Small RNA Libraries Research Articles

Efficient small fragment sequencing of human, cattle, and bison miRNA, small RNA, or csRNA-seq libraries using AVITI

BackgroundNext-Generation Sequencing (NGS) catalyzed breakthroughs across various scientific domains. Illumina’s sequencing by synthesis method has long been central to NGS, but new sequencing methods like Element Biosciences’ AVITI technology are emerging. AVITI is reported to offer improved signal-to-noise ratios and cost reductions. However, its reliance on rolling circle amplification, which can be affected by polymer size, raises questions about its effectiveness in sequencing small RNAs (sRNAs) such as microRNAs (miRNAs), small nucleolar RNAs (snoRNAs), and many others. These sRNAs are crucial regulators of gene expression and involved in various biological processes. Additionally, capturing capped small RNAs (csRNA-seq) is a powerful method for mapping active or “nascent” RNA polymerase II transcription initiation in tissues and clinical samples.ResultsHere, we report a new protocol for seamlessly sequencing short fragments on the AVITI and demonstrate that AVITI and Illumina sequencing technologies equivalently capture human, cattle (Bos taurus), and bison (Bison bison) sRNA or csRNA sequencing libraries, increasing confidence in both sequencing approaches. Additionally, analysis of generated nascent transcription start site (TSS) data for cattle and bison revealed inaccuracies in their current genome annotations, underscoring the potential and necessity to translate small and nascent RNA sequencing methodologies to livestock.ConclusionsOur accelerated and optimized protocol bridges the advantages of AVITI sequencing with critical methods that rely on sequencing short fragments. This advance bolsters the utility of AVITI technology alongside traditional Illumina platforms, offering new opportunities for NGS applications.

MicroRNA858 represses the transcription factor gene SbMYB47 and regulates flavonoid biosynthesis in Scutellaria baicalensis.

MicroRNAs (miRNAs) are non-coding endogenous single-stranded RNAs that regulate target gene expression by reducing their transcription and translation. Several miRNAs in plants function in secondary metabolism. The dried root of Scutellaria baicalensis Georgi is a traditional Chinese medicine that contains flavonoids (baicalin, wogonoside, and baicalein) as its main active ingredients. Although the S. baicalensis genome sequence has been published, information regarding its miRNAs is lacking. In this study, 12 small RNA libraries of different S. baicalensis tissues were compiled, including roots, stems, leaves, and flowers. A total of 129 miRNAs were identified, including 99 miRNAs from 27 miRNA families and 30 predicted miRNAs. Furthermore, 46 reliable target genes of 15 miRNA families were revealed using psRNAtarget and confirmed by degradome sequencing. It was speculated that the microRNA858 (miR858)-SbMYB47 module might be involved in flavonoid biosynthesis. Transient assays in Nicotiana benthamiana leaves indicated that miR858 targets SbMYB47 and suppresses its expression. Artificial miRNA-mediated knockdown of miR858 and overexpression of SbMYB47 significantly increased the flavonoid content in S. baicalensis hairy roots, while SbMYB47 knockdown inhibited flavonoid accumulation. Yeast one-hybrid and dual-luciferase assays indicated that SbMYB47 directly binds to and activates the S. baicalensis phenylalanine ammonia-lyase 3 (SbPAL-3) and flavone synthase II (SbFNSⅡ-2) promoters. Our findings reveal the link between the miR858-SbMYB47 module and flavonoid biosynthesis, providing a potential strategy for the production of flavonoids with important pharmacological activities through metabolic engineering.

Profiling of 24-nt phasiRNAs in Rice Anther by Massively Parallel Sequencing and Stem-Loop Reverse Transcription PCR.

Small RNAs are highly abundant and play important roles in plant reproduction. Profiling of small RNAs in reproductive tissues is a critical step in understanding their biology. Here, we describe a protocol for small RNA profiling in rice anthers, with a focus on an abundantly expressed but little-understood reproductive small RNA class named 24-nucleotide phased secondary small interfering RNAs (24-nt phasiRNAs). The protocol details small RNA library preparation steps for high-throughput sequencing, with a subsequent bioinformatic analysis framework. A low-throughput stem-loop reverse transcription PCR protocol for quick semi-quantification of small RNAs is also included as a complementary approach. The collective protocol, although focused on 24-nt phasiRNAs, should be amenable to other small RNA classes in various plant reproductive tissues.

'140R' Rootstock Regulates Resveratrol Content in 'Cabernet Sauvignon' Grapevine Leaves Through miRNA.

