Self-assembled Monolayer Method Research Articles

Charged Microdroplets Deposition for Nanostructured-Based Electrode Surface Modification

Accelerated synthesis of gold nanoparticles (AuNPs) in charged microdroplets produced by electrospray ionization (ESI) was exploited to modify the surface of graphite screen-printed electrodes (GSPEs). The deposited AuNPs were then functionalized by the charged microdroplets deposition of 6-ferrocenyl-hexanethiol (6Fc-ht) solutions that act as reducing and stabilizing agents and provide electrochemical properties for the modified electrodes. The morphology and composition of the AuNPs were characterized by scanning electron microscopy (SEM). Cyclic voltammetry (CV), differential pulse voltammetry (DPV) and electrochemical impedance spectroscopy (EIS) were used to investigate the electrochemical behavior of the modified electrodes. The results showed that the ESI microdroplets deposition technique produces uniform and well-dispersed AuNPs on GSPE, and optimal conditions for deposition were identified, enhancing GSPE electrocatalytic performance. Further functionalization by ESI microdroplets of AuNPs with 6Fc-ht demonstrated improved redox properties compared with the conventional self-assembled monolayer (SAM) method, highlighting the technique’s potential for the easy and fast functionalization of electrochemical sensors.

In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.

Boosting oxygen transport through mitigating the interaction between Pt and ionomer in proton exchange membrane fuel cell

The key to operating low-cost and high-power proton exchange membrane fuel cell (PEMFC) is reducing local oxygen transport resistance (Rionomer) from Pt/ionomer interface in cathode with low Pt loading. Herein, we design a high-oxygen mass-transfer Pt/ionomer interface via chemical modification of Pt/C catalyst with 1-Hexadecanethiol (C16SH) by self-assembled monolayers (SAMs) method. With a concentration of 0.3 mM, C16SH is selectively adsorbed on Pt nanoparticles and constructs a hydrophobic Pt/C surface, which can effectively reduce.-SO3H density around Pt active sites and the specific Pt/ionomer interface is obtained after C16SH is removed by in situ electrochemical oxidation. Consequently, compared with the performance of membrane electrode assembly (MEA) from unmodified catalyst, the voltage of C16SH-modified MEA increases by 45 and 82 mV, respectively, at 1500 and 2000 mA cm−2 at RH 100%. The decrease in oxygen transport resistance plays a key role in improving polarization performance, relative to the increase in H+ transport resistance. Moreover, according to limiting current density method, the reduced Rionomer from Pt/ionomer interface is the essential reason for the improved oxygen transport. In general, this work highlights a promising method to boost oxygen transport and enhance performance of PEMFC through mitigating the interaction between Pt and ionomer.

ELECTROCHEMICAL, DFT AND MULTISCALE SIMULATION STUDIES ON SELF-ASSEMBLED FILMS OF 2-AMINO-4-METHYL-PYRIDINE INHIBITOR FOR COPPER METAL CORROSION PROTECTION IN 3.5% NaCl MEDIUM

Copper metal and its alloys are the most used in the industries because it holds excellent conductivity and natural corrosion protectiveness against air/moisture. However, copper undergoes degradation in presence of aggressive 3.5% NaCl. Protective coating is one of the practical methods to safeguard copper metal. In this study, 2-amino-4-methyl-pyridine (AMP) was coated as self-assembled monolayer method (SAM) with different immersion periods (12 h/24 h) and investigated the corrosion potential against 3.5% NaCl medium. Chemical composition of AMP/SAM/Cu was characterized using Fourier-transform infrared (FT-IR) spectroscopy and morphological analysis using atomic force microscopy (AFM) techniques. AMP’s corrosion inhibition potential were evaluated via electrochemical impedance spectroscopy (EIS) and potentiodynamic polarization (PDS) analyses. Quantum chemical calculations and molecular dynamics (MD) simulations explained the stronger adsorption of AMP over copper metal surface via self-assembly method. The corrosion analysis revealed that AMP’s SAM formation (24 h immersion) enhances the corrosion protection of Cu metal, which is mainly due to the uniform thin adhesive compact layer formation and blocks incoming corrosive chloride ions. EIS investigation evident that AMP forms an adhesive layer over the copper surface and prevents the diffusion of aggressive corrosive medium, while PP studies revealed that AMP acts via the mixed mode of corrosion inhibition mechanism. AMP’s significant inhibition efficiency 90% was confirmed via PP analysis. AFM analysis enabled the morphology image of AMP’s shielding over Cu surface and the molecular modeling investigation supported well for the Cu–N (from AMP) bond formation.

