Southern Guangxi Research Articles

The Performance of New Temperature-sensitive Indica Hybrid Rice Combinations in Late Season Regional Trials in Southern Guangxi

The Performance of New Temperature-sensitive Indica Hybrid Rice Combinations in Late Season Regional Trials in Southern Guangxi

Tea planting age effects on the soil aggregation and aggregate-related organic matters, microbial biomass and activity in the southern Guangxi of China

ABSTRACT Improved knowledge of how tea planting age impacts the relationships of soil aggregates with microbial biomass and activity may help understand the mechanisms of improving soil organic matters (OM) sequestration in tea plantation ecosystem. In this study, soil samples (0–20 cm depth) were collected from tea plantations with various ages (8, 17, 25 and 43 years) in the southern Guangxi, China. Soil samples were split into > 2, 2–1, 1–0.25 and < 0.25 mm aggregates following an optimal moisture sieving procedure. Long-term tea planting was favorable to Corg and Nt accumulation in soil aggregates. However, soil aggregate-related microbial biomass (Cmic and Nmic contents) and activity (respiration rate) first increased and then decreased, and their levels were highest in the 17-year tea plantations. After 17 years of tea planting, the disintegration of > 2 mm fractions in soils might partially explain the decreases of microbial biomass and activity. Meanwhile, soil OM availability and soil acidification were also important drivers of the changes in soil microbial biomass and activity during tea planting. Hence, implementing a sustainable management scheme is critical to maintaining microbial community development after 17 years of tea planting, and thus favor nutrient cycling and energy flow in soils.

Soil aggregation and aggregate-related exchangeable base cations under different aged tea (Camellia sinensis L.) plantations in the hilly regions of southern Guangxi, China

ABSTRACT As the secondary nutrients in soils, exchangeable base cations can form cationic bridges with clay particles and organic matters to promote the formation of soil aggregates, and to protect soil organic carbon (Corg) and nutrients from loss. To have a comprehensive understanding toward the dynamics of soil exchangeable base cations in the tea planting process, it requires to evaluate these cations’ distribution in soil aggregates at various sizes. In this study, soil samples (0–20 cm) from the tea plantations at various ages (8, 17, 25, and 43 yr.) in the hilly regions of southern Guangxi, China were divided into >2, 1–2, 0.25–1, and <0.25 mm aggregate fractions through a dry-sieving procedure. Then, the cation exchange capacity (CEC), total exchangeable bases (TEB), and different individual cations, such as exchangeable potassium (K+), sodium (Na+), calcium (Ca2+), and magnesium (Mg2+), in soil aggregates were detected. Our results suggested that the mean weight diameter (MWD), that is an indicator evaluating the stability of soil aggregates, in the 17-yr. tea plantations appeared to be the highest among all the tea plantations, indicating that more stable soil aggregates could be formed in the 17-yr. tea plantations in comparison with the rest plantations. During tea planting of 35 yr. (from 8 to 43 yr.), the increasing rate of soil CEC stock was 33.42 cmol m−2 yr.−1, while the loss rates of soil exchangeable K+, Na+, Ca2+, Mg2+, and TEB were 0.89, 0.52, 3.86, 1.23, and 6.51 cmol m−2 yr.−1, respectively. Interestingly, the loss rates of soil exchangeable base cations in the middle phase (from 17 to 25 yr.) were greater than those in other phases. Therefore, it is of critical importance to implement a sustainable management scheme to maintain soil aggregate stability and to minimize the loss of soil exchangeable base cations in the tea planting process, especially after 17 yr., in the hilly regions of southern Guangxi, China.

