses were incubated in water at 25°C to obtain J2. The J2 tail is thin with a broad, bluntly pointed tip and a clearly defined hyaline tail terminus. Measurements of J2 (n = 20) included L = 443 ± 22.6 (417 to 478) μm, BW = 17.2 ± 2.21 (14.5 to 19.6) μm, stylet = 14.2 ± 0.7 (13.3 to 15.2) μm, DGO = 3.56 ± 0.52 (2.92 to 4.34) μm, tail = 53.7 ± 3.50 (48.6 to 60.2) μm, and hyaline tail terminus = 13.3 ± 2.45 (10.2 to 18.8) μm. For females (n = 20), stylet = 15.2 ± 1.06 (13.1 to 16.5) μm. Stylet knobs in females are divided longitudinally by a groove so that each knob appears as two. The perineal patterns are round to ovoid, with moderate to high dorsal arch and mostly lacking obvious lateral lines. Phasmids are large. Morphological characteristics from J2s and perineal patterns from adult females matched the original description of Meloidogyne enterolobii (Yang and Eisenback 1983). Species identity was further explored by sequencing the mitochondrial DNA region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/​AATTTCTAAAGACTTTTCTTAGT) (Xu et al. 2004), rDNA-internal transcribed spacer (ITS1_5.8S_ITS2) region using primers V5367/26S (TTGATTACGTCCCTGCCCTTT/​TTTCACTCGCCGTTACTAAGG) (Vrain et al. 1992), and the D2–D3 fragment of the 28S ribosomal RNA gene using primers D2A/D3B (GTACCGTGAGGGAAAGTTG/​TCGGAAGGAACCAGCTACTA) (De Ley et al. 1999). The sequences for the target genes were 841 bp (GenBank accession no. MF467278), 765 bp (MF467277), and 759 bp (MF467276), respectively. Sequence homologies were 99 to 100% identical with those in GenBank for known sequences of M. enterolobii. Species identification was further confirmed with M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/​TCAGTTCAGGCAGGATCAACC) (Long et al. 2006). A 200-bp amplification product was produced, which was previously reported only for M. enterolobii, whereas no product was amplified from control populations of M. incognita or M. javanica. In a glasshouse test, seedlings of ginger cultivar Hongya maintained in 20-cm-diameter pots were inoculated with 3,000 eggs plus J2s of the population of M. enterolobii with six replicates; noninoculated controls were included. After 10 weeks, all inoculated plants were chlorotic, galling symptoms on roots were similar to those in the field, and the nematode reproduction factor (final population/initial population) was 13.8. The noninoculated control plants grew well and had no galling symptoms on the roots. These results confirmed the nematodes’ pathogenicity. To our knowledge, this is the first record of M. enterolobii parasitizing a plant (i.e., ginger) in the family Zingiberaceae in China.