Silurus Triostegus Research Articles

Biochemical contents of tapeworm Proteocephalus osculatus and its definitive host, Silurus triostegus

The current study dealt with the determination of the concentration of some biomolecules in the tissues of the tapeworm and the intestinal tissue of its definitive host (fish). At the probability level (P≤0.05) a sig-nificant difference was noticed in the concentration of proteins, glycogen and lipids in the intestinal tissue of non-infected fish compared to the infected fish. The concentration of proteins and glycogen in the tissues of the tapeworm was (9.95 and 7.33) mg/g of fresh weight respectively, it was lower than that in the intestinal tissues of its infected definitive host, which amounted to (22.06, 12.33) mg/g of fresh weight, respectively, while lipids appeared in a higher concentration in the tapeworm tissues (19.17) mg/g of fresh weight com-pared to its concentration in the intestine of its infected definitive host (17.10) mg/g of fresh weight. As for the concentration of urea and creatinine, it was found a significant difference at the level of probability (P≤0.05) in the serum of infected and non-infected fish, as both urea and creatinine showed a significant relative increase in the serum of infected fish (12.30, 2.31) mg/dl respectively than in non-infected fish (10.66 and 1.07) mg/dl respectively. Keywords: creatinine; glycogen; lipid; protein; Silurus triostegus; tapeworm; urea

Exploring collagen diversity in the bone of mesopotamian catfish (Silurus triostegus, Heckel, 1843)

Collagen, a pivotal extracellular matrix biomolecule ubiquitous in connective tissues, drew substantial attention due to its widespread presence, notably in skin and bone. This pioneering study delves into the extraction, characterization, and amino acid profiling of acid-soluble collagens (ASC) obtained from the bone (ASC-B) of the Mesopotamian catfish, Silurus triostegus, (Heckel, 1843). Notably, this research marks the inaugural exploration of this species as a collagen source. Fourier transform infrared spectroscopy (FTIR) confirmed the integrated and native nature of both collagens, while X-ray diffraction (XRD) results indicated the preservation of helical structures in both skin and bone collagens. UV-Vis spectra highlighted prominent absorptions at 230 nm. SEM studies revealed the porous and fibrous structure of ACS-B Collectively considering UV–Vis and FTIR results alongside the amino acid composition, the extracted collagens were characterized as type I collagen. The collagen isolated from the catfish emerges as a potential alternative source of vertebrate collagens with prospective applications in diverse industries, including diet, medical, and pharmaceutical sectors.

Isolation and Diagnosis of the Myxozoa Parasitizing in some Fish Species in Tigris River at Salah Al-Din Governorate, Iraq

The currently study was achieved from February 2021 to end January 2022 to investigate the external and intestinal parasites in some fish species of Tigris river passing Tikrit city. During the period of this study, 580 fish were collected that belonged to seven families and 16 species. These fish are represented 45 Acanthobrama marmid, 40 Alburnus sellal, 30 Arabibarbus grypus, 65 Carasobarbus luteus, 55 Chondrostoma regium, 60 Cyprinion kais, 60 Cyprinius carpio, 50 Leuciscus vorax, 21 Luciobarbus xanthopterus, 14 Squalius Lepidus, 13 Mystus pelusius, 10 Silurus triostegus, 10 Heterropneutes fossilis, 12 Mastacembelus mastacemblus, 30 Coptodon zilli and 65 Planiliza abu. This study diagnosis 12 species of Myxoblus: M. bouixi, M. bramae, M. branchiophilus, M. cyprinicola, M. dispar, M. ellipsoides, M. infundibulatus, M. koi, M. magnus, M. molnari, M. musculi, and M. shaerica.

