Small RNA Libraries Research Articles

Post-transcriptional regulation of frog innate immunity: discovery of frog microRNAs associated with antiviral responses and ranavirus infection using a Xenopus laevis skin epithelial-like cell line

Post-transcriptional regulators such as microRNAs are emerging as conserved regulators of innate antiviral immunity in vertebrates, yet their roles in amphibian antiviral responses remain uncharacterized. We profiled changes in microRNA expressions in the Xenopus laevis skin epithelial-like cell line Xela DS2 in response to poly(I:C)—an analogue of viral double-stranded RNA and inducer of type I interferons—or frog virus 3 (FV3), an immunoevasive virus associated with amphibian mortality events. Small RNA libraries generated from untreated, poly(I:C)-treated, and FV3-infected cells were sequenced. We detected 136 known X. laevis microRNAs and discovered 133 novel X. laevis microRNAs. Sixty-five microRNAs were differentially expressed in response to poly(I:C), many of which were predicted to target regulators of antiviral pathways such as cGAS-STING, RIG-I/MDA-5, TLR signaling, and type I interferon signaling, as well as products of these pathways (NF-ĸB-induced and interferon-stimulated genes). In contrast, only 49 microRNAs were altered by FV3 infection, fewer of which were predicted to interact with antiviral pathways. Interestingly, poly(I:C) treatment or FV3 infection downregulated transcripts encoding factors of the host microRNA biogenesis pathway. Our study is the first to suggest that host microRNAs regulate innate antiviral immunity in frogs and sheds light on microRNA-mediated mechanisms of immunoevasion by FV3.

Phospho-RNAseq Profiling of Extracellular mRNAs and lncRNAs.

Extracellular RNAs (exRNAs) in biofluids have attracted great interest as potential biomarkers. Although extracellular microRNAs in blood plasma are extensively characterized, extracellular messenger RNA (mRNA) and long noncoding RNA (lncRNA) studies are limited. We have recently reported that human plasma contains fragmented mRNAs and lncRNAs that are missed by standard small RNA-seq protocols due to lack of 5'phosphate or presence of 3'phosphate. Here, we describe a modified protocol for preparation of small RNA libraries for next generation sequencing called "phospho-RNA-seq." This protocol has been optimized for use with low-input exRNA-containing samples, such as plasma or serum, and has modifications introduced to capture extracellular RNA with varied 5'and 3'ends.

Identification of microRNA-like RNAs in Cordyceps guangdongensis and their expression profile under differential developmental stages

Cordyceps guangdongensis is a well-known fungus with high nutritional and medicinal value. The metabolite profile of C. guangdongensis is similar to that of Ophiocordyceps sinensis. In plants and animals, microRNAs play important roles in regulating gene expression at the post-transcriptional level. MicroRNA-like RNAs (milRNAs) have been documented in several macro-fungi. To comprehensively investigate the milRNAs in C. guangdongensis, three small RNA libraries from the differentially developmental stages were constructed. Twenty-six conserved milRNAs were identified, and 19 novel milRNA candidates were predicted. Among them, 20 milRNAs were differentially expressed across the developmental processes, and 12 milRNAs were verified using stem-loop quantitative real-time reverse transcription polymerase chain reaction. In addition, the potential target genes of milRNA were predicted to be involved in the development of fruiting bodies and metabolite biosynthesis. This study is the first to report the milRNAs of C. guangdongensis, and provides important insights into studies of milRNA regulation pathways in ascomycete fungi.

Identification and functional analysis of microRNAs in the regulation of summer diapause in Galeruca daurica

MicroRNAs (miRNAs) regulate gene expression at the post-transcriptional level. Although the regulatory roles of miRNAs in various physiological processes throughout insect development have been investigated, it is almost unknown about the roles of miRNAs involved in regulation of diapause in insects. We constructed nine small RNA libraries from Galeruca daurica adults at different diapause stages: pre-diapause (PD), diapause (D), and post-diapause (TD). Using Illumina sequencing, a total of 95.06 million valid reads was obtained, and 222 miRNAs, including 135 conserved and 87 novel miRNAs, were identified from G. daurica. The expression profiles of these miRNAs were analyzed across different diapause stages. The 30 and 13 miRNAs were differentially expressed in the D/PD and TD/D comparisons, respectively. The KEGG and GO analysis of the predicted target genes suggested the essential roles of miRNAs in the regulation of summer diapause in G. daurica, especially via the juvenile hormone, ribosome, MAPK signaling, and Ca2+ signaling pathways. Our research results indicate that miRNAs may be involved in the regulation of summer diapause in G. daurica, and these results also provide an important new small RNA genomics resource for further studies on insect diapause.