Grafting is important for increasing the resistance of grapevines to environmental stress, improving fruit quality, and shortening the reproductive period. In this study, 'Cabernet Sauvignon' (CS) grafted on the resistant rootstock 140R (CS/140R), self-grafted grapevines of the resistant rootstock 140R (140R/140R), and self-grafted grapevines of CS (CS/CS) were subjected to high-throughput sequencing; small RNA (sRNA) libraries were constructed, and miRNAs responsive to the grafting process were identified. A total of 177 known miRNAs and 267 novel miRNAs were identified. Many miRNAs responsive to the grafting process were significantly down-regulated in CS/140R leaves relative to CS/CS leaves, such as vvi-miR171c, vvi-miR171e, et al., suggesting that the expression of these miRNAs might be affected by grafting. Kyoto Encyclopedia of Genes and Genomes analysis revealed that the differentially expressed miRNAs regulated the expression of genes in the phenylpropanoid synthesis pathway. Grapevine leaves transiently overexpressing vvi-miR171c were assayed, and the expression of the target gene, VvMYB154, and the resveratrol content were decreased, indicating that vvi-miR171c negatively regulates the expression of VvMYB154. In sum, 140R increased the resveratrol content of the scion by grafting, down-regulating the expression of vvi-miR171c. These results provide new information that will aid future analyses of the effects of grafting on the content of secondary metabolites.

First time evaluation of myocardium microRNA profile in Anderson-Fabry disease: implications in the pathological processes

Abstract Background Anderson Fabry disease (AFD) is an X-linked lysosomal disorder, characterized by progressive sphingolipid storage and organ dysfunction. Cardiac involvement is characterized by left ventricular hypertrophy, inflammation and fibrosis and is leading cause of mortality. MicroRNAs (miRNAs) are emerging as promising biomarkers in medicine, as they are dysregulated in many human diseases, offering opportunities to improve our understanding of disorders and discover new therapeutic targets. However, so far, only a few studies have evaluated the role of miRNAs in Fabry disease, and cardiac tissue miRNAs have never been assessed. Purpose To determine the specific tissue miRNA profile analyzing myocardial tissue of AFD patients and to evaluate their relationship with the severity of cardiac involvement. Methods 19 AFD patients (10 females [53%]; median age 53 years [IQR 43-63]) undergoing right ventricular endomyocardial biopsy (n=15) or surgical septal myectomy (n=4), standard cardiac magnetic resonance (1.5T, cines for maximum wall thickness (MWT) and indexed LV mass (LVMi) calculation) and high-sensitivity Troponin I (TnI) dosage were included and compared to 7 endomyocardial biopsies of controls. Myocardial samples were fixed in formalin and embedded in paraffin. RNA was extracted from 3-5 slides of tissue and used to generate small RNA libraries (Qiagen) for Next Generation Sequencing analysis on Illumina sequencer. Raw data were normalized and analyzed using DEseq2 pipeline. Correlations were performed using Pearson r; a p < 0.05 was considered statistically significant. Results In AFD group median MWT was 13 mm [IQR 8-17], LVMi was 72 g/m2 [IQR 46-97]. TnI was increased in 9 patients (47%) and NT-proBNP in 8 (42%). 6 patients were on specific AFD treatment. We identified 9 miRNAs differentially expressed in AFD patients compared to controls; miRPath analysis revealed that these miRNAs are associated to pathways involved in AFD pathogenesis (autophagy and mTOR signalling, HIF-1, apoptosis, TGF-beta signalling and inflammation) (figure 1). Moreover, we found 10 miRNAs that were differentially expressed in maximal wall thickness (<10 mm, 10-15 mm, >15 mm) groups (figure 2), in particular 3 miRNAs that progressively increased at the increasing of thickness. Among these miRNAs, miR-21-5p showed the strongest correlation with myocardial hypertrophy (r=0.869, p value<0.001 for MWT; r=0.905, p<0.001 for LVMi) and with cardiac damage (r=0.831, p<0.001 for TnI). Additionally, miR-21-5p had a modest correlation with age (r=0.518, p=0.05) and did not differ between patients on specific AFD treatment and patients not treated (p=0.660). Conclusions This study for the first time evaluated the myocardial miRNA profile in AFD patients and identified miR-21-5p as a cardiac biomarker correlating with clinical heart involvement, both in terms of left ventricular hypertrophy (MWT, LVMi) and myocardium damage (troponin).Figure 1Figure 2

Assessment of heat tolerance and identification of miRNAs during high-temperature response in grapevine.

With global warming, heat stress has been recognized as a significant factor limiting grapevine development and fruit quality. MicroRNAs (miRNAs) are a class of small non-coding RNAs known to play crucial regulatory roles in stress resistance. Hence, there is an immediate requirement to cultivate and identify grapevine varieties that are resistant to heat and explore miRNA-mediated heat stress defense mechanisms. In this study, we assessed the thermal resistance of 38 grape germplasm resources and identified a series of miRNAs involved in heat stress resistance. The CK (25°C) and HS (45°C) groups of "Shenyue" cuttings of grapes were used as experimental materials for next-generation sequencing and construct libraries of small RNAs. A total of 177 known and 20 novel miRNAs were detected in the libraries. Differential expression analysis identified 65 differentially expressed miRNAs (DEMs) using the DE-Seq procedure. Furthermore, RT-qPCR validation confirmed complementary expression profiles of eight DEMs and their target genes between the HS and CK groups. Heterologous transformation further identified the function of Vvi-miR3633a downregulated under heat stress in Arabidopsis. In the heterologous expression lines, the survival rate was reduced by high temperature treatment indicating the ability of Vvi-miR3633a to regulate heat resistance. Assessing the heat resistance of grape species and the expression patterns of miRNA in response to high temperatures may reveal the molecular processes of heat resistance regulation mediated by miRNA in grapes under heat stress.