Determination of fatty acid composition of Silurus triostegus Heckel, 1843 and Arabibarbus grypus Heckel, 1843 species living in Ilısu Dam Lake (Batman/TÜRKİYE)

In this study, the fatty acid compounds in the muscle tissues of Mesopotamian catfish (Silurus triostegus, Heckel, 1843) and Shabut (Arabibarbus grypus, Heckel, 1843), which live in Ilısu Dam Lake on the Tigris River and have economic importance. For fatty acid analysis, muscle tissues were taken from the samples obtained from local fishermen, placed in tubes and lipids were obtained by applying chloroform/methanol method. The methylation steps of fatty acids in the samples were performed in accordance with TS EN ISO 12966:2 (TS EN ISO 12966-2., 2017) method. The total fatty acid content of saturated fatty acids (SFA) value was detected as 27,97 ± 0,26 in A.grypus, 32.46 ± 0.37 in S. triostegus, The value of Monounsaturated Fatty Acids (MUFA) varied between 42.63 ± 0.6% in A. grypus and 41.5 ± 0.51% in S. triostegus. Total polyunsaturated polyunsaturated acids (PUFA) ranged between 21.83 ± 1.49 for A. grypus and 25.82 ± 1.94 for S. triostegus. MUFA values in all samples were higher than SFA and PUFA values for both fish species. Docosa Hexaenoic Acid (DHA) and Eicosa Pentaenoic Acid (EPA) are commonly consumed omega-3 types. A. grypus and S. triostegus are within the recommended limits for EPA (C20:5n3) and DHA (C22:6n3). For A. grypus, ω3/ω6 values were (1,06); for S. triostegus ω3/ω6 values were (1,38). When the ω3/ω6 values of both fish species were analysed for human health, it was determined that the ω3/ω6 values of omega fatty acids A. grypus and S. triostegus were above 1. As a result information on the composition of 20 types of fatty acids and ω3/ω6 amounts were obtained in muscle tissue of A. grypus and S. triostegus species living in Ilısu Dam Lake and most preferred by local people. The levels of fat and its components in these species, which may cause different problems when accumulated in the body as a result of changing consumption habits, were indicated in the study.

Study of the Level of Lead and Zinc in Five Species of Fish in Tigris River

The research was carried out in the Tigris River, specifically in two distinct areas, namely Tikrit and Samarra within the Salah al-Din province, during the period of May 1, 2022, to January 9, 2021. The selection of these two stations was made with the intention of collecting fish samples for the purpose of assessing the presence of heavy element contamination in the fish population. This study was conducted at the laboratories of the Department of Food Sciences in the College of Agriculture, and the Department of Chemical Engineering in the College of Engineering at the University of Tikrit. The objective of the study was to assess the extent of heavy metal contamination, specifically lead and zinc, in various parts of fish including meat, liver, gills, and intestines. The study focused on five species of fish commonly found in the Tigris River, namely Zori, Nile tilapia, Aspius vorax, Silurus triostegus, and Carrasobarbus luteus. Additionally, the study encompassed two regions, Tikrit and Samarra, located in Salah al-Din province. The bi-interaction recorded a significant difference in the lead element, the highest value of which was (5.14 PPM) in the Nile tilapia muscles, and the lowest value (0.001 PPM) in the Nile tilapia gills, where the bi-interaction between the type of fish and the location was not recorded in the zinc element in the Samarra location, it reached the highest level The zinc element in the average of the sample type was (37.17 PPM) in the liver of the studied fish, and the lowest value was (8.82 PPM) in the intestines of the studied fish.

Study of some toxic metals in parts from catfish (Silurus triostegus) in Shatt Al-Arab river

According to their toxicity, toxic heavy metals such as arsenic, mercury, cadmium, copper, zinc, and lead are believed to be the most harmful to humans, fish, and the environment. Because their levels are rising due to human activities endangering aquatic species and people, the current study sought to ascertain the level of toxic heavy metals in five catfish parts (skin, liver, muscles, gills, and ovaries). In the northern part of the Shatt Al-Arab, catfish samples were collected in March 2022. ICP-MS was used to detect target metal levels. According to the results, arsenic accumulated in the skin and muscles at a rate of 0.22 and 0.21ppm, respectively. In contrast, the levels of arsenic in the various body parts are not statistically different. Additionally, cadmium showed no noticeable variances in the studied body parts. Furthermore, the liver had the most significant copper accumulation 18.72ppm. Furthermore, mercury accumulation in various body parts was shown to vary statistically, with the highest levels in muscles 0.66ppm. In addition, zinc was accumulated in the body parts in the following sequence: gills, ovaries, liver, skin, and muscles, respectively, while in the following sequence: muscles, skin, gills, liver, and ovaries respectively in the lead. Moreover, there were no statistically significant differences in the quantity of zirconium that accumulated. According to the current study, the catfish’s body parts did not accumulate toxic heavy metals at high rates. This may be due to study area the environment and the mechanisms of treating these types of metals by catfish.