Hormonal regulation of microRNA expression dynamics in the gut of the yellow fever mosquito Aedes aegypti

ABSTRACT The yellow fever mosquito Aedes aegypti is an obligatory blood feeder and a major arboviral disease vector, evoking severe public health concerns worldwide. In adult female mosquitoes, the gut is critical for blood digestion and pathogen entry. We aimed for a systematic exploration of microRNA expression dynamics in the gut during the gonadotrophic cycle. Small RNA libraries were constructed from female mosquito gut tissues at five time points. Unsupervised hierarchical clustering revealed three expression clusters (early, mid and late) peaking at sequential time points – 24, 48 and 72 h posteclosion. Differentially expressed miRNAs were identified at 24 h post-blood meal (PBM). Depletions of Methoprene-tolerant [Met; the juvenile hormone (JH) receptor] and Ecdysone receptor [EcR; the receptor to 20-hydroxyecdysone (20E)] were performed using dsRNA to these genes to investigate impacts on microRNA expressions. Our results suggest that Met-mediated signalling downregulates miRNA expression from the early cluster and upregulates that from the late cluster. EcR signalling either up- or downregulated miRNA levels at 24 h PBM, indicating a differential effect of this receptor in miRNA gene expression. Furthermore, miR-281, which is the most abundant miRNA in the gut tissue, is induced and repressed by Met- and EcR-mediated signalling, respectively. Systematic depletion using synthetic antagomir and phenotype examinations indicate that miR-281 is obligatory for the normal progression of blood digestion, ovarian development and reproduction. Collectively, this study unveils expression dynamics of microRNAs in the female gut tissue during the gonadotrophic cycle and demonstrates that they are affected by JH and 20E signalling.

Identification and Analysis of MicroRNAs Associated with Wing Polyphenism in the Brown Planthopper, Nilaparvata lugens.

Many insects are capable of developing two types of wings (i.e., wing polyphenism) to adapt to various environments. Though the roles of microRNAs (miRNAs) in regulating animal growth and development have been well studied, their potential roles in modulating wing polyphenism remain largely elusive. To identify wing polyphenism-related miRNAs, we isolated small RNAs from 1st to 5th instar nymphs of long-wing (LW) and short-wing (SW) strains of the brown planthopper (BPH), Nilaparvata lugens. Small RNA libraries were then constructed and sequenced, yielding 158 conserved and 96 novel miRNAs. Among these, 122 miRNAs were differentially expressed between the two BPH strains. Specifically, 47, 2, 27 and 41 miRNAs were more highly expressed in the 1st, 3rd, 4th and 5th instars, respectively, of the LW strain compared with the SW strain. In contrast, 47, 3, 29 and 25 miRNAs were more highly expressed in the 1st, 3rd, 4th and 5th instars, respectively, of the SW strain compared with the LW strain. Next, we predicted the targets of these miRNAs and carried out Gene Ontology and Kyoto Encyclopedia of Genes and Genomes pathway analysis. We found that a number of pathways might be involved in wing form determination, such as the insulin, MAPK, mTOR, FoxO and thyroid hormone signaling pathways and the thyroid hormone synthesis pathway. Thirty and 45 differentially expressed miRNAs targeted genes in the insulin signaling and insect hormone biosynthesis pathways, respectively, which are related to wing dimorphism. Among these miRNAs, Nlu-miR-14-3p, Nlu-miR-9a-5p and Nlu-miR-315-5p, were confirmed to interact with insulin receptors (NlInRs) in dual luciferase reporter assays. These discoveries are helpful for understanding the miRNA-mediated regulatory mechanism of wing polyphenism in BPHs and shed new light on how insects respond to environmental cues through developmental plasticity.