First Report of metaplexis yellow mottle-associated virus Infecting Metaplexis japonica (Thunb.) Makino in Shandong, China.

Metaplexis japonica (Thunb.) Makino, commonly known as rough potato, has a wide distribution in China, Japan, Korea, and adjacent Russia. In China, M. japonica is a traditional herbal medicinal plant, which is also cultivated as a vegetable (Shi et al. 2020; Wei et al. 2019). In July 2023, leaves of M. japonica plants growing near a soybean field in Qingdao, Shandong province, exhibited leaf crinkling, mosaic and distorting symptoms of probable virus infection (Supplementary Figure 1). The disease incidence in a 50 m2 area was approximately 40%. To identify the suspected viral etiological agents, symptomatic leaves from 10 M. japonica plants were collected and pooled to perform small RNA deep sequencing (sRNA-Seq). TransZol Up Total RNA Extraction Kit (TransGen Biotech, Beijing, China) was used to extract total RNA. Small RNA library construction and high-throughput sequencing (HTS) were performed on Illumina NovaSeq platform by Genepioneer (Nanjing, China) (Li et al. 2024). A total of 17,384,311 raw reads were obtained. Redundant reads were removed by cutadapt software (version 1.18) to obtain 11,580,876 clean reads with 18 to 26 nucleotide (nt) sizes. The clean reads were assembled using velvet software (version 1.1.07). A total of forty-six small contigs from 42 to 283 nt were identified, with 85 to 100% nucleotide sequence identities, respectively, to metaplexis yellow mottle-associated virus (MeYMaV, genus Caulimovirus, family Caulimoviridae, accession numbers: NC_077108.1). Finally, 1,355,955 reads (11.71% mapped ratio of total reads, cover 56.7% over the MeYMaV genome) were mapped to the genome of MeYMaV by bwa software (version 0.7.17-r1188). To confirm the sRNA-Seq results, PCR was performed with specific primers MeYMaV-N-F/MeYMaV-N-R (5'-TGGTATCAGAGCCTAGTTAA-3'/5'-GGAGTTGGTAATGTATTACC-3') and MeYMaV-C-F/MeYMaV-C-R (5'-AATGGAACGGCTGTTAGTAT3'/TTAATTTCTAGCCCTTGGCTACTTAC). Both the primer pairs were designed using GenBank accession numbers: NC_077108.1 (Yang et al. 2021) to obtain the N and C terminals genome fragments of 10 MeYMaV plants. Two amplicons approximately in 4000-, and 3900-bp sizes were amplified (Supplementary Figure 2), sequenced (tsingke, Beijing, China) and aligned to obtain 7,742-nt complete MeYMaV genome sequence (Accession no. PP892524). BLASTn analysis revealed 90.16% and 92.18% sequence identity, respectively, with the MeYMaV isolate LM-Cau-A (NC_077108.1) based on complete genome and coat protein sequences, respectively. Previously, cucumber mosaic virus and MeYMaV were reported in M. japonica from Jiangsu and Liaoning provinces in China, respectively (Yang et al. 2018; 2021). To our knowledge, this is the first natural infection report of MeYMaV in M. japonica in Shandong, China. The natural occurrence of MeYMaV is not only affects the quality of M. japonica, but also poses a potential threat to surrounding crops. This study enriches information on the disease distribution of MeYMaV and will be helpful for disease management.

Integrated microRNA study and pathological analysis provides new insights into the immune response of Ruditapes philippinarum under Vibrio anguillarum challenge

Manila clam (Ruditapes philippenarum) is an important shellfish aquaculture product. The large-scale breeding of clams is often affected by V. anguillarum and causes large-scale death. However, the pathogenesis, immune response and metabolic pathway of V. anguillarum are still unclear. In this study, we found that the bacterial load in the hepatopancreas of R. philippinarum peaked at 48 h after V. anguillarum infection, and then gradually decreased, while the activity of lysozyme reached the peak at 12 h. Tissue section observation reveals that the infected hepatopancreas cells lost normal structure or necrosis. Additionally, six small RNA libraries were constructed using hepatopancreas of clams. A total of 15 differentially expressed (DE) microRNA (miRNA) were identified at 48 h after V. anguillarum infection, including 8 upregulated and 7 downregulated miRNAs. GO and KEGG enrichment results indicated the prediction of 48 known miRNAs and 127 new miRNAs, with functional annotation suggests that endocytosis pathway and bacterial recognition proteins may play key roles in immune response. The sequencing results were basically consistent with the qRT-PCR validation, indicating the accuracy of the data. This study provides a new idea to explore the immune regulation mechanism of shellfish after V. anguillarum infection, which brings important reference significance for modern immunological research.