Response of soil fertility characteristics in water-stable aggregates to tea cultivation age in hilly region of southern Guangxi, China

Research on the changes of soil aggregate-relevant organic C (Corg) and nutrients in different aged tea plantations is essential for improving our understanding of soil Corg mitigation and nutrient restitution during tea cultivation. In this study, soil Corg, total nitrogen (Ntot), available phosphorus (Pava), and the exchangeable cations (that is, potassium (K+), sodium (Na+), calcium (Ca2+), and magnesium (Mg2+)) were measured in soil aggregates (0–20 cm depth) from different aged (8-, 17-, 25-, and 43-yr.) tea plantations in the hilly region of southern Guangxi, China. Soil aggregates were divided into large macro-aggregates (>2 mm), medium macro-aggregates (2–1 mm), small macro-aggregates (1–0.25 mm), and micro-aggregates (<0.25 mm) according to a wet-sieving procedure. The tea plantations of 17-yr. were related to the highest stability of soil aggregates; meanwhile, both large macro-aggregates and micro-aggregates were the major fractions carrying soil Corg and nutrients. Long-term tea cultivation was beneficial to soil Corg, Ntot, and Pava accumulating processes; nevertheless, the increase rates of their storages were declined in the bulk soil as the tea cultivation age increased. Differently, soil exchangeable cation storages decreased with time, and the decreasing rates at the middle phase (from 17- to 25-yr.) of tea cultivation were higher than those at other phases. Hence, developing and implementing a sustainable management scheme is critical to keeping the stability of soil aggregates and maximally reducing the losses of soil exchangeable cations in the process of tea cultivation, particularly after 17-yr., in the hilly region of southern Guangxi, China.

Responses of soil aggregate-associated organic carbon and nutrients to tea cultivation age in southern Guangxi, China

Understanding the response mechanism of soil aggregate-associated organic carbon (OC) and nutrients to tea cultivation age can lay a theoretical foundation for improving soil fertility, ensuring soil health, and promoting sustainable utilization of soil resources in the tea plantations. In this study, concentrations of soil OC and nutrient were analyzed in >2, 2-1, 1-0.25, and <0.25 mm fractions (split by a dry-sieving procedure) at the 0-20 cm soil layer in four tea plantations with Baimao tea of different ages (8, 17, 25, and 43 a) in southern Guangxi, China. The distribution of soil aggregates showed that the dominant aggregates were >2 mm fractions with a mean value of 63.8%, followed by <0.25 mm fractions, while 2-1 and 1-0.25 mm fractions with mean values of 9.9% and 7.8%, respectively. As an indicator of soil aggregate stability, the mean weight diameter (MWD) in the tea plantations showed an order of 17 a >8 a >25 a >43 a. Regardless of tea cultivation age, soil aggregate-associated OC and total nitrogen (TN) concentrations increased with increasing aggregate size. Soil OC and TN concentrations in >2 and 2-1 mm fractions were significantly higher than those in other fractions. The mean values of soil OC and TN concentrations were 18.76 and 0.84 g·kg-1 in the >2 mm fractions, and were 18.65 and 0.80 g·kg-1 in the 2-1 mm fraction. Soil aggregate-associated available nitrogen (AN), available phosphorus (AP), and availa-ble potassium (AK) concentrations were highest in the <0.25 mm fractions with mean values of 50.43, 23.06, and 68.04 mg·kg-1, respectively. Long-term tea cultivation was favorable to the accumulation of soil OC, TN, AN, and AP, whereas the accumulation rates of these element stocks in the whole soil decreased with increasing tea cultivation age. In contrast, soil AK was susceptible to leaching in tea cultivation, with the loss rate of this element stock in the middle stage (from 17 to 25 a) being higher than those in the other stages. To ensure soil quality and promote the sustainable utilization of soil resources, more attention should be paid to the problems such as the decrease of soil aggregate stability and the aggravation of AK loss after 17 a of tea cultivation.

Re-examination of the Chinese record of Opisthotropis maculosa (Squamata, Natricidae), resulting in the first national record of O. haihaensis and description of a new species.

The taxonomic status of the previous record of Opisthotropis maculosa Stuart & Chuaynkern, 2007 from Guangdong and Guangxi, southern China, is revised based on the comparison of morphological and molecular data collected from the Chinese specimens and the holotype of O. maculosa from Thailand and O. haihaensis Ziegler, Pham, Nguyen, Nguyen, Wang, Wang, Stuart & Le, 2019 from Vietnam. Results reveal that the population from Shiwandashan Nature Reserve in southern Guangxi, China belongs to O. haihaensis, and represents the first national record for China; the populations from western Guangdong and southeastern Guangxi are described as a new species, Opisthotropis hungtaisp. nov. We suggest that O. maculosa should be removed from the Chinese herpetofauna checklist. The new national record of O. haihaensis and the description of the new species bring the total number of Opisthotropis to 13 in China.

