In silico modelling of ciprofloxacin specific aptamer for the development of high-performance biosensor

Abstract

Ciprofloxacin (CFX), a widely used fluoroquinolone antibiotic, is critical in healthcare settings for treating patients. However, improper treatment of wastewater from these facilities can lead to environmental contamination with CFX. This underscores the need for an efficient, straightforward method for early detection. In this study, a DNA aptamer was selected through a hierarchical docking workflow, and the stability and interactions were assessed by Molecular Dynamics (MD) simulation. The aptamer-CFX complex that showed the most promise had a docking score of −8.596 kcal/mol and was further analyzed using MD simulation and MM/PBSA. Based on the overall results, the identified ssDNA sequence length of 60 nt (CAGCGCTAGGGCTTTTAGCGTAATGGGTAGGGTGGTGCGGTGCAGATATCGGAATTGGTG) was immobilized over a gold transducer surface through the self-assembled monolayer (SAM; Au–S-ssDNA) method. The ssDNA-modified surface has demonstrated a high affinity towards CFX, which is confirmed by cyclic voltammogram (CV) and electrochemical impedance spectroscopy measurements (EIS). The DNA-aptamer modified electrode demonstrated a good linear range (10 × 10−9 – 200 × 10−9 M), detection limit (1.0 × 10−9 M), selectivity, reproducibility, and stability. The optimized DNA-aptamer-based CFX sensor was further utilized for the accurate determination of CFX with good recoveries in real samples.