Transcriptome-Wide Evaluation Characterization of microRNAs and Assessment of Their Functional Roles as Regulators of Diapause in Ostrinia furnacalis Larvae (Lepidoptera: Crambidae).

microRNAs (miRNAs) function as vital regulators of diapause in insects through their ability to post-transcriptionally suppress target gene expression. In this study, the miRNA of Ostrinia furnacalis, an economically important global crop pest species, was characterized. For the included analyses, 9 small RNA libraries were constructed using O. furnacalis larvae in different diapause states (non-diapause, ND; diapause, D; diapause-termination, DT). The results identified 583 total miRNAs, of which 256 had previously been identified, whereas 327 were novel. Furthermore, comparison analysis revealed that 119 and 27 miRNAs were differentially expressed in the D vs. ND and DT vs. D, respectively. Moreover, the expression patterns of their miRNAs were also analyzed. GO and KEGG analysis of the target genes of differentially expressed miRNAs highlighted the importance of these miRNAs as diapause regulators in O. furnacalis, especially through metabolic processes, endocrine processes, 20-hydroxyecdysone, and circadian clock signaling pathways. In summary, this study highlighted the involvement of specific miRNAs in the control of diapause in O. furnacalis. To the best of our knowledge, this is the first study to identify miRNA expression patterns in O. furnacalis, thereby providing reference and novel evidence enhancing our current understanding of how small RNAs influence insect diapause.

Comparison of colostrum and milk extracellular vesicles small RNA cargo in water buffalo

Recently, much interest has been raised for the characterization of signaling molecules carried by extracellular vesicles (EVs), which are particularly enriched in milk (mEVs). Such interest is linked to the capability of EVs to cross biological barriers, resist acidification in the gastric environment, and exert modulation of the immune system, mainly through their microRNA (miRNA) content. We characterized the small-RNA cargo of colostrum EVs (colosEVs) and mEVs from Italian Mediterranean buffalo through next generation sequencing. Colostrum (first milking after birth) and milk (day 50 of lactation) were sampled from seven subjects from five farms. ColosEVs and mEVs were subjected to morphological characterization, followed by high-depth sequencing of small RNA libraries produced from total RNA. The main difference was the amount of EV in the two samples, with colostrum showing 10 to 100-fold higher content than milk. For both matrices, miRNA was the most abundant RNA species (95% for colosEVs and 96% for mEVs) and three lists were identified: colosEV-specific, mEV-specific and shared most expressed. Gene ontology (GO) enrichment analysis on miRNA targets highlighted many terms related to the epigenetic, transcriptional and translational regulations across the three lists, with a higher number of enriched terms for colosEV-specific miRNAs. Terms specific to colosEVs were related to “cell differentiation” and “microvillus assembly”, while for mEV “cardiac and blood vessel development” and “mitochondria” emergerd. Immune modulation terms were found for both sample-specific miRNAs. Overall, both matrices carry a similar molecular message in terms of biological processes potentially modulated into receiving cells, but there is significant difference in the abundance, with colostrum containing much more EVs than milk. Moreover, colosEVs carry molecules involved in signal transduction, cell cycle and immune response, as for mEVs and EVs of other previously characterized species, but with a special enrichment for miRNAs with epigenetic regulation capacities. These beneficial characteristics of colosEVs and mEVs are essential for the calf and could also be exploited for the therapeutic purposes in humans, although further studies are necessary to measure the sanitization treatment impact on EV conservation, especially in buffalo where milk is consumed almost exclusively after processing.

Expression profiling of Spodoptera exigua (Lepidoptera: Noctuidae) microRNAs and microRNA core genes by Bacillus thuringiensis GS57 infection.