Evaluating effect of metallic ions on aggregation behavior of \u03b2-amyloid peptides by atomic force microscope and surface-enhanced Raman Scattering

BackgroundExcessive aggregation of β-amyloid peptides (Aβ) is regarded as the hallmark of Alzheimer’s disease. Exploring the underlying mechanism regulating Aβ aggregation remains challenging and investigating aggregation events of Aβ in the presence and absence of metallic ions at molecular level would be meaningful in elucidating the role of metal cations on interactions between Aβ molecules. In this study, chemical self-assembled monolayer (SAM) method was employed to fabricate monolayer of β-amyloid peptides Aβ42 on gold substrate with a bolaamphiphile named 16-Mercaptohexadecanoic acid (MHA). Firstly, the samples of gold substrate (blank control), the MHA-modified substrate, and the Aβ42-modified substrate were detected by X-ray photoelectron spectroscopy (XPS) to track the self-assembly process. Aggregation behaviors of Aβ42 before and after metallic ions (Zn2+, Ca2+, Al3+) treatment were monitored by atomic force microscopy (AFM) and the interaction between Aβ42 and metallic ions (Zn2+, Ca2+, Al3+) was investigated by surface-enhanced Raman Scattering (SERS).ResultsThe XPS spectra of binding energy of gold substrate (blank control), the MHA-modified substrate, and the Aβ42-modified substrate are well fitted with the corresponding monolayer’s composition, which indicates that Aβ42 monolayer is well formed. The recorded surface morphology of different experimental groups obtained by AFM showed markedly different nanostructures, indicating occurrence of aggregation events between Aβ42 molecules after adding metal ions to the solution. Compared to the control group, the presence of metallic ions resulted in the increased size of surface structures on the observed 3D topography. Besides, the intermolecular rupture force of Aβ42 increased with the addition of metallic ions. Further study by SERS showed that the Raman strength of Aβ42 changes significantly after the metal cation treatment. A considerable part of the amide bonds interacts with metal cations, leading to a structural change, which is characterized by the weakened β-fold Raman peak.ConclusionThe AFM imaging results suggest that aggregation events occurred between Aβ42 molecules with the addition of metal cations. In addition, the results of force tests indicate that the presence of metallic ions could promote adhesion between Aβ42 molecules, which is likely to be the trigger for aggregation behavior of Aβ42. Furthermore, the effect of metallic cations on the conformational change of Aβ42 studied by SERS supported the results obtained by AFM. Taken together, the results showed that the presence of substoichiometric metal cations promotes aggregation behavior between Aβ42 molecules on the substrate at pH 7.4.

A two-in-one immunoassay biosensor for the simultaneous detection of Odontoglossum ringspot virus and Cymbidium mosaic virus

This study proposes a highly sensitive and label-free electrochemical immunosensor that can simultaneously detect Phalaenopsis virus, Odontoglossum ringspot virus (ORSV) and Cymbidium mosaic virus (CymMV). First, a microhemisphere array nickel mold was made using the semiconductor lithography process combined with the electroforming process. Afterward, hot embossing was used to print the microhemisphere array on a polyethylene terephthalate film. Then, to prepare the detection electrode with a nano/micro-hybrid structure, a thin gold film was sputtered on the microhemisphere array surface, followed by successively immobilizing 1,6-hexanedithiol and colloidal gold nanoparticles on the surface of the gold film. Finally, the ORSV and CymMV antibodies were mixed and immobilized on the electrode using the self-assembled monolayer method to prepare the two-in-one sensing electrode. The ORSV and CymMV were simultaneously detected using electrochemical differential pulse voltammetry. The biosensor developed in this study has a detection limit of 0.5 ng/mL. Notably, the virus can be detected even after diluting the sap of the infected leaf 100 times.

IMPROVEMENT OF SURFACE POTENTIAL ENERGY OF INDIUM TIN OXIDE THIN FILM MODIFIED WITH ORGANIC SEMICONDUCTOR MATERIAL BASED ON PHENYL GROUP

This study focuses on surface characterization of modified indium tin oxide (ITO) for potential applications as anode in organic electronics devices. [4-iodophenyl]-silanetriol molecules were coated by self-assembled monolayers method on ITO surface. Kelvin Probe Microscopy, Scanning Tunneling Microcopy and X-ray Photoelectron Spectroscopy techniques were used to analyze the modified ITO surface. The results show that organic semiconductor material based on Phenyl group enhance surface morphology and increase the surface potential energy of ITO around [Formula: see text][Formula: see text]meV and contribute the tunneling current that inject from Fermi energy level of the ITO. This study includes the influence of surface interactions on electrochemical and spectral features of compounds. The results are important in developing surface structures in amorphous layers, better understanding the mechanism of creation of such structures on ITO surface.