57 President Oral Presentation Pick: The exploration of blood microRNA profiling in feedlot cattle with different lameness phenotypes

Abstract Lameness is a significant economic and welfare issue in feedlot production. Effective treatment depends on diagnosing the cause of lameness accurately. There is increasing evidence that circulating microRNAs may serve as useful biomarkers for diagnosing disease. However, their association with lameness in feedlot cattle is currently unknown. The objective of this study was to investigate whether blood miRNA profiles can be associated with a specific lameness phenotype. Blood samples were collected via venepuncture (into Tempus™ Blood RNA Tubes) from 39 feedlot cattle diagnosed with digital dermatitis (DD; n = 2), toe tip necrosis syndrome (TTNS; n = 5), footrot (FR; n = 26) and healthy controls (HC; n = 6) for miRNA profiling using RNA sequencing. Samples were obtained at the time each animal was pulled from their pens for medical treatment. Total RNA was extracted from blood samples and subjected to small RNA libraries construction and RNA-sequencing. The sequence data analysis was performed using a web-based tool, sRNAtoolbox. A total of 596 miRNAs were identified across 39 blood samples with the expression of 444, 437, 465 and 575 miRNAs detected in the HC, DD, TTNS and FR groups, respectively. In addition, group-specific miRNAs were identified with 9 in the DD group, 45 in the TTN group, 28 in the FR group and 2 in the HC group. Moreover, 41, 8 and 36 differential expressed miRNAs (DE miRNAs) were detected in DD, TTNS and FR groups, respectively, when compared to the HC group using DeSeq2. These data suggest that miRNA profiles may differ according to lameness diagnosis in beef cattle. However, further investigation incorporating functional analyses of miRNA, increased sample size and the physiological profile of the animals are required to better understand the relationship between blood miRNA profiles and lameness in feedlot cattle.

Abstract 15839: Patients With Abdominal Aortic Aneurysms Have Reduced Levels of MicroRNA 122-5p in Circulating Exosomes

Introduction: There are currently no specific biomarkers to screen and monitor disease progression in abdominal aortic aneurysms (AAA), which are the 15 th leading cause of death in the United States. Circulating exosomes contain microRNAs (miRNA) that are potential biomarkers of disease. This study aimed to characterize the exosomal miRNA expression profile of patients with AAA in order to identify novel markers of disease. Methods: A total of 109 patients scheduled to undergo a duplex ultrasound (US) for screening or surveillance of AAA were screened to participate in the study. Eleven patients with AAA (max aortic diameter >3cm) and 15 non-aneurysmal controls (max aortic diameter <3cm on screening US) were enrolled. Circulating plasma exosomes were isolated using Cushioned-Density Gradient Ultracentrifugation and total RNA was extracted. Next Generation Sequencing was performed on the Illumina HiSeq4000 SE50 after NEBNext Multiplex Small RNA Library Prep. Differential miRNA expression analysis was performed using DESeq2 software with a Benjamini-Hochberg correction. MicroRNA expression profiles were validated by Quantitative Real-Time PCR. Results: Aortic diameter, as measured by US, was significantly larger in the AAA group (mean maximum diameter 5.2 vs 2.3 cm, p =2.84x10 -6 ). Aneurysm patients were more likely to suffer from CAD (5/11 vs 1/15, p = 0.05) but had similar levels of PAD (4/11 vs 2/15, p =0.35) and COPD (4/11 vs 4/15, p =0.68) compared to controls. A total of 40 miRNAs were differentially expressed ( p <0.05). Of these, 18 miRNAs were up-regulated and 22 were down-regulated in controls compared to AAA. After false discovery rate (FDR) adjustment, only miR-122-5p was expressed at significantly different levels in AAA compared to controls (fold change = 5.03 controls vs AAA; raw p = 1.8x10 -5 ; FDR p =0.02). Conclusions: Plasma exosomes from AAA patients have significantly reduced levels of miRNA-122-5p compared to controls.