Functional Properties of Collagen Extracted From Catfish ( Silurus triostegus) Bone

Back ground: Collagen accounts for 25percent of all proteins found in vertebrates. The words "collagen"is created with Greek words "kolla" and "genos," which respectively mean "glue" and "formation." It hasa wide range of biological and pharmacological uses. Pig and cow skins provide the majority of thecollagen. Utilizing animal collagen has been restricted as a result of epidemics of certain animal diseasesincluding foot-and-mouth disease (FMD) and bovine spongiform encephalopathy (BSE) (FMD), whichpose a risk of transmission to humansObjective: The goal of this study is to extract collagen from catfish bone.Material and methods: Catfish (Silurus triostegus) bone was used to extract collagen that has beenpepsinized and acid-solubilized collagen (ASC) (PSC). The extracts' proximate composition (moisture,protein, fat, and ash) was measured, and dry weight was used to compute the yield of ASC and PSC. Themolecular weight of experimental collagen ranged from 97 to 200 KD, according to the SDS-PAGEpattern. In order to identify bone collagen, the Fourier Transform Infrared (FTIR) spectra analysis for theacquired ASC and PSC, as well as the standard collagen (type I, II), was used. Using a scanning electronmicroscope (SEM, the morphological structure of ASC and PSC was revealed), and the diffraction angles(2 θ) of ASC and PSC were determined using X-ray analysis. For quality control, the HPLC techniquewas used to determine the collagen.Rustles: The proximate composition of ASC and PSC bone of catfish. The ASC bone of catfish containedmoisture (75.22%), good amount of protein (16.65%) , fat (2.40%) and ash content (0.28 %), While thePSC bone had slightly lower moisture (68.50%) than ASC, it had higher protein (19.93%), fat (1.825%),and ash (0.58%) levels ,HPLC SEM ,FTIR ,Electrophoresis, X-ray.Conclusion: Fish bone was promising sources for preparing collagen, acid soluble collagen (ASC),pepsin soluble collagen (PSC) were successfully extracted by two methods. The collagen extracted frombone catfish, was of type I collagen, which are composed two α1, one α2 chains, and β chains as shownby SDS-PAGE patterns.

EFFECT OF FREEZING PRESERVATION PERIOD ON SOME SENSORY CHARACTERISTICS OF THREE IRAQI LOCAL FISH SPECIES

The current study was conducted to determine the ideal period for freezing of three fish species of in the Iraqi local markets which are common carp Cyprinus carpio ,catfish Silurus triostegus and mullet Planiliza abu through sensory evaluation and the effect of freezing time on the flavor, juiciness and general acceptability of fish .A total of20 samples, were taken for each species of fresh local fish and were frozen at 18°C for different freezing periods : 1 day (T2), 15 days (T3), 30 days (T4) and 45 days (T5) , in addition to the fresh treatment T1 that has not been subjected to freezing. Results of common carp showed that the best freezing time was recorded for treatments T2, T3 and T4 which attained 6.8, 6.6 and 6.2, respectively, for the flavor. The treatment T2, T3 and T4 were recorded 6.4, 6.8 and 6.6 respectively, for tenderness .The treatments T2, T3 and T4 were amounted 7.4, 6.6 and 6.6 respectively, for the Juiciness. Results of the general acceptance of treatments T2, T3 and T4 were 7.6, 7.2, 6.6 respectively. Results of the catfish and the mullet for flavor showed that the best freezing period was for the two treatments T2 and T3, which were 7.4, 6.4 in the catfish and 6.6 and 5.4 in the mullet respectively. T2 and T3 continued to be significantly superior to the freshness of the catfish and the mullet over T4 and T5 and it was 7.0, 6.4 for the catfish and 5.8, 5.6 for the mullet, respectively. T2 and T3 were superior for the juiciness of catfish by 7.0 and 6.6 and for mullet, 5.8 and 5.6 respectively. As for the trait of general acceptance, it was superior in the two treatments T2 and T3 for catfish and mullet and they were 7.4, 6.8 for catfish 6.8 and 6.4 for mullet respectively.