REMOTE SENSING RETRIEVAL OF SOIL MOISTURE IN GUANGXI BASED ON ATI AND TVDI MODELS

Abstract. In order to further to improve the monitoring accuracy of soil moisture spatial and temporal changes in Guangxi, this paper uses MODIS, Landsat8, ASTER GDEM data and measured relative soil moisture data as data sources. According to the design idea of complementary advantages, the EVI value of Landsat8 image is partitioned, and the relative soil moisture is inverted by ATI model method in the area of EVI≤0.33, and the relative soil moisture is inverted by TVDI model in the area of EVI&gt;0.33. The apparent thermal inertia model (ATI) and the temperature vegetation drought index model (TVDI) was used to invert the relative soil moisture in Guangxi. The results show that the temporal variation of relative soil moisture in the study area in 2017 is the change cycle from rising to falling: the rising period is from January to July, and the falling period is from August to December, in which the relative soil moisture reaches the peak in July. The minimum value are December; the relative soil moisture in the north of Guangxi are generally higher than that in southern Guangxi. The correlation between the relative soil moisture value of the ATI model and the TVDI model partition retrieval and the measured relative soil moisture data is higher, and the relative soil moisture retrieval effects is better.

Genetic diversity of Procambarus clarkii populations based on mitochondrial DNA and microsatellite markers in different areas of Guangxi, China

The red swamp crayfish (Procambarus clarkii) is a famous invasive species. However, it has become one of the most important freshwater aquaculture resources in China. Herein, we focus on five artificial cultured populations of P. clarkii in Guangxi, southern China to investigate the genetic diversity based on mitochondrial DNA and microsatellites. The results revealed that the genetic diversity of P. clarkii populations in southern Guangxi (NN and DT) was lower than in central (LZ and LB) and northern (RS) Guangxi. A total of 17 haplotypes were captured from 100 individuals and haplotype 2 mainly existed, and the number of haplotype in NN and DT was less than other populations. The AMOVA showed that genetic variation was determined by within populations. The observed mismatch distribution of overall populations fit the expected distributions, indicating that no obvious demographic expansion, but unimodal was observed in RS, LZ and LB. Fst among most of groups exhibited moderate differentiation. Nevertheless, the gene flow demonstrated there had extensive gene exchanges between different populations, particularly between LZ and LB. UPGMA tree revealed that NN and DT belonged to the same clade, whereas the remaining populations were in the other clade. According to the genetic diversity, there is a need to improve the germplasm resources of P. clarkii in southern Guangxi.

New discovery of Late Pleistocene modern human teeth from Chongzuo, Guangxi, southern China

An increasing number of multidisciplinary field and laboratory projects focused on paleoanthropological sites from different areas of Asia are resulting in the discovery of many important findings. One such key area is southern China, particularly in the karst limestone caves of Guangxi Zhuang Autonomous Region, as a number of important hominin fossils have been discovered in recent years. In order to more intensively investigate the vast karst deposits of southern Guangxi, beginning in 2016 we initiated a systematic survey and excavation research program in Chongzuo City, southwest Guangxi. To date, this new field research initiative resulted in the discovery of eight new vertebrate fossil localities. One of these sites is the Yanlidong (“YLD”) cave, which in addition to yielding a rich collection of vertebrate fossils, also included the discovery of three hominin fossil teeth. Based on morphological and metric comparisons, we tentatively assigned these three teeth to modern Homo sapiens. Optically stimulated luminescence (OSL) dating of fossiliferous sediment indicate that age of these human teeth can be constrained between 30 and 65 ka. The implications of this new evidence from YLD and other nearby caves for the origin of modern humans in eastern Asia debate are discussed.