Sperm miRNAs\u2014 potential mediators of bull age and early embryo development

BackgroundSperm miRNAs were reported to regulate spermatogenesis and early embryonic development in some mammals including bovine. The dairy cattle breeding industry now tends to collect semen from younger bulls under high selection pressure at a time when semen quality may be suboptimal compared to adult bulls. Whether the patterns of spermatic miRNAs are affected by paternal age and/or impact early embryogenesis is not clear. Hence, we generated small non-coding RNA libraries of sperm collected from same bulls at 10, 12, and 16 months of age, using 16 months as control for differential expression and functional analysis.ResultsWe firstly excluded all miRNAs present in measurable quantity in oocytes according to the literature. Of the remaining miRNAs, ten sperm-borne miRNAs were significantly differentially expressed in younger bulls (four in the 10 vs 16 months contrast and six in the 12 vs 16 months contrast). Targets of miRNAs were identified and compared to the transcriptomic database of two-cell embryos, to genes related to two-cell competence, and to the transcriptomic database of blastocysts. Ingenuity pathway analysis of the targets of these miRNAs suggested potential influence on the developmental competence of two-cell embryos and on metabolism and protein synthesis in blastocysts.ConclusionsThe results showed that miRNA patterns in sperm are affected by the age of the bull and may mediate the effects of paternal age on early embryonic development.

MiRNA expression profile in chicken ovarian follicles throughout development and miRNA-mediated MMP expression

Accumulating evidence has demonstrated the role of microRNAs (miRs) in the avian ovary. In this study, high-throughput transcriptome analyses were employed to study the differential miR expression profiles in the chicken ovary, aiming to reveal miR-targeting matrix metalloproteinase (MMP) expression during follicular growth, maturation, and atresia. Using tissues of chicken ovarian follicles at key steps of development (slow growing - white, the most recently recruited - small yellow, and preovulatory - F2) and regression (the third postovulatory), 14 small RNA (sRNA) libraries were constructed. The 25 most highly expressed known miRs were identified along with eight significantly differentially expressed (DE) miRs (gga-miR-let-7d, gga-miR-31-3p, gga-miR-138-1-3p, gga-miR-1552-5p, gga-miR-92-3p, gga-miR-31-5p, gga-miR-202-3p, and gga-miR-6648-3p) which were further examined by quantitative real time-PCR (qRT-PCR) in white, yellowish, small yellow, and atretic follicles as well as in the granulosa and theca layer of yellow preovulatory F3–F1 follicles (n = 6 hens). These miRs were mainly associated with four pathways: inhibition of MMPs, axonal guidance signaling, HIF1α signaling, and GP6 signaling. Four predicted target genes (i.e. MMP-16, ADAM10, COL4A2, and COL4A5) were examined by qRT-PCR and negatively correlated with DE miRs. The identified candidate miR:mRNA target pairs include gga-miR-31-5p or gga-miR-92-3p:MMP-16, gga-miR-31-5p or gga-miR-92-3p:ADAM10, let-7d:COL4A2, and gga-miR-138-1-3p:COL4A5 are potentially associated with MMP modulation in the hen ovary, mostly in the granulosa and theca cells of the largest preovulatory follicles. These results provide a novel insight to the role of miRs in follicle development by identifying a miR target network that is putatively engaged in remodeling of the extracellular matrix during ovarian follicle development in chickens.

Whole egg consumption increases gene expression within the glutathione pathway in the liver of Zucker Diabetic Fatty rats.

Nutrigenomic evidence supports the idea that Type 2 Diabetes Mellitus (T2DM) arises due to the interactions between the transcriptome, individual genetic profiles, lifestyle, and diet. Since eggs are a nutrient dense food containing bioactive ingredients that modify gene expression, our goal was to examine the role of whole egg consumption on the transcriptome during T2DM. We analyzed whether whole egg consumption in Zucker Diabetic Fatty (ZDF) rats alters microRNA and mRNA expression across the adipose, liver, kidney, and prefrontal cortex tissue. Male ZDF (fa/fa) rats (n = 12) and their lean controls (fa/+) (n = 12) were obtained at 6 wk of age. Rats had ad libitum access to water and were randomly assigned to a modified semi-purified AIN93G casein-based diet or a whole egg-based diet, both providing 20% protein (w/w). TotalRNA libraries were prepared using QuantSeq 3' mRNA-Seq and Lexogen smallRNA library prep kits and were further sequenced on an Illumina HighSeq3000. Differential gene expression was conducted using DESeq2 in R and Benjamini-Hochberg adjusted P-values controlling for false discovery rate at 5%. We identified 9 microRNAs and 583 genes that were differentially expressed in response to 8 wk of consuming whole egg-based diets. Kyto Encyclopedia of Genes and Genomes/Gene ontology pathway analyses demonstrated that 12 genes in the glutathione metabolism pathway were upregulated in the liver and kidney of ZDF rats fed whole egg. Whole egg consumption primarily altered glutathione pathways such as conjugation, methylation, glucuronidation, and detoxification of reactive oxygen species. These pathways are often negatively affected during T2DM, therefore this data provides unique insight into the nutrigenomic response of dietary whole egg consumption during the progression of T2DM.