MicroRNAs (miRNAs) are endogenous, non-coding RNAs, which are functional in a variety of biological processes through post-transcriptional regulation of gene expression. However, the role of miRNAs in the interaction between Bacillus thuringiensis and insects remains unclear. In this study, small RNA libraries were constructed for B. thuringiensis-infected (Bt) and uninfected (CK) Spodoptera exigua larvae (treated with double-distilled water) using Illumina sequencing. Utilising the miRDeep2 and Randfold, a total of 233 known and 726 novel miRNAs were identified, among which 16 up-regulated and 34 down-regulated differentially expressed (DE) miRNAs were identified compared to the CK. Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis revealed that potential target genes of DE miRNAs were associated with ABC transporters, fatty acid metabolism and MAPK signalling pathway which are related to the development, reproduction and immunity. Moreover, two miRNA core genes, SeDicer1 and SeAgo1 were identified. The phylogenetic tree showed that lepidopteran Dicer1 clustered into one branch, with SeDicer1 in the position closest to Spodoptera litura Dicer1. A similar phylogenetic relationship was observed in the Ago1 protein. Expression of SeDicer1 increased at 72 h post infection (hpi) with B. thuringiensis; however, expression of SeDicer1 and SeAgo1 decreased at 96 hpi. The RNAi results showed that the knockdown of SeDicer1 directly caused the down-regulation of miRNAs and promoted the mortality of S. exigua infected by B. thuringiensis GS57. In conclusion, our study is crucial to understand the relationship between miRNAs and various biological processes caused by B. thuringiensis infection, and develop an integrated pest management strategy for S. exigua via miRNAs.

Circulating miR-28-5p is overexpressed in patients with sarcopenia despite long-term remission of Cushing's syndrome: a pilot study.

Patients with Cushing's syndrome (CS) in remission show sustained fatigue, myopathy, and an increased prevalence of sarcopenia. The mechanisms that determine these persistent muscle problems are not well known. We aimed to identify circulating microRNAs (miRNAs) with differential expression that could be potential biomarkers for the diagnosis and/or prognosis in CS. Thirty-six women in sustained remission for 13 ± 7 years (mean ± SD) from CS, with a median age (IQ range) of 51 (45.2-60) years and mean ± SD BMI of 27 ± 4 Kg/m2, and 36 matched healthy controls were investigated. In 7 patients sarcopenia was present according to the European Working Group on Sarcopenia in Older People (EWGSOP) criteria. Small RNA libraries were generated and indexed using a modified Illumina TruSeq small RNA-sequencing protocol. MiRNAs were identified in plasma using bioinformatic analysis, and validation was carried out using RT-qPCR. For the validation, Taqman probes were performed on QuantStudio 5 equipment (Applied Biosystems). In a first discovery group using RNA-sequencing, plasma samples of 18 CS patients and 18 healthy subjects were investigated; circulating miR-28-5p, miR-495-3p and miR-654-5p were upregulated in CS patients as compared with controls (p<0.05). In a validation study of the 3 upregulated miRNAs in 36 patients and 26 controls, no differences were observed by RT-qPCR; however, the expression of circulating miR-28-5p was upregulated in CS patients with sarcopenia as compared with those without (AUC for fold-change in the ROC analysis, 0.798; p=0.0156). The optimized cut-off value for miR-28-5p to identify CS patients with sarcopenia was 3.80, which yielded a sensitivity of 86% and a specificity of 69%. MiR-28-5p, a muscle-specific microRNA involved in myotube proliferation and differentiation in vivo, may serve as an independent non-invasive biomarker for identifying CS patients at high-risk of sarcopenia despite biochemical remission.

Analysis of Amblyomma americanum microRNAs in response to Ehrlichia chaffeensis infection and their potential role in vectorial capacity.

MicroRNAs (miRNAs) represent a subset of small noncoding RNAs and carry tremendous potential for regulating gene expression at the post-transcriptional level. They play pivotal roles in distinct cellular mechanisms including inhibition of bacterial, parasitic, and viral infections via immune response pathways. Intriguingly, pathogens have developed strategies to manipulate the host's miRNA profile, fostering environments conducive to successful infection. Therefore, changes in an arthropod host's miRNA profile in response to pathogen invasion could be critical in understanding host-pathogen dynamics. Additionally, this area of study could provide insights into discovering new targets for disease control and prevention. The main objective of the present study is to investigate the functional role of differentially expressed miRNAs upon Ehrlichia chaffeensis, a tick-borne pathogen, infection in tick vector, Amblyomma americanum. Small RNA libraries from uninfected and E. chaffeensis-infected Am. americanum midgut and salivary gland tissues were prepared using the Illumina Truseq kit. Small RNA sequencing data was analyzed using miRDeep2 and sRNAtoolbox to identify novel and known miRNAs. The differentially expressed miRNAs were validated using a quantitative PCR assay. Furthermore, a miRNA inhibitor approach was used to determine the functional role of selected miRNA candidates. The sequencing of small RNA libraries generated >147 million raw reads in all four libraries and identified a total of >250 miRNAs across the four libraries. We identified 23 and 14 differentially expressed miRNAs in salivary glands, and midgut tissues infected with E. chaffeensis, respectively. Three differentially expressed miRNAs (miR-87, miR-750, and miR-275) were further characterized to determine their roles in pathogen infection. Inhibition of target miRNAs significantly decreased the E. chaffeensis load in tick tissues, which warrants more in-depth mechanistic studies. The current study identified known and novel miRNAs and suggests that interfering with these miRNAs may impact the vectorial capacity of ticks to harbor Ehrlichia. This study identified several new miRNAs for future analysis of their functions in tick biology and tick-pathogen interaction studies.