Surface-Modified Halloysite Nanotubes as Electrochemical CO2 Sensors

The outer surface of halloysite nanotubes (HNTs) was selectively modified using (3-aminopropyl)triethoxysilane (APTES) via a self-assembled monolayer (SAM) method. The product of this reaction, ami...

Next generation nanopatterning using small molecule inhibitors for area-selective atomic layer deposition

Area-selective atomic layer deposition (ALD) is an approach to self-aligned, bottom-up nanofabrication with the potential to overcome many of the challenges facing the semiconductor industry around continued device downscaling. Currently, the most common method for achieving area-selective ALD uses self-assembled monolayers (SAMs) as a means of surface deactivation. Alternative routes are also being pursued that may better meet the demands of high-volume device manufacturing and overcome some disadvantages of the SAM method. One promising alternative is the use of small molecule inhibitors (SMIs). This Perspective provides an overview of the current developments in the use of SMIs for selective deposition by describing systems from the literature and providing insight into SMI selection. Although little is yet known about the mechanistic behavior of SMIs, this Perspective aims to lay the framework for both a better understanding of their inhibitive performance and strategies to innovate their design. It establishes two key interfaces—between the ALD precursor and the inhibitor, and between the inhibitor and the substrate—and discusses the role of each in selective deposition. Building upon the established understanding of SAMs together with current knowledge of SMIs, this Perspective aims to define guiding principles and key considerations for improving SMI design.

Optical biosensor for biogenic amines detection used a porous silicon matrix

The content of biogenic amines has been studied due to the toxicity of these compounds in humans when are consumed exogenously, and is used as an indicator of quality in the food industry. The manly method for its determination is high performance liquid chromatography. However, it requires a long time for analysis. An alternative method is the use of biosensors, porous silicon with gold nanoparticles were obtained by electrochemical attack assisted with metal salt. These substrates were used for the construction of a biosensor capable of detecting BA using diamine oxidase enzyme as an element of biological recognition and is binding using the self-assembled monolayers method. The correlation between scanning electron microscopy, X-ray dispersive energy spectroscopy, and Fourier Transform infrared spectroscopy analysis, demonstrated the correct construction of the biosensor and the detection of biogenic amines by interaction with the enzyme. Finally, with the built biosensor it was possible to detect three important biogenic amines found in food.

Electrical Characteristics of Molecular Junctions Fabricated by Inverted Self-Assembled Monolayer Method

In this study, we demonstrated the molecular ensemble junctions fabricated by the inverted selfassembled monolayer (iSAM) method in which the molecular layer was deposited on the top electrode surface. The alkyl thiolate molecules were used to benchmark this method and we found that the electrical characteristics of these molecular junctions were comparable to the results reported previously by performing statistical analysis. We expect this iSAM method to enable the molecular junctions with bottom electrode of various materials.

Polyethyleneimine-Modified Quartz Crystal Microbalance and its Characteristics for Detecting Acetic Acid

Acetic acid is a clear liquid with a strong smell of acids. The danger of inhaling acetic acid vapors may cause irritation of the nose and throat. At high vapor levels, acetic acid may cause respiratory inflammation and can cause eye irritation and eye damage permanently. New detection methods of acetic acid are urgently required especially for practical applications. In this study, the acetic acid vapor sensor was developed by depositing polyethyleneimine (PEI) layer onto the two QCM substrates using well-known self-assembled monolayers (SAM) method. As results, the sensor was less sensitive to humidity. The sensor also showed high sensitivity and limit of detection limit (0.85 mg/L) to acetic acid.

Effective Construction of a High-Capacity Boronic Acid Layer on a Quartz Crystal Microbalance Chip for High-Density Antibody Immobilization.

Boronic acids (BAs) provide strong potential in orientation immobilization of antibody and the modification method is crucial for efficiency optimization. A highly effective method has been developed for rapid antibody immobilization on gold electrodes through the electrodeposition of a BA–containing linker in this study. Aniline-based BA forms a condense layer while antibody could automatically immobilize on the surface of the electrode. Compare to traditional self-assembled monolayer method, the electrodeposition process dramatically reduces the modification time from days to seconds. It also enhances the immobilized efficiency from 95 to 408 (ng/cm2) with a strong preference being exhibited for shorter aniline-based linkers.