Differential Expression of Maize and Teosinte microRNAs under Submergence, Drought, and Alternated Stress.

Submergence and drought stresses are the main constraints to crop production worldwide. MicroRNAs (miRNAs) are known to play a major role in plant response to various stresses. In this study, we analyzed the expression of maize and teosinte miRNAs by high-throughput sequencing of small RNA libraries in maize and its ancestor teosinte (Zea mays ssp. parviglumis), under submergence, drought, and alternated stress. We found that the expression patterns of 67 miRNA sequences representing 23 miRNA families in maize and other plants were regulated by submergence or drought. miR159a, miR166b, miR167c, and miR169c were downregulated by submergence in both plants but more severely in maize. miR156k and miR164e were upregulated by drought in teosinte but downregulated in maize. Small RNA profiling of teosinte subject to alternate treatments with drought and submergence revealed that submergence as the first stress attenuated the response to drought, while drought being the first stress did not alter the response to submergence. The miRNAs identified herein, and their potential targets, indicate that control of development, growth, and response to oxidative stress could be crucial for adaptation and that there exists evolutionary divergence between these two subspecies in miRNA response to abiotic stresses.

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos

Preparation of Small RNA Libraries for Sequencing from Early Mouse Embryos.

MicroRNAs (miRNAs) are important for the complex regulation of cell fate decisions and developmental timing. In vivo studies of the contribution of miRNAs during early development are technically challenging due to the limiting cell number. Moreover, many approaches require a miRNA of interest to be defined in assays such as northern blotting, microarray, and qPCR. Therefore, the expression of many miRNAs and their isoforms have not been studied during early development. Here, we demonstrate a protocol for small RNA sequencing of sorted cells from early mouse embryos to enable relatively unbiased profiling of miRNAs in early populations of neural crest cells. We overcome the challenges of low cell input and size selection during library preparation using amplification and gel-based purification. We identify embryonic age as a variable accounting for variation between replicates and stage-matched mouse embryos must be used to accurately profile miRNAs in biological replicates. Our results suggest that this method can be broadly applied to profile the expression of miRNAs from other lineages of cells. In summary, this protocol can be used to study how miRNAs regulate developmental programs in different cell lineages of the early mouse embryo.

Identification of miRNA-eQTLs in maize mature leaf by GWAS

BackgroundMiRNAs play essential roles in plant development and response to biotic and abiotic stresses through interaction with their target genes. The expression level of miRNAs shows great variations among different plant accessions, developmental stages, and tissues. Little is known about the content within the plant genome contributing to the variations in plants. This study aims to identify miRNA expression-related quantitative trait loci (miR-QTLs) in the maize genome.ResultsThe miRNA expression level from next generation sequencing (NGS) small RNA libraries derived from mature leaf samples of the maize panel (200 maize lines) was estimated as phenotypes, and maize Hapmap v3.2.1 was chosen as the genotype for the genome-wide association study (GWAS). A total of four significant miR-eQTLs were identified contributing to miR156k-5p, miR159a-3p, miR390a-5p and miR396e-5p, and all of them are trans-eQTLs. In addition, a strong positive coexpression of miRNA was found among five miRNA families. Investigation of the effects of these miRNAs on the expression levels and target genes provided evidence that miRNAs control the expression of their targets by suppression and enhancement.ConclusionsThese identified significant miR-eQTLs contribute to the diversity of miRNA expression in the maize penal at the developmental stages of mature leaves in maize, and the positive and negative regulation between miRNA and its target genes has also been uncovered.