First Report of Papaya Leaf Curl China Virus on Passion Fruit in China

Papaya leaf curl China virus, a monopartite begomovirus, belongs to genus Begomovirus, family Geminiviridae. Papaya leaf curl China virus (PaLCuCNV) was originally reported on Carica papaya L. in Guangxi province of China (Wang et al. 2004). To date, the virus has been reported to infect many plants, including Carica papaya, Solanum lycopersicum, Corchoropsis timentosa, Siegesbeckia orientalis, Ageratum conyzoides, Eclipta prostrata, and Acalypha australis (Huang et al. 2006; Tang et al. 2018; Yang et al. 2011; Zhang et al. 2010; Zhang et al. 2015). Passion fruit (Passiflora spp.) is an economically important fruit crop in many tropical and subtropical regions worldwide. In recent years, two passion fruit species, the purple (Passiflora edulis Sims) and the yellow (Passiflora edulis f. flavicarpa Degener), were widely planted in southern China, including Guangdong, Guangxi, Fujian, Jiangxi, and Guizhou provinces. Until now, more than 30 plant viruses, including two begomoviruses, Euphorbia leaf curl virus and papaya leaf curl Guangdong virus, have been reported on passion fruit in several countries (Cheng et al. 2014). There are few reports on viruses infecting passion fruit in mainland China. In June 2018, plants of passion fruit were found exhibiting leaf curl, malformation on leaves, in one orchard of Ganzhou city, Jiangxi province. Two symptomatic leaf samples were collected from two diseased plants, and the total RNA was extracted from the leaf tissues using TRIzol reagent (Invitrogen, U.S.A.) according to the manufacturer’s protocol. The extracted RNA was subjected to ribosomal RNA depletion and a cDNA library constructed using a TruSeq RNA Sample Prep kit (Illumina, U.S.A.) and sequenced by an Illumina HiSeq X-ten platform. A total of 40,544,026 candidate clean reads were eventually obtained and assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). BLASTn searches of the resulting contigs revealed the presence of one virus contig of 1,027 nucleotides (nt) nearly identical (99.88%) to PaLCuCNV. To determine the complete viral genome sequence, two pairs of abutting primers were designed based on the contig. The complete DNA-A sequence of this isolate of PaLCuCNV, designated as PaLCuCNV-[China:Jiangxi:Passion fruit:2018], consists of 2,754 nt. A phylogenetic tree constructed with the full genome sequences of PaLCuCNV isolates showed the closest relationship to the PaLCuCNV Chinese (Jiangxi) isolate KP68559, which was collected from on A. conyzoides. The complete nucleotide sequence has been submitted to the GenBank database under accession number MN092343. We used PCR assay with the specific primers (β01, GGTACCACTACGCTACGCAGCAGCC; and β02, GGTACCTACCCTCCCAGGGGTACAC) to target the betasatellite DNA (Briddon et al. 2002) but did not generate any amplicon. In a brief survey, another 19 passion fruit leaf samples, which were asymptomatic, were collected from the same orchard to test for the presence of PaLCuCNV by PCR. Seven of the 19 samples tested positive for the virus. To our knowledge, this is the first report of natural occurrence of PaLCuCNV on passion fruit in China. This report indicates that passion fruit plays a possible role as a reservoir host in PaLCuCNV transmission.

Determination of Place of Residence Using the Gene Information of Plants Carried by the Human Body.

Objective To identify the plant species using the DNA sequence of plant pollen from lung tissues of a unidentified body, infer the possible long-term places of residence of the deceased according to the distribution area of the pollen in the lung tissues, therefore narrow the scope of criminal investigation and provide clues for case solving. Methods Lung tissues were extracted from the deceased, total DNA was extracted by the mCTAB method. Gene fragments of the two plant DNA barcodes, matK and rbcL, were acquired using specific primers for amplification, then sequenced. The DNA sequences of target gene fragments were acquired through bioinformatics analysis. The sequences were combined with reference sequence data. Phylogenetic analysis was made to identify the species that the DNA sequences belonged to. The places where the deceased could have lived for a long time were inferred, according to the distribution information of plant species. Results Gene fragments of 32 plant species which belonged to 31 genera of 27 families were in the lung tissues of the deceased. Among them, plants of 9 genera that had certain indicative function were mainly endemic plants from Hainan, Guangdong, Guangxi and Yunnan. These results showed that the deceased may have stayed in these areas for a long time before death. After further investigation, the victim was confirmed to have come from a county in southern Guangxi, which was in accordance with the research results. Conclusion The method of using gene information of plants from lung tissues of human bodies to infer places of residence can assist inference of the places where the deceased could have lived for a long time. The present study may also provide new ideas for locating sources of the corpses in cases with unidentified victims.