First report of apple hammerhead viroid infecting apple trees in Montenegro.

Apple hammerhead viroid (AHVd, Pelamoviroid, Avsunviroidae) is one of the five viroids infecting apples. It has been identified on all continents except Australia since its viroid nature was confirmed (DiSerio et al. 2018; CABI and EPPO 2022). AHVd has been found in apple trees showing leaf mosaic, ringspot and dieback (Hamdi et al., 2021). Apple (Malus domestica Borkh.) and its wild relatives are traditionally grown in Montenegro. With an annual production of 7767 tons on 216 ha, it is the second most important fruit tree (after plum) in the country (Anonymous 2022). In a 2020-2022 survey, 29 apple trees exhibiting virus-like symptoms (e.g. mosaic, necrosis) were sampled throughout Montenegro, including 16 locations in eight municipalities (Podgorica, Danilovgrad, Niksic, Mojkovac, Bijelo Polje, Berane, Pljevlja and Savnik). Small RNAs were isolated using the mirVana miRNA Isolation Kit (Ambion, Life Technologies) and pooled into three bulk samples. Each bulk contained 9 to 10 samples. Libraries of sRNAs were constructed using the Ion Total RNA-Seq Kit v2 and barcoded using the Xpress RNA-Seq Barcode 1-16 Kit (Ion Torrent) according to the manufacturer's instructions. Small RNA library sequencing was performed on Illumina platform (Novogene Europe) yielding 9.9, 9.8 and 18.6 million reads in the three libraries. The CLC Genomics Workbench software was used to demultiplex the reads into pools using the 'Demultiplex Reads' tool. The online program VirusDetect (Zheng et al. 2017) was used for virus/viroid detection and identification. Besides viruses known to infect apple (apple stem grooving virus, apple stem pitting virus, apple mosaic virus), contigs mapping to AHVd were identified in all three bulks enabling full AHVd genomes reconstruction. To verify AHVd presence, all 29 apple samples were tested by reverse transcription-polymerase chain reaction (RT-PCR) using the AHVd PG13f/PG12r primers (Messmer et al. 2017). AHVd amplicons were obtained in three samples (30/21, 32/21 and 38/21) from bulk 1 and two samples (47/21 and 55/21) from bulk 2, while all samples from bulk 3 tested negative potentially due to the low titer of the pathogen or nucleotide mismatches at the 3' end of the primers. The three amplicons from bulk 1 were Sanger sequenced and partial AHVd genomes over 200 nts were obtained from two of them (30/21 and 32/21) (GenBank acc. nos. OQ863319 and OR020603). Furthermore, three full consensus AHVd genomes were assembled in Geneious Prime by mapping Sanger sequences onto contigs from Virus Detect and named 30/21, 32/21 and 38/21 (acc. nos. PP133245, -46, and -47, respectively). All three genomes exhibited conserved hammerhead motifs (Messmer et al. 2017). In BLASTn analysis, the isolate 30/21 from Montenegro shared the highest nt identity (98.8%) with the isolate SA-36 (ON564299) from Czechia, while 32/21 and 38/21 showed the highest identities (95.4% and 92.3%) with isolates SD17_2-3 (MK188691) from Canada and JF2 (ON564298) from Czechia, respectively. To the best of our knowledge, this is the first report of AHVd infecting Malus domestica in Montenegro. The AHVd-positive samples 30/21 and 32/21 originated from at least two-decade-old apple trees from Niksic, whilst 38/21 came from a 40-year-old tree from Mojkovac district, suggesting that this viroid has long been present in different parts of the country. The AHVd discovery in Montenegro should be considered in any phytosanitary regulations and pome fruit certification program in the country.

Fine-needle aspiration technique under endoscopic ultrasound guidance: A technical approach for RNA profiling of pancreatic neoplasms.