Electrocatalytic Behaviour of Surface Confined Pentanethio Cobalt (II)Binuclear Phthalocyanines Towards the Oxidation of 4-Chlorophenol

Cobalt binuclear phthalocyanine (CoBiPc) bearing pentanethio substituents at the peripheral positions were synthesized. The immobilization of the synthesized cobalt phthalocyanines on gold electrode was achieved using self-assembled monolayer method (SAM). X-ray photoelectron spectroscopy (XPS) and Kelvin Probe (KP) techniques were used to characterise the formation of monomeric and binuclear phthalocyanine SAMs on the gold surface. The phthalocyanine SAMs on gold electrodes were investigated for electrocatalytic oxidation of 4-chlorophenol. The electrocatalytic properties of tetra- and octa- pentanethio substituted cobalt binuclear phthalocyanine (CoBiPc) are compared with their tetra- and octa-pentanethio substituted phthalocyanine (CoPc). The SAMs modified gold electrode surfaces showed a peak current enhancement and stability and reduction in electrocatalytic potentials compared to the bare or unmodified electrodes towards the detection of the 4-chlorophenol. The SAMs of cobalt binuclear phthalocyanines exhibited more enhanced electrocatalytic properties in terms of stability, detection peak current and reduction of the electrocatalytic over potential reduction.

Detection of Odontoglossum Ringspot Virus Infected Phalaenopsis Using a Nano-Structured Biosensor

In this study, a highly sensitive biosensor based on a 3D nano-structured sensing electrode made from an anodic aluminum oxide (AAO) barrier layer with the uniform distribution of gold nanoparticles (GNPs) is proposed for label-free detection of orchid viruses. This nanostructured electrode was utilized for developing a label-free sensing system based on electrochemical impedance spectroscopy (EIS) to directly detect the Odontoglossum ringspot virus (ORSV) concentration from orchid leaves. The ORSV antibody (anti-ORSV) was employed as a detecting probe and was covalently immobilized on the nanostructured sensing electrode surface through a self-assembled monolayer (SAM) method. Through a selective binding interaction between specific antigen and antibody pairs, our nanostructured biosensors can provide a high specificity and accuracy sensing result. Our experimental results revealed that the specific binding of ORSV onto the immobilized anti-ORSV gave rise to the incremental interfacial charge transfer resistance of the electrode, allowing one to distinguish between healthy and infected orchids in a fast and accurate manner. The linear detection range is 50,000 ng/mL–0.5 ng/mL with R2 = 0.9686. A detection limit of 0.345 ng/mL can be achieved. These results demonstrated that our ORSV biosensor is feasible for field applications.

Electrocatalytic behaviour of surface confined pentanethio cobalt (II) binuclear phthalocyanines towards the oxidation of 4-chlorophenol

Cobalt binuclear phthalocyanine (CoBiPc) bearing pentanethio substituents at the peripheral positions were synthesized. The immobilization of the synthesized cobalt phthalocyanines on gold electrode was achieved using self-assembled monolayer method (SAM). X-ray photoelectron spectroscopy (XPS) and Kelvin Probe (KP) techniques were used to characterise the formation of monomeric and binuclear phthalocyanine SAMs on the gold surface. The phthalocyanine SAMs on gold electrodes were investigated for electrocatalytic oxidation of 4-chlorophenol. The electrocatalytic properties of tetra- and octa- pentanethio substituted cobalt binuclear phthalocyanine (CoBiPc) are compared with their tetra- and octa-pentanethio substituted phthalocyanine (CoPc). The SAMs modified gold electrode surfaces showed a peak current enhancement and stability and reduction in electrocatalytic potentials compared to the bare or unmodified electrodes towards the detection of the 4-chlorophenol. The SAMs of cobalt binuclear phthalocyanines exhibited more enhanced electrocatalytic properties in terms of stability, detection peak current and reduction of the electrocatalytic over potential.

Effect of TiO2 modification with amino-based self-assembled monolayer on inverted organic solar cell