Chloroplast and nuclear DNA analyses provide insight into the phylogeography and conservation genetics of Camellia nitidissima (Theaceae) in southern Guangxi, China

Camellia nitidissima is a high-value endemic ornamental plant with a limited distribution in the south of Guangxi, China. This plant is classified as ‘vulnerable’, and the particular variety (var.) known as microcarpa is classified as ‘endangered’. In this study, we used phylogeographic analysis of one chloroplast fragment and two single-copy nuclear DNA sequences to study the genetic structure of C. nitidissima samples from nine populations distributed across four regions in Guangxi. We carried out this study to facilitate the development of appropriate conservation strategies for the protection of this plant. Analysis of nuclear DNA showed that the genetic variation in var. microcarpa was distinct from that in var. nitidissima. Chloroplast and nuclear markers showed high levels of genetic variation among three disjunct geographical regions of var. nitidissima, indicating that the current genetic structure of this variety reflects long-term isolation and limited gene flow across the regions investigated. We recommend that conservation programmes recognise var. microcarpa and that the three disjunct geographical population groups of var. nitidissima be treated as three separate management units.

Soil aggregation and aggregate-associated carbon, nitrogen, and phosphorus under different aged tea (Camellia sinensis L.) plantations in hilly region of southern Guangxi, China

To have a comprehensive understanding towards the dynamics of soil carbon (C), nitrogen (N), and phosphorus (P) during tea planting, it requires to evaluate the distribution of these elements within soil aggregates at various sizes. In this study, soil organic C (OC), labile OC (LOC), total nitrogen (TN), alkali-hydrolyzable N (AN), total P (TP), and available P (AP) had been detected within soil aggregates obtained at the 0–20 cm depth from tea plantations of various ages (8-, 17-, 25-, and 43-yr.) in hilly region of southern Guangxi, China. Soil aggregates were divided into micro-aggregates (<0.25 mm), small (1-0.25 mm), medium (2-1 mm), and large (>2 mm) macro-aggregates through a dry-sieving procedure. As main carriers of soil C, N, and P, both large macro-aggregates and micro-aggregates had relatively high stores of these elements in all of tea plantations. Tea planting age significantly influences the dynamics of C, N, and P stores in whole-soil, except for total P. During the 35-yr. of tea planting (from 8- to 43-yr.), the accumulation rates of soil OC, TN, AN, and AP were 27.91 g OC m−2 yr.-1, 0.96 g TN m−2 yr.-1, 0.06 g AN m−2 yr.-1, and 0.04 g AP m−2 yr.-1, respectively. Notably, the accumulation rates of these elements in whole-soil differed with the stage of tea planting. For example, soil OC store was increased by 54.94 g OC m-2 yr.-1 at early (from 8- to 17-yr.) stage of tea planting, while by 25.82 and 15.31 g OC m-2 yr.-1 at middle (from 17- to 25-yr.) and late (from 25- to 43-yr.) stages, respectively. Also, similar trends were observed in the TN, AN, and AP in whole-soil. Differently, soil LOC store was first increased and then decreased, and the store was significantly higher in the 17-yr. tea plantations relative to other tea plantations. These results indicated that long-term tea planting brought various benefits, such as the accumulation of soil OC, TN, AN, and AP. However, their accumulation rates in whole-soil decreased with the increase of tea planting age. In addition, it is of critical importance to develop and implement an appropriate management scheme to maintain the soil as a LOC sink after 17-yr. of tea planting in hilly region of southern Guangxi, China.

Soil aggregate-related organic carbon and relevant enzyme activities as affected by tea (Camellia sinensis L.) planting age in hilly region of southern Guangxi, China