Early diagnosis of pancreatic ductal adenocarcinoma (PDAC) has been a longstanding challenge. The prognosis of patients with PDAC depends on the stage at diagnosis. It is necessary to identify biomarkers for the detection and differentiation of pancreatic tumors and optimize PDAC sample preparation procedures for DNA and RNA analysis. Most molecular studies are done using paraffin-embedded blocks; however, the integrity of DNA and RNA is often compromised in this format. Moreover, RNA isolated from human pancreatic tissue samples is generally of low quality, in part, because of the high concentration of endogenous pancreatic RNAse activity present. To assess the potential of endoscopic ultrasound-guided fine-needle aspiration (EUS-FNA) to obtain specimens from pancreatic neoplasms for subsequent RNA molecular profiling, including next-generation sequencing (NGS). Thirty-four EUS-FNA samples were included in this study: PDAC (n = 15), chronic pancreatitis (n = 5), pancreatic cysts (n = 14), mucinous cysts (mucinous cystic neoplasia/intraductal papillary mucinous neoplasia) n = 7, serous cystic neoplasms n = 5, and pseudocysts n = 2. Cyst material consisted of cyst fluid and cyst wall samples obtained by through-the-needle biopsy (TTNB). Samples were stored at -80 °C until analysis. RNA purity (A260/230, A260/280 ratios), concentration, and integrity (RIN) were assessed. Real-time polymerase chain reaction was conducted on all samples, and small RNA libraries were prepared from solid mass samples. RNA was successfully extracted from 29/34 (85%) EUS-FNA samples: 100% pancreatic adenocarcinoma samples, 100% chronic pancreatitis samples, 70% pancreatic fluid cyst samples, and 50% TTNB samples. The relative expression of GAPDH and HPRT were obtained for all successfully extracted RNA samples (n = 29) including low-quality RNA specimens. Low concentration and nonoptimal RIN values (no less than 3) of RNA extracted from EUS-FNA samples did not prevent NGS library preparation. The suitability of cyst fluid samples for RNA profiling varied. The quality of RNA extracted from mucinous cyst fluid had a median RIN of 7.7 (5.0-8.2), which was compatible with that from solid neoplasms [6.2 (0-7.8)], whereas the quality of the RNA extracted from all fluids of serous cystic neoplasms and TTNB samples had a RIN of 0. The results demonstrate the high potential of EUS-FNA material for RNA profiling of various pancreatic lesions, including low-quality RNA specimens.

Efficient small fragment sequencing of human, cow, and bison miRNA, small RNA or csRNA-seq libraries using AVITI.

Next-Generation Sequencing (NGS) catalyzed breakthroughs across various scientific domains. Illumina's sequencing by synthesis method has long been essential for NGS but emerging technologies like Element Biosciences' sequencing by avidity (AVITI) represent a novel approach. It has been reported that AVITI offers improved signal-to-noise ratios and cost reductions. However, the method relies on rolling circle amplification which can be impacted by polymer size, raising questions about its efficacy sequencing small RNAs (sRNA) molecules including microRNAs (miRNAs), piwi-interacting RNAs (piRNAs), and others that are crucial regulators of gene expression and involved in various biological processes. In addition, capturing capped small RNAs (csRNA-seq) has emerged as a powerful method to map active or "nascent" RNA polymerase II transcription initiation in tissues and clinical samples. Here, we report a new protocol for seamlessly sequencing short DNA fragments on the AVITI and demonstrate that AVITI and Illumina sequencing technologies equivalently capture human, cattle (Bos taurus) and the bison (Bison bison) sRNA or csRNA sequencing libraries, augmenting the confidence in both approaches. Additionally, analysis of generated nascent transcription start sites (TSSs) data for cattle and bison revealed inaccuracies in their current genome annotations and highlighted the possibility and need to translate small RNA sequencing methodologies to livestock. Our accelerated and optimized protocol therefore bridges the advantages of AVITI sequencing and critical methods that rely on sequencing short DNA fragments.

Identifying quantitative sncRNAs signature using global sequencing as a potential biomarker for tuberculosis diagnosis and their role in regulating host response

ObjectivesThe study aimed to identify a quantitative signature of circulating small non-coding RNAs (sncRNAs) as a biomarker for pulmonary tuberculosis disease (active-TB/ATB) and explore their regulatory roles in host-pathogen interactions and disease progression. MethodsWe conducted a cross-sectional study recruiting subjects diagnosed with active-TB (drug-sensitive and drug-resistant) and healthy controls. Sera samples were collected and utilized for preparing small RNA libraries. Quantitative patterns of circulating sncRNAs (miRNAs, piRNAs and tRFs) were identified via high-throughput sequencing and DeSeq2 analysis and validated in independent active-TB cohorts. Functional knockdown for two selected miRNAs were also performed. ResultsA diagnostic signature of four sncRNAs for both drug-sensitive and drug-resistant active-TB cases was validated, exhibiting an AUC of 0.96 (95% CI: 0.937–0.996, p < 0.001) with 86.7% sensitivity (95% CI: 0.775–0.932) and 91.7% specificity (95% CI: 0.730–0.990) in ROC analysis. Functional knockdown demonstrated regulatory roles of hsa-miR-223-5p and hsa-miR-10b-5p in Mycobacterium tuberculosis (Mtb) growth and pro-inflammatory cytokine expression (IL-6 and IL-8). ConclusionThe study identified a diagnostic tool utilizing a signature of four sncRNAs with high specificity and sensitivity, enhancing our understanding of sncRNAs as ATB diagnostic biomarker. Additionally, hsa-miR-223-5p and hsa-miR-10b-5p demonstrated potential roles in Mtb pathogenesis and host-response to infection.

Effects of miR-306 Perturbation on Life Parameters in the English Grain Aphid, Sitobion avenae (Homoptera: Aphididae).

