First Report of Papaya Leaf Curl China Virus on Passion Fruit in China

Abstract

Papaya leaf curl China virus, a monopartite begomovirus, belongs to genus Begomovirus, family Geminiviridae. Papaya leaf curl China virus (PaLCuCNV) was originally reported on Carica papaya L. in Guangxi province of China (Wang et al. 2004). To date, the virus has been reported to infect many plants, including Carica papaya, Solanum lycopersicum, Corchoropsis timentosa, Siegesbeckia orientalis, Ageratum conyzoides, Eclipta prostrata, and Acalypha australis (Huang et al. 2006; Tang et al. 2018; Yang et al. 2011; Zhang et al. 2010; Zhang et al. 2015). Passion fruit (Passiflora spp.) is an economically important fruit crop in many tropical and subtropical regions worldwide. In recent years, two passion fruit species, the purple (Passiflora edulis Sims) and the yellow (Passiflora edulis f. flavicarpa Degener), were widely planted in southern China, including Guangdong, Guangxi, Fujian, Jiangxi, and Guizhou provinces. Until now, more than 30 plant viruses, including two begomoviruses, Euphorbia leaf curl virus and papaya leaf curl Guangdong virus, have been reported on passion fruit in several countries (Cheng et al. 2014). There are few reports on viruses infecting passion fruit in mainland China. In June 2018, plants of passion fruit were found exhibiting leaf curl, malformation on leaves, in one orchard of Ganzhou city, Jiangxi province. Two symptomatic leaf samples were collected from two diseased plants, and the total RNA was extracted from the leaf tissues using TRIzol reagent (Invitrogen, U.S.A.) according to the manufacturer’s protocol. The extracted RNA was subjected to ribosomal RNA depletion and a cDNA library constructed using a TruSeq RNA Sample Prep kit (Illumina, U.S.A.) and sequenced by an Illumina HiSeq X-ten platform. A total of 40,544,026 candidate clean reads were eventually obtained and assembled de novo by CLC Genomics Workbench 9.5 (Qiagen). BLASTn searches of the resulting contigs revealed the presence of one virus contig of 1,027 nucleotides (nt) nearly identical (99.88%) to PaLCuCNV. To determine the complete viral genome sequence, two pairs of abutting primers were designed based on the contig. The complete DNA-A sequence of this isolate of PaLCuCNV, designated as PaLCuCNV-[China:Jiangxi:Passion fruit:2018], consists of 2,754 nt. A phylogenetic tree constructed with the full genome sequences of PaLCuCNV isolates showed the closest relationship to the PaLCuCNV Chinese (Jiangxi) isolate KP68559, which was collected from on A. conyzoides. The complete nucleotide sequence has been submitted to the GenBank database under accession number MN092343. We used PCR assay with the specific primers (β01, GGTACCACTACGCTACGCAGCAGCC; and β02, GGTACCTACCCTCCCAGGGGTACAC) to target the betasatellite DNA (Briddon et al. 2002) but did not generate any amplicon. In a brief survey, another 19 passion fruit leaf samples, which were asymptomatic, were collected from the same orchard to test for the presence of PaLCuCNV by PCR. Seven of the 19 samples tested positive for the virus. To our knowledge, this is the first report of natural occurrence of PaLCuCNV on passion fruit in China. This report indicates that passion fruit plays a possible role as a reservoir host in PaLCuCNV transmission.