Occurrence of Chenopodium quinoa mitovirus 1 in Chenopodium quinoa in China.

Chenopodium quinoa mitovirus 1 (CqMV1), a member of Mitovirus in the family Mitoviridae, is the first identified plant mitovirus (Nerva et al., 2019), which has been reported to be capable of infecting different cultivars of Chenopodium quinoa including Cherry vanilla quinoa, GQU-7356 campesino Quinoa, and Wild (Nerva et al., 2019). Cultivation of C. quinoa has increased notably in China, with good agricultural and industrial results due to its nutritional value (Vega-Gálvez et al., 2010). In September 2019, leaf mottling and plant stunting were observed on C. quinoa (cv. Longli 1) plants (Fig. S1) in a field of about 0.9 acre in Qingyuan County, Zhejiang Province, China. About 33.3% (401/1200) of C. quinoa showed leaf mottling and plant stunting symptoms. To identify viral agents potentially associated with this disease, a sRNA library from a symptomatic leaf sample was generated and sequenced. Total RNA was extracted using RNAiso Plus (TaKaRa, Tokyo, Japan) and the library was constructed using the Truseq Small RNA Library preparation kit (Illumina, CA, USA). Approximately 14 million raw reads were obtained from the Illumina MiSeq platform. The clean reads were obtained and assembled using the VirusDetect pipeline v1.6 (Zheng et al., 2017) for virus identification. A total of 22 assembled contigs, with sizes ranging from 42 to 306 nt, could be aligned to the genome of CqMV1 isolate Che1 (accession no. MF375475) with nucleotide identities of 96.3% to 99.1% and a cumulative alignment coverage of the CqMV1 genome of 84.0%. Except for CqMV1, no other viruses or viroids were found in the sample. Based on the assembled contigs and the reference CqMV1 genome, we designed two primer pairs (P1F: 5'- TCCGAATCTCATTTTCGGAGTGGGTAGA -3' and P1R: 5'- CAGACTTTAGATCAAATGAATACACATGT -3'; P2F: 5'- TCCAGTATACCTGTGGATAGTACTTTCA -3'and P2R: 5'- CGATCTCTGCTACCAAATACTCGTGAGCC -3') to obtain the genome sequence of CqMV1 isolate Zhejiang (CqMV1-ZJ). Total RNA from the CqMV1-infected C. quinoa plant was subject to reverse transcription (RT) using AMV reverse transcriptase (TaKaRa, Tokyo, Japan) with random primers N6 (TaKaRa, Tokyo, Japan). The cDNA was then used as the template to amplify two regions in the genome, which together covered the entire genome of CqMV1-ZJ, using high-fidelity DNA polymerase KOD-Plus-Neo (Toyobo, Osaka, Japan). The PCR products were cloned into the pLB vector (Tiangen, Beijing, China) and Sanger sequenced (YouKang Co., Ltd, China). The obtained sequences were assembled into a 2,730-nt contig, representing the complete genome of CqMV1-ZJ (GenBank accession no. MT089917). Pairwise sequence comparison using the Sequence Demarcation Tool v.1.2 (Muhire et al., 2014) revealed that CqMV1-ZJ shared a sequence identity of 96.9% with the sole CqMV1 sequence available in GenBank (MF375475), thus confirming the identity of the virus as CqMV1. Furthermore, we performed RT- PCR detection on 10 collected samples using the primer pair P1F and P1R. All seven symptomatic plants tested positive for CqMV1 infection, whereas three asymptomatic plants were CqMV1-free (Fig. S1), suggesting a possible association between the virus and the symptoms observed. However, in the study by Nerva et al, two CqMV1 infected accessions (cv. Regalona and IPSP1) were found asymptomatic (Nerva et al., 2019), we therefore speculated that the symptom caused by CqMV1 varies between different C. quinoa varieties or its growth environment. To the best of our knowledge, this is the first report of CqMV1 infecting C. quinoa in China. Its ability to be transmitted through seeds (Nerva et al., 2019) and the possible pathogenicity in C. quinoa raises a serious concern for the local C. quinoa industry. The findings reported here will assist further investigations on the epidemiology and biological characteristics of CqMV1 in Zhejiang, China.