Checklists of Protozoans and Myxozoans of Freshwater and Marine Fishes of Basrah Province, Iraq

Reviewing the literature on all the protozoans and myxozoans parasitizing freshwater and marine fishes of Basrah Province, Iraq indicated the presence of 25 protozoans (one sarcodinid, six mastigophorans, one opalinid, four epicomplexans and 13 ciliophorans) as well as ten myxozoans. Some of these parasites infect skin, fins and gills of their hosts while others are internal parasites of fish muscles, body cavity and different body viscera. Apart from one taxon which was recorded from a marine locality, the remaining taxa were recorded from freshwater localities. The total number of protozoan and myxozoan species recorded for each fish host species fluctuated from a minimum of one parasite species in 11 fish hosts to a maximum of 15 parasite species in Silurus triostegus. Number of fish hosts reported for these parasites fluctuated from one host in case of 21 parasite species to a maximum of 19 host species in case of the ciliophoran Trichodina domerguei.

ANALYTICAL STUDY OF THE FISHERIES IN THE LOWER REACHES OF THE TIGRIS RIVER, NORTH QURNA, BASRAH, IRAQ

The fisheries of the lower reaches of Tigris river, north Qurna in Basrah Governorate have been analyzed during the period from January to December 2005. The fishing boats used there varied in lengths form 5 to 10m, of which 50% were motorized with 25-75 HP. Seine and drift gill nets are the main fishing gears used, their lengths ranged from 100 to 200m with mesh sizes of 14-100mm and 7-32mm for seine and gill nets respectively. The number of fishermen in each boat varied from 1 to 7. Twenty three fish species were recorded caught in the area, of which eight were marine species, belonging to twelve fish families, in addition to shrimps. The total catches ranged from 629Kg in January - march to 3335Kg in July- September with total catch of 7671Kg. Three species namely catfish Silurus triostegus, crucian carp Carassius carassius and khishni Liza abu comprised 86.93% of the total catches constituting 69.65%, 11.02% and 6.26%, respectively. The average catch per unit of effort was 19.8 Kg/hr/100m for seine nets and 2.42 Kg/hr/100m for gill nets. The diversity and evenness indices for biomass were 1.0 and 0.33, respectively, in July-September and 1.5 and 0.52, respectively, in October-December. The highest similarity index of species composition was between April-June and July-September (87%), and lowest between April-June and January-March (63%).

ANALYTICAL STUDY OF THE FISHERIES IN THE LOWER REACHES OF THE TIGRIS RIVER, NORTH QURNA, BASRAH, IRAQ

The fisheries of the lower reaches of Tigris river, north Qurna in Basrah Governorate have been analyzed during the period from January to December 2005. The fishing boats used there varied in lengths form 5 to 10m, of which 50% were motorized with 25-75 HP. Seine and drift gill nets are the main fishing gears used, their lengths ranged from 100 to 200m with mesh sizes of 14-100mm and 7-32mm for seine and gill nets respectively. The number of fishermen in each boat varied from 1 to 7. Twenty three fish species were recorded caught in the area, of which eight were marine species, belonging to twelve fish families, in addition to shrimps. The total catches ranged from 629Kg in January - march to 3335Kg in July- September with total catch of 7671Kg. Three species namely catfish Silurus triostegus, crucian carp Carassius carassius and khishni Liza abu comprised 86.93% of the total catches constituting 69.65%, 11.02% and 6.26%, respectively. The average catch per unit of effort was 19.8 Kg/hr/100m for seine nets and 2.42 Kg/hr/100m for gill nets. The diversity and evenness indices for biomass were 1.0 and 0.33, respectively, in July-September and 1.5 and 0.52, respectively, in October-December. The highest similarity index of species composition was between April-June and July-September (87%), and lowest between April-June and January-March (63%).