The effects of surface modification of titanium dioxide (TiO2) on the performance of inverted type organic solar cells (i-OSCs) was investigated in this study. A series of benzoic acid derivatized self-assembled monolayer (SAM) molecules of 4′-[(hexyloxy)phenyl]amino-3,5-biphenyl dicarboxylic acid (CT17) and 4′-[1-naphthyl (phenyl)amino]biphenyl-4-carboxylic acid (CT19) were utilized to modify the interface between TiO2 buffer layer and poly-3 hexylthiophene (P3HT):[6,6]-phenyl C61 butyric acid methyl ester (PC61BM) active layer having the device structure of ITO/TiO2/SAM/P3HT:PC61BM/MoO3/Ag. The work function and surface wetting properties of TiO2 buffer layer served as electron transporting layer between ITO and PC61BM active layer were tuned by SAM method. The solar cell of the SAM modified devices exhibited better performance. The power conversion efficiency (PCE) of i-OSCs devices with bare TiO2 electrodes enhanced from 2.00% to 2.21% and 2.43% with CT17 and CT19 treated TiO2 electrodes, respectively. The open circuit voltage (Voc) of the SAM treated TiO2 devices reached to 0.60V and 0.61V, respectively, while the Voc of untreated TiO2 was 0.57V. The water contact angle of i-OSCs with CT17 and CT19 SAMs was also higher than the value of the unmodified TiO2 electrode. These results show that inserting a monolayer at the interface between organic and inorganic layers is an useful alternative method to improve the performance of i-OSCs.

Corrosion Protection of Copper with Hybrid Sol-Gel Containing 1H-1, 2, 4-triazole-3-thiol

To improve the corrosion protection of copper metal, 0.01M concentration of 1H-1,2,4-triazole-3-thiol (TAT) was incorporated into the hybrid sol-gel monolayers containing 3-glycidoxypropyltrimethoxysilane (GPTMS) and Tetraethoxysilane (TEOS). It was further subjected to hydrolysis and condensation reaction to form a sol-gel matrix. The TAT-doped hybrid sol-gel coating was applied over the copper surface by Self-Assembled Monolayer (SAM) method. The resultant coating was characterized by Fourier Transform Infrared (FT-IR), X- RayDiffraction (XRD) analysis, Scanning Electron Microscopy (SEM) and Energy-Dispersive X-ray (EDX) spectroscopy. The corrosion protection ability of these coatings was evaluated by Electrochemical Impedance Studies (EIS) and Potentiodynamic Polarization (PP) measurements in 3.5% NaCl medium. The EIS and PP results showed that TAT doped hybrid sol-gel coating exhibit better corrosion protection than the undoped hybrid coating alone. Thus these studies revealed the enhancement of corrosion protection of TAT doped hybrid sol-gel coating on the copper metal surface.

Preparation of a high hydrophobic aluminium surface by double zincating process

In this present study, an efficient method has been proposed to develop a high hydrophobic zincated coating on the eva-core aluminium (Al) alloy surface. The double zincating method (Z2) was utilized to develop the required roughness on the Al surface. To control the surface energy, lauric acid (LA) was coated on the surface using the liquid self-assembled monolayers (L-SAMs) method. Surface morphology, the chemical composition of the treated and untreated Al alloy has been studied using scanning electron microscopy (SEM), atomic force microscopy (AFM), optical microscopy and X-ray diffraction (XRD), respectively. The hydrophobicity of the substrates has also been analysed using a contact angle measurement (CA). AFM micrographs show the surface roughness of the Al alloy has been drastically increased with chemical treatments from 0.071 to 0.32 μm. XRD shows the percentage crystallinity of the Al alloy is decreased with double zincating and LA coating from 56.8 to 22.7%. As a result, a high hydrophobicity of Al alloy was induced with a contact angle of 150° upon the double zincating method and L-SAMs coating.

Induced Infiltration of Hole-Transporting Polymer into Photocatalyst for Staunch Polymer-Metal Oxide Hybrid Solar Cells.

For efficient solar cells based on organic semiconductors, a good mixture of photoactive materials in the bulk heterojunction on the length scale of several tens of nanometers is an important requirement to prevent exciton recombination. Herein, we demonstrate that nanoporous titanium dioxide inverse opal structures fabricated using a self-assembled monolayer method and with enhanced infiltration of electron-donating polymers is an efficient electron-extracting layer, which enhances the photovoltaic performance. A calcination process generates an inverse opal structure of titanium dioxide (<70 nm of pore diameters) providing three-dimensional (3D) electron transport pathways. Hole-transporting polymers was successfully infiltrated into the pores of the surface-modified titanium dioxide under vacuum conditions at 200 °C. The resulting geometry expands the interfacial area between hole- and electron-transport materials, increasing the thickness of the active layer. The controlled polymer-coating process over titanium dioxide materials enhanced photocurrent of the solar cell device. Density functional theory calculations show improved interfacial adhesion between the self-assembled monolayer-modified surface and polymer molecules, supporting the experimental result of enhanced polymer infiltration into the voids. These results suggest that the 3D inverse opal structure of the surface-modified titanium dioxide can serve as a favorable electron-extracting layer in further enhancing optoelectronic performance based on organic or organic-inorganic hybrid solar cell.