Differential Expression, Interactive Relationship and Functional Pathway of Micro Ribonucleic Acids and Proteins in Plasma Exosomes of Patients with Atrial Fibrillation

Background Atrial fibrillation (AF) is one of the most common arrhythmia all over the world with increased morbidity and mortality in the recent years. Micro ribonucleic acids (miRNAs) and proteins in plasma exosomes are a hot topic of mechanism analysis, liquid biopsy and drug delivery. For the first time worldwide, the current study was designed to analyze differential expression, interactive relationship and functional pathway of miRNAs and proteins in plasma exosomes of patients with AF. Methods The current study enrolled 24 individuals, including 8 individuals without AF, 8 patients with paroxysmal AF and 8 patients with persistent AF. Exosomes were extracted from plasma by ultracentrifugation and verified by transmission electron microscopy, western blot and nanoparticle tracking analyses. MiRNAs were dealt with MGIEasy Small RNA Library Prep Kit and analyzed by high-throughput sequencing platform BGISEQ-500. Proteins were labeled with Tandem Mass Tag Labeling Kit and analyzed by nanospray high performance liquid chromatography-mass spectrometry. Results All individuals had a mean age of 73.5±16.2 years, and 17 individuals were males (70.8%). Compared with individuals without AF, patients with paroxysmal AF had 263 downregulated and 535 upregulated known miRNAs, and patients with persistent AF had 164 downregulated and 676 upregulated known miRNAs. Compared with individuals without AF, patients with paroxysmal AF had 188 downregulated proteins and 4 upregulated proteins, and patients with persistent AF had 78 downregulated proteins and 6 upregulated proteins. Interactive analyses showed that compared with individuals without AF, both patients with paroxysmal and persistent AF had the top concentrated pathways of differential miRNAs and proteins were regulation of actin cytoskeleton, focal adhesion and platelet activation. Conclusions The current study detected plasma exosomes in patients with AF and displayed differential expression of miRNAs and proteins in plasma exosomes of these patients. Patients with AF have more upregulated miRNAs and more downregulated proteins in plasma exosomes than individuals without AF. Moreover, these differentially expressed miRNAs and proteins and their interactive relationship in plasma exosomes were related to regulation of actin cytoskeleton and other signaling pathways involved in AF. They could be key factors in the development and identification of AF and applied as preventative and therapeutic targets of AF. Further studies about AF are needed for more detailed pathways of miRNAs and proteins in exosomes and rapid development of exosome based therapies. Keywords atrial fibrillation, micro ribonucleic acid, plasma exosomes

Differential expression profile of microRNA in yak skeletal muscle and adipose tissue during development.

miRNAs play an important role in regulating normal animal development. Muscle tissue and fat metabolism are important for maintaining energy balance in animals. Yak has important agricultural and economic importance as it provides milk, meat, and hair. It is used for transportation as well. However, the miRNA expression profiles of their muscle and adipose tissue are currently unknown. To explore the regulatory roles of miRNAs in the skeletal muscle and adipose tissues of yak. A total of 12 small RNA libraries were constructed from the skeletal muscle and adipose samples from yak aged 0.5, 2.5, 4.5, and 7.5years. High-throughput sequencing and bioinformatics analysis were used to determine the dynamic expression profile of miRNA, and a miRNA regulatory network related to muscle and adipose tissue development was established. miR-1-3p and miR-143-3p showed the highest expression during yak skeletal muscle and fat development, respectively. The MAPK and Ras signaling pathways were the pivotal pathways. miR-181-5p, miR-542-3p, and miR-424-5p may have key roles in skeletal muscle development, and CREBRF, GRB10, CDK1, RFX3, and EPC2 were the core target genes. While miR-127-5p, miR-379-3p, and miR-494-3p may play important regulatory roles in adipose deposition, and ETV1, XPO7, and C5AR2 were the core target genes. This study provides valuable resources for further study of the molecular mechanisms underlying yak skeletal muscle and adipose tissue development, and also a basis for studying the interactions between genes and miRNAs.

Comprehensive analysis of microRNAs in the mantle central and mantle edge provide insights into shell formation in pearl oyster Pinctada fucata martensii.