It is essential to reveal the variations in the activities of carbon (C)-cycling enzymes in soil aggregates of different sizes, so as to shed more light on the soil organic C (Corg) dynamics in the tea plantation ecosystems. In this study, the activities of cellobiohydrolase, xylanase, β-glucosidase, and invertase were detected in soil aggregates obtained at the depth of 0–20 cm from tea plantations of various ages (8, 17, 25, and 43-yr.) in hilly region of southern Guangxi, China. Soil aggregates were divided into >2, 2–1, 1–0.25, and <0.25 mm fractions through a dry sieving procedure. This study hypothesized that the potential of soil Corg decomposition would be higher at early stage (in the initial 17-yr.) than that at late stage (after 17-yr.). Our results suggested that, irrespective of the tea planting age, soil aggregate-related Corg contents were mainly distributed in the >2 and 2–1 mm fractions, and soil aggregates at the >2 mm sizes had the highest activities of C-cycling enzymes. Notably, the C-cycling enzyme activities in soil aggregates were closely correlated with Corg availability, and Corg contents might not exert a vital part. On the other hand, tea planting for a long time could promote soil Corg to be accumulated. At early stage, the accumulated soil Corg was primarily derived from the >2 mm fractions; meanwhile, the C-cycling enzyme activities in the >2 mm fractions were also markedly elevated, indicating that the accumulated Corg in soils at early stage was more easily decomposed and showed a higher potential of decomposition than that at late stage, thus supporting our hypothesis. Overall, the youthful tea plantations in the initial 17-yr. showed an increasing trend with respect to the potential of soil Corg decomposition; however, when tea plantations became mature, the potential of soil Corg decomposition was reduced in hilly region of southern Guangxi, China.

New and little-known crickets from Southern Guangxi, China (Orthoptera: Grylloidea: Gryllidae: Phalangopsidae; Trigonidiidae).

The crickets from Southern Guangxi, China have been investigated from 2017-2019. Teleogryllus (Brachyteleogryllus) commodus and Lissotrachelus ferrugineonotatus are first reported from Guangxi. Two new species, Polionemobius marblus He sp. nov. and Ornebius panda He sp. nov., are described along with their calling songs. The COI genes of above species and Cacoplistes brevisparamerus, Gorochovius trinervus are provided. The type specimens are deposited in Museum of Biology, East China Normal University (ECNU).

Analysis and Projection of Flood Hazards over China

Floods have been experienced with greater frequency and more severity under global climate change. To understand the flood hazard and its variation in the future, the current and future flood hazards in the 21st century in China are discussed. Floods and their trends are assessed using the accumulation precipitation during heavy rainfall process (AP_HRP), which are calculated based on historical meteorological observations and the outputs of a global climate model (GCM) under three Representative Concentration Pathway (RCP) scenarios. The flood-causing HRPs counted by the flood-causing critical precipitation (the 60% fractile of AP_HRP) capture more than 70% of historical flood events. The projection results indicate that the flood hazards could increase under RCP4.5 and RCP8.5 and increase slightly under RCP2.6 during the 21st century (2011–2099). The spatial characteristics of flood hazards and their increasing trends under the three RCPs are similar in most areas of China. More floods could occur in southern China, including Guangdong, Hainan, Guangxi and Fujian provinces, which could become more serious in southeastern China and the northern Yunnan province. Construction of water conservancy projects, reservoir dredging, improvement of drainage and irrigation equipment and enhancement of flood control and storage capacity can mitigate the impacts of floods and waterlogging on agriculture.

Capacity assessment of the health laboratory system in two resource-limited provinces in China

BackgroundStrong laboratory capacity is essential for detecting and responding to emerging and re-emerging global health threats. We conducted a quantitative laboratory assessment during 2014–2015 in two resource-limited provinces in southern China, Guangxi and Guizhou in order to guide strategies for strengthening core capacities as required by the International Health Regulations (IHR 2005).MethodsWe selected 28 public health and clinical laboratories from the provincial, prefecture and county levels through a quasi-random sampling approach. The 11-module World Health Organization (WHO) laboratory assessment tool was adapted to the local context in China. At each laboratory, modules were scored 0–100% through a combination of paper surveys, in-person interviews, and visual inspections. We defined module scores as strong (> = 85%), good (70–84%), weak (50–69%), and very weak (< 50%). We estimated overall capacity and compared module scores across the provincial, prefecture, and county levels.ResultsOverall, laboratories in both provinces received strong or good scores for 10 of the 11 modules. These findings were primarily driven by strong and good scores from the two provincial level laboratories; prefecture and county laboratories were strong or good for only 8 and 6 modules, respectively. County laboratories received weak scores in 4 modules. The module, ‘Public Health Functions’ (e.g., surveillance and reporting practices) lagged far behind all other modules (mean score = 46%) across all three administrative levels. Findings across the two provinces were similar.ConclusionsLaboratories in Guangxi and Guizhou are generally performing well in laboratory capacity as required by IHR. However, we recommend targeted interventions particularly for county-level laboratories, where we identified a number of gaps. Given the importance of surveillance and reporting, addressing gaps in public health functions is likely to have the greatest positive impact for IHR requirements. The quantitative WHO laboratory assessment tool was useful in identifying both comparative strengths and weaknesses. However, prior to future assessments, the tool may need to be aligned with the new WHO IHR monitoring and evaluation framework.