Functional Properties of Collagen Extracted from Catfish (Silurus triostegus) Waste.

Collagen is used for a variety of biomedical and pharmaceutical uses, such as osteoarthritis-related pain management, hypertension, tissue engineering, and human implants, and is generally derived from porcine or bovine. Collagen from these animals has limitations due to the risk of disease transmission and religious constraints. Therefore, this study investigated the extraction of collagen from catfish (Silurus triostegus) waste. Acid-solubilized collagen and pepsin-solubilized collagen were extracted from catfish skin, fin, head, bone, and muscle. SDS-PAGE patterns of the extracted collagen showed that the protein molecular weights ranged from 97 to 200 kDa and skin, bone, and fin collagen consisted of 2 distinct α chains, which is typical of type 1 collagen. The proximate composition (moisture, protein, fat, and ash) and yield of the obtained extracts were determined. Skin collagen extracts were selected for further investigation due to the high collagen yield. The effects of the pH and salt concentration on solubility, and the denaturation temperature, FTIR spectra, reverse-phase HPLC, and SEM analysis were investigated to characterize the collagen samples. Based on the characterization of catfish skin collagen, this waste material has potential for use in the pharmaceutical and food industries.

Seasonal Variations of Polycyclic Aromatic Hydrocarbons in the Muscle Tissue of Silurus triostegus Heckel, 1843 from Derbendikhan Reservoir

Derbendikhan reservoir is located on the southeast of Sulaimani city 35° 6' 35" N, 45° 41' 20" E, it is the second largest reservoir in the Iraqi Kurdistan region at an altitude of 485 m above sea level. It was formed when the dam was constructed in1956–1961. The area is about 114.30 km2 with the maximum depth of 75.0 m. Silurus triostegus is one of twenty genera of fish that are endemic to Derbendikhan reservoir, Seasonal sampling for 64 samples of fish for 11 sites was carried out from November 2018 to August 2019, Fishing was performed with gill nets of 18, 25, 33, 40, and 55 mm inner mesh sizes. The goal of this research is to determine the level of PAHs in, fish muscle of Silurus triostegus, because fish as an important food source for man and it’s the primary indicator of the toxification of streams and lakes, on the other hand, PAH will cause many health problems including cancer, in addition, this information may be used as a database for any environmental modeling in the future, this study was carried out. Results indicate increasing in PAH in the spring season, although, as a result of fishing activities using old boats and ships at a high rate, in addition to the changes of water temperature in different season. PAH in the muscle of fish (0.098–1.271 μg/g) were above the WHO maximum permissible limit of 0.001 μg/g. The main conclusion is that the fish muscle contains high amounts of PAHs through bioaccumulation and biomagnifications. Finally, the lake needs immediate attention to reduce improper waste disposal and improve on measures against indiscriminate dumping of petroleum products and domestic waste in the water, which are the major sources of petrogenic and pyrogenic PAHs should be minimized, and the treatment of the sewage before its discharge into the reservoir.

-

This study was achieved to investigate the accumulation of some heavy metals included: Cadmium, Lead and Nickel in the tissues (gill, intestine, liver, muscles and skin) of Silurus triostegus Heckel, 1843 (Siluriformes, Siluridae) and its larval stage of the nematode Contracaecum sp. (Rhabditida, Anisakidae). As well as to assess the infection patterns of Contracaecum among S. triostegus specimens which were purchased fresh from the local market in Baghdad. One hundred and nine nematodes specimens in larval stage were recovered from the fish host; the overall prevalence of Contracaecum sp. was 38.6%. The sex of the host was not significantly (P ˃ 0.05) associated with the infection of this nematode. Results showed that the overall mean intensity of Contracaecum sp. was 6.41; mean intensity did not differ significantly (P ˃ 0.05) between the fish sexes.The lead (Pb) was the only element detected in all fish tissues investigated as well as in the parasite, while the cadmium and nickel elements were not detected in all specimens. Skin and muscles of the fish, as well the parasite Contracaecum sp. contained the lowest lead levels compared to other fish tissues (gill, intestine and liver), although no significant differences were noticed among all investigated tissues and the parasite regarding the concentration of Pb.