MicroRNAs (miRNA) play a vital role in insects' growth and development and have significant potential value in pest control. Previously, we identified miR-306 from small RNA libraries within the English grain aphid, Sitobion avenae, a devasting insect pest for wheat. miR-306 not only involves in wing morphogenesis, but also is critically important for aphid survival. Its specific impacts on the life history traits, however, remain unclear. Here, we evaluate the impact of miR-306 perturbation on S. avenae populations using a two-sex life table approach. This comprehensive analysis revealed that miR-306 perturbation significantly prolongs the developmental stages (9.64% and 8.20%) and adult longevity of S. avenae, while decreasing pre-adult survival rate (41.45% and 38.74%) and slightly reducing average fecundity (5.80% and 13.05%). Overall, miR-306 perturbation negatively affects the life table parameters of the aphid population. The population prediction models show a significant decline in the aphid population 60 days post interference, compared to the control groups (98.14% and 97.76%). Our findings highlight the detrimental effects of miR-306 perturbation on S. avenae population growth and suggest potential candidate genes for the development of RNAi-based biopesticides targeted specifically at this pest species.

MiRNA-seq provides novel insight into the response to hyper- and hypo- salinity acclimation in Crassostrea hongkongensis

The Hong Kong oyster, Crassostrea hongkongensis, is a significant bivalve species with economic importance. It primarily inhabits the estuarine intertidal zones in southern China, making it susceptible to salinity fluctuations. Consequently, investigating the molecular mechanisms governing salinity regulation in C. hongkongensis is essential. In this study, we conducted miRNA-seq on C. hongkongensis to compare miRNA expression differences under varying salinities (5‰, 25‰, and 35‰). The miRNA sequencing revealed 51 known miRNAs and 95 novel miRNAs across nine small RNA libraries (S5, S25, and S35). Among these miRNAs, we identified 6 down-regulated differentially expressed (DE) miRNAs in response to hypo-salinity stress (5‰), while 1 up-regulated DE miRNA and 5 down-regulated DE miRNAs were associated with hyper-salinity stress (35‰). Additionally, we predicted 931 and 768 potential target genes for hypo- and hyper-salinity stress, respectively. Functional gene annotation indicated that the target genes under hypo-salinity stress were linked to vesicle-mediated transport and metal ion binding. Conversely, those under hyper-salinity stress were primarily involved in signal transduction and metabolic processes. These findings have provided insights into the regulatory role of miRNAs, their potential target genes and associated pathways in oyster hypo- and hyper-salinity stress, which establish a foundation for future studies on the roles of miRNAs in salinity acclimation mechanisms in C. hongkongensis.

Identification of the Coexisting Virus-Derived siRNA in Maize and Rice Infected by Rice Black-Streaked Dwarf Virus.

Rice black-streaked dwarf virus is transmitted by small brown planthoppers, which causes maize rough dwarf disease and rice black-streaked dwarf disease. This virus leads to slow growth or death of the host plants. During the coevolutionary arms race between viruses and plants, virus-derived small interfering RNAs (vsiRNAs) challenge the plant's defense response and inhibit host immunity through the RNA silencing system. However, it is currently unknown if rice black-streaked dwarf virus can produce the same siRNAs to mediate the RNA silencing in different infected species. In this study, four small RNA libraries and four degradome libraries were constructed by extracting total RNAs from the leaves of the maize (Zea mays) inbred line B73 and japonica rice (Oryza sativa) variety Nipponbare exposed to feeding by viruliferous and nonviruliferous small brown planthoppers. We analyzed the characteristics of small RNAs and explored virus-derived siRNAs in small RNA libraries through high-throughput sequencing. On analyzing the characteristics of small RNA, we noted that the size distributions of small RNAs were mainly 24 nt (19.74 to 62.00%), whereas those of vsiRNAs were mostly 21 nt (41.06 to 41.87%) and 22 nt (39.72 to 42.26%). The 5'-terminal nucleotides of vsiRNAs tended to be adenine or uracil. Exploring the distribution of vsiRNA hot spots on the viral genome segments revealed that the frequency of hotspots in B73 was higher than those in Nipponbare. Meanwhile, hotspots in the S9 and S10 virus genome segments were distributed similarly in both hosts. In addition, the target genes of small RNA were explored by degradome sequencing. Analyses of the regulatory pathway of these target genes unveiled that viral infection affected the ribosome-related target genes in maize and the target genes in the metabolism and biosynthesis pathways in rice. Here, 562 and 703 vsiRNAs were separately obtained in maize and rice and 73 vsiRNAs named as coexisting vsiRNAs (co-vsiRNAs) were detected in both hosts. Stem-loop PCR and real-time quantitative PCR confirmed that co-vsiRNA 3.1 and co-vsiRNA 3.5, derived from genome segment S3, simultaneously play a role in maize and rice and inhibited host gene expression. The study revealed that rice black-streaked dwarf virus can produce the same siRNAs in different species and provides a new direction for developing new antiviral strategies.