A new species of Leptobrachella (Anura: Megophryidae) from southern Guangxi, China.

This study describes a new member of the genus Leptobrachella, Leptobrachella shangsiensis sp. nov., based on morphological, acoustic and molecular analyses from southern Guangxi, China. L. shangsiensis sp. nov. differs from its congeners by a combination of the following characters: (1) SVL 24.9-29.4 mm in 11 males and 30.8-35.9 mm in 5 females, (2) black supratympanic fold with dark reddish rim, (3) ventrolateral glands distinct, forming a broken line, (4) ventral surface yellowish creamy-white with marble texture, (5) iris copper in the upper and silver in the lower fifth and (6) toe webbing basal and narrow lateral fringes. The male advertisement call of L. shangsiensis sp. nov. consists of one note per call, lacking an introductory note, with a mean dominant frequency of 5.5-6.5 kHz at the ambient temperature of 21.5ºC. Uncorrected sequence divergences between L. shangsiensis sp. nov. and all homologous DNA sequences available for the 16S rRNA gene were found to be > 5.9%. L. shangsiensis sp. nov. occurs in an evergreen forest in Shiwandashan National Nature Reserve located at an elevation of 450-550 m.

Complete plastome sequence of Clinacanthus nutans (Acanthaceae): a medicinal species in Southern China

Clinacanthus nutans (Burm.f.) Lindau. is a medicinal species occurring in southern Guangdong province, Guangxi province, Hainan province and Yunnan province of China, which has been widely used in the medical field. However, its complete plastome information and systematic position are still unknown. In order to enhance the development of its medicinal value, we report and characterize the complete plastid genome sequence of C. nutans in an effort to provide genomic resources useful to promoting its medicinal value and systematic research. The complete plastome is 151,669 bp in length and contains the typical structure and gene content of angiosperm plastome, including two Inverted Repeat (IR) regions of 25,366 bp, a Large Single-Copy (LSC) region of 83,502 bp and a Small Single-Copy (SSC) region of 17,435 bp. The plastome contains 113 genes, consisting of 80 unique protein-coding genes, 29 unique tRNA gene and four unique rRNA genes (5S rRNA, 4.5S rRNA, 23S rRNA and 16S rRNA). The overall A/T content in the plastome of C. nutans is 61.60%. The complete plastome sequence of C. nutans will provide a useful resource for the conservation genetics of this species as well as for the phylogenetic studies of Acanthaceae.

Complete plastome sequence of Dillenia indica linn. (Dilleniaceae): an Endangered (EN) species in South China

Dillenia indica Linn. is an endangered plant species occurring in southern Guangxi province and Yunnan province of China, which has been grown in gardens as an ornamental plant and is widely used in the medical field. Here, we report and characterize the complete plastid genome sequence of D. indica to provide genomic resources useful for promoting its conservation. The complete plastome is 159,266 bp in length and contains the typical structure and gene content of angiosperm plastome, including two inverted repeat (IR) regions of 26,457 bp, a large single-copy (LSC) region of 88,305 bp, and a small single-copy (SSC) region of 18,047 bp. The plastome contains 115 genes, consisting of 81 unique protein-coding genes, 30 unique tRNA genes, and 4 unique rRNA genes (5S rRNA, 4.5S rRNA, 23S rRNA, and 16S rRNA). The overall A/T content in the plastome of D. indica is 63.40%. The complete plastome sequence of D. indica will provide a useful resource for the conservation genetics of this species as well as for the phylogenetic studies of Dilleniaceae.