The Fish Fauna of the Atatürk Dam Lake (Adıyaman/Turkey)

This study was carried out between November 2013 and May 2015, to determine the fish fauna inhabited in the Atatürk Dam lake. The specimens were obtained by different technical fishing gears. It was determined that specimens caught were belonging to 25 species (Capoeta trutta, Capoeta umbla, Cyprinon macrostomus, Arabibarbus grypus, Carasobarbus luteus, Carassius carassius, Carassius gibelio, Cyprinus carpio, Garra variabilis, Luciobarbus esocinus, Luciobarbus mystaceus, Luciobarbus xanthopterus, Acanthobrama marmid, Alburnus mossulensis, Chondrostoma regium, Leuciscus vorax, Squalius cephalus, Cobitis elazigensis, Mystus pelusius, Silurus glanis, Silurus triostegus, Glyptothorax kurdistanicus, Oncorhynchus mykiss, Mastacembelus mastacembelus, Planiliza abu) and 8 families (Cyprinidae, Cobitidae, Bagridae, Siluridae, Sisoridae, Salmonidae, Mastacembelidae, Mugilidae) were identifed. The most dominant family in the Atatürk Dam Lake is the Cyprinidae with 17 species and eightteen species within 25 species that were identified have commercial value. The existence of Silurus glanis, Mystus pelusius and Carassius carassius was determined for the first time in Atatürk Dam Lake and they are new records for the lake.

Effects of Inositol Supplementation in Sperm Extender on the Quality of Cryopreserved Mesopotamian Catfish (Silurus triostegus, H. 1843) Sperm.

Simple SummaryThis study was based on the determination of post-thaw semen quality, oxidant–antioxidant status and DNA-damage status of frozen Mesopotamian catfish semen. To this end, the sperm was frozen in diluent containing different inositol concentrations (5, 10, 20 and 40 mg). Increasing levels of inositol linearly increased the spermatozoa motility rate and duration significantly (p < 0.05). High doses of inositol increased antioxidants and decreased oxidants. In addition, lower intracellular DNA damage and percentage of apoptotic spermatozoa occurred in high doses of inositol (p < 0.05).In this study, the effects of supplemented inositol on sperm extenders were examined on the spermatozoa motility rate and duration, total antioxidant and oxidant status, apoptotic spermatozoa and DNA damage, during the sperm post-thaw process of Mesopotamian Catfish (Silurus triostegus, H. 1843). The semen was frozen in diluents containing different inositol concentrations (5, 10, 20 and 40 mg). Increasing levels of inositol linearly improved the spermatozoa motility rate and duration significantly (p < 0.05). MDA and TOS were linearly decreased, however, TAS and GSH linearly increased (p < 0.05). The increasing inositol levels resulted in a linear and quadratic decrease in DNA damage in the comet assay, 8-hydroxydeoxyguanosine and the determined percentage of apoptotic spermatozoa (p < 0.05). These results suggest that there are many positive effects of the use of supplemental inositol on enhancing sperm cryopreservation efficiency in Silurus triostegus.

Comparative Study of Lipid and Fatty Acid Profile in Liver Tissues of Male and Female Silurus triostegus During the Catching Seasons

In this study, seasonal variations of total fatty acid (FA), phospholipid (PL) and triacylglycerol (TAG) compositions in liver tissues of catfish (Silurus triostegus) were investigated. Samples of S. triostegus were obtained from Atatürk Dam Lake, Turkey, in two month periods during one year as from May. The major components were palmitic acid (16:0), stearic acid (18:0), oleic acid (18:1n-9), palmitoleic acid (16:1n-7), docosahexaenoic acid (DHA, 22:6n-3) and arachidonic acid (AA, 20:4n-6) in total lipid, 16:0, 18:0, 18:1n-9, eicosapentaenoic acid (EPA, 20:5n-3), DHA and AA in PL, 16:0, 16:1n7, 18:1n-9, linoleic acid (LA, 18:2n-6), AA, EPA, DHA and docosapentaenoic acid (22:5n-3) in TAG extracted from the liver of S. triostegus in all seasons. N-3/n-6 ratio was found 2.00-2.61 in females, 1.15-2.75 in males in total lipid. The highest lipid content was found in May (2.39%) in the females. In the males, the highest level was found in September (2.91%). In TAG fraction, the component with the lowest ratio in both sexes’ TAG is PUFA. In PL fraction, SFA, MUFA, and PUFA percentages were found at similar rates in both sexes in all months.