MicroRNAs (miRNAs) are a class of non-coding RNA molecules with post-transcriptional regulatory activity in various biological processes. Pearl oyster Pinctada fucata martensii is one of the main species cultured for marine pearl production in China and Japan. In this study, we constructed two small RNA libraries of mantle central (MC) and mantle edge (ME) from P. f. martensii and obtained 24,175,537 and 21,593,898 clean reads, respectively. A total of 258 miRNAs of P. f. martensii (Pm-miRNA) were identified, and 93 differentially expressed miRNAs (DEMs) including 49 known Pm-miRNAs and 44 novel Pm-miRNAs were obtained from the MC and ME. The target transcripts of these DEMs were obviously enriched in neuroactive ligand-receptor interaction pathway, and others. After over-expression of Pm-miR-124 and Pm-miR-9a-5p in the MC by mimic injection into the muscle of P. f. martensii, nacre exhibited a disorderly growth as detected by scanning electron microscopy. Pm-nicotinic acetylcholine receptor alpha subunit, Pm-neuropeptide Y and Pm-chitin synthase were investigated as the targets of Pm-miR-124; and Pm-tumor necrosis factor receptor associated factor 2 and Pm-chitin synthase were investigated as the targets of Pm-miR-9a-5p. These predicted target transcripts were down-regulated after the over-expression of Pm-miR-124 and Pm-miR-9a-5p in MC. This study comprehensively analyzed the miRNAs in mantle tissues to enhance our understanding of the regulatory mechanism underlying shell formation.

Exosomal microRNAs are novel circulating biomarkers in cigarette, waterpipe smokers, E-cigarette users and dual smokers

BackgroundElectronic cigarettes (e-cigs) vaping, cigarette smoke, and waterpipe tobacco smoking are associated with various cardiopulmonary diseases. microRNAs are present in higher concentration in exosomes that play an important role in various physiological and pathological functions. We hypothesized that the non-coding RNAs transcript may serve as susceptibility to disease biomarkers by smoking and vaping.MethodsPlasma exosomes/EVs from cigarette smokers, waterpipe smokers and dual smokers (cigarette and waterpipe) were characterized for their size, morphology and TEM, Nanosight and immunoblot analysis. Exosomal RNA was used for small RNA library preparation and the library was quantified using the High Sensitivity DNA Analysis on the Agilent 2100 Bioanalyzer system and sequenced using the Illumina NextSeq 500 and were converted to fastq format for mapping genes.ResultsEnrichment of various non-coding RNAs that include microRNAs, tRNAs, piRNAs, snoRNAs, snRNAs, Mt-tRNAs, and other biotypes are shown in exosomes. A comprehensive differential expression analysis of miRNAs, tRNAs and piRNAs showed significant changes across different pairwise comparisons. The seven microRNAs that were common and differentially expressed of when all the smoking and vaping groups were compared with non-smokers (NS) are hsa-let-7a-5p, hsa-miR-21-5p, hsa-miR-29b-3p, hsa-let-7f-5p, hsa-miR-143-3p, hsa-miR-30a-5p and hsa-let-7i-5p. The e-cig vs. NS group has differentially expressed 5 microRNAs (hsa-miR-224-5p, hsa-miR-193b-3p, hsa-miR-30e-5p, hsa-miR-423-3p, hsa-miR-365a-3p, and hsa-miR-365b-3p), which are not expressed in other three groups. Gene set enrichment analysis of microRNAs showed significant changes in the top six enriched functions that consisted of biological pathway, biological process, molecular function, cellular component, site of expression and transcription factor in all the groups. Further, the pairwise comparison of tRNAs and piRNA in all these groups revealed significant changes in their expressions.ConclusionsPlasma exosomes of cigarette smokers, waterpipe smokers, e-cig users and dual smokers have common differential expression of microRNAs which may serve to distinguish smoking and vaping subjects from NS. Among them has-let-7a-5p has high sensitivity and specificity to distinguish NS with the rest of the users, using ROC curve analysis. These findings will pave the way for the utilizing the potential of exosomes/miRNAs as a novel theranostic agents in lung injury and disease caused by tobacco smoking and vaping.