Piscicola geometra (Linnaeus, 1761) leech parasitizing two fish species hosts from Greater Zab near Aski-Kalak, Kurdistan-Iraq, morphological and molecular investigations

Samples of two fish species, Cyprinus carpio and Silurus triostegus were collected from Aski-Kalak and inspected for the presence of parasitic leeches from March 2018 to February 2019 with a prevalence of 6.66 and 8.33 and mean intensity 0.10 and 0.11 respectively. Both hosts’ species were regarded as new hosts for this parasite in Iraq since no previous reports in this country. Collected leeches were fixed, preserved, and identified based on morphological and molecular techniques. For molecular identification, amplification and sequencing of 18S rDNA, with forward primer C1, (ACCCGCTGAACTTTAAGCAT, position 25), and reverse primer C3, (CTCTTCAGAGTACTTTTCAAC, position 390) were studied, while morphological identification based on well descried, and distinguished by focusing on color patterns, number vis arrangement of eyes, body annulations, gonopores shape and location, shape, location and size of body parts, in addition to some species-specific characters, criteria’s were documented by photographing and drawing illustrations.

Survey of Fish Fauna from Five Stations in Duhok Province, Kurdistan Region, Iraq

A survey of fish species was carried out from five stations in Duhok province during the period from August 2016 to September 2017. A total of 517 freshwater fishes, belong to 19 species, namely: Acanthobrama marmid, Arabibarbus grypus, Capoeta damascina, C. trutta, Carasobarbus luteus, Carassius carassius, Chondrostoma regium, Cyprinion kais, C. macrostomum, Cyprinus carpio, Garra rufa, Leuciscus vorax, Luciobarbus barbulus, L. esocinus, L. xanthopterus, Mastacembelus mastacembelus, Mesopotamichthys sharpeyi, Planiliza abu and Silurus triostegus were recorded. The survey showed that the abundant fish at all five stations was C. carassius which is one of the nuisance fish species while the little abundance was recorded for C. luteus.

Cryopreservation of Mesopotamian catfish (Silurus triostegus H., 1843) spermatozoa: Effects of diluents and osmotic pressure on spermatozoa DNA damage, rate and duration of motility

This study was performed to evaluate the effectiveness of three different osmotic pressure (325, 365, and 385 mOsm/kg) in combination with Dimethyl Sulfoxide (DMSO) and NaCl or glucose on spermatozoa DNA damage, rate and duration of motility. Sperm was collected from eight healthy mature Silurus triostegus, evaluated microscopically and pooled at 25 °C. The pooled sperm samples were diluted to final concentration of 1/3 (sperm/diluents) in NaCl and glucose based extender (10% cryoprotectant and 10% egg yolk (EY) into 80% diluents) and separated into groups to 3 different osmotic pressures (325-365-385 mOsm/ kg). Equilibrated sperm was frozen in 0.25 ml straws. Sperm samples were tested for post-thaw sperm motility, duration of motility, DNA damage, Apoptotic index. The highest spermatozoa motility rates were obtained with glucose and NaCl diluents at osmotic pressures of 365 and 385 mOsm/kg (p <0.01). The spermatozoa motility duration was found to be the highest in glucose and NaCl diluents at 365 mOsm/kg osmotic pressure (p <0.01). The post-thawing live spermatozoa rate was determined to be the highest in the sperm frozen with glucose at 385 mOsm/kg. The apoptotic cell rate was determined to be the highest in the sperm frozen with glucose at 385 mOsm/kg osmotic pressure. The necrotic cell rate was found to be the highest with 2.08±0.39% when frozen with the glucose diluent at 325 mOsm/kg pressures. It is concluded that the glucose solution with low osmolality had a harmful effect on the spermatozoa.