Safety Cabinet Research Articles

Update on methods used for mycological testing: wide diversity and opportunities for improvement persist

Past analysis of laboratory methods used for mycology specimens revealed significant variation in practices, many of which fell short of recommended procedures. In 2016 these findings led to a set of recommendations for laboratories to consider modification of their methods where appropriate, to analyse current laboratory methods used by participants in the Royal College of Pathologists of Australasia Quality Assurance Programs (RCPAQAP) Mycology module, and to compare these to the 2016 recommendations. Seven test items, with 105-107 participants each, were analysed. Several laboratories (7-12%) did not handle specimens as recommended in an appropriate biological safety cabinet. Direct microscopy was not performed on tissue specimens 23-25% of the time. The most used staining method was potassium hydroxide with an optical brightener for fluorescent microscopy (49%) followed by Gram stain (33%). While 17-25% of laboratories used three or more media, use of four or more was uncommon (<3%). Between 9-13% of participants used only a single non-inhibitory medium for cultures. Urine specimens were incubated longer than recommended with 57% of laboratories incubating for >7days and 24% >21 days. Duration of incubation was shorter than recommended for several specimen types with 36% of skin specimens and 37-48% of tissue specimens being kept ≤21 days. For cultures kept >7 days, 13% were inspected daily, but for those incubating >14 days only 3%. The methods of several laboratories remain outside recommended practice. An updated set of recommendations are made.

Some Specific Biological Risks of SARS-CoV-2 Infected Syrian Hamsters at Animal Biosafety Level - Lab 3

The emergence of novel severe acute respiratory syndrome 2 (SARS-CoV-2) has prompted extensive research to identify its pathogenesis, transmission, and reservoir entry in animals. Syrian hamsters (Mesocricetus auratus) are being identified as an ideal animal model for the study of SARS-CoV-2 infection due to their susceptibility and respiratory symptoms similar to that observed in humans. This study focused on the specific biological risks associated with the use of infected Syrian hamsters in animal biosafety level 3 (ABSL-3) laboratories. The professional and psychological training of professionals working with laboratory animals should be a priority. Biological safety requires the involvement of all parties from technical staff to top management. The COVID-19 pandemic has shown a limitation in experimental studies when obtaining the right strain of mice proved difficult. A rare experimental model of Syrian hamsters started to be used in the work, which Syrian hamsters have several distinctive characteristics associated with increased aggressiveness of females, leading to a requirement to keep them isolated and some technical difficulties during manipulations in the biological safety cabinet. Therefore, a risk-based approach must be introduced to reduce the additional risks to workers to an acceptable level. This includes enhanced accuracy in the use of personal protective equipment (PPE), rigorously following biosecurity protocols, and monitoring staff health to detect potential risk of zoonotic transmission. The implementation of international standards and regulations on biological safety and biosecurity is of paramount importance.

Impact of cleanroom status on the reasons for discarding organ-cultured corneal transplants in a modern eye bank - More donor corneas thanks to astronaut suit?

This study investigated the influence of cleanroom conditions on the discard rates of donor corneas in a German university eye bank. Discard rates were analysed from 2017 to 2020 at the LIONS Cornea Bank at Saarland University Medical Center. 1941 corneas from 971 donors were included. 1262 corneas (65.1%) were stored in a class D cleanroom from 2017 to 2019 and processed in a cleanroom class A sterile bank (group 1). 679 corneas (34.9%) were continuously stored in a class B cleanroom and processed in a class A cleanroom safety cabinet in the same room from 2019 to 2020 (group 2). The target parameter of this work was the number of contamination-related discards. Although they cannot be influenced by the spatial conditions, the discards due to insufficient endothelial quality, serology, contraindications, scars and technical causes were also recorded. Statistical analysis was performed using SPSS and various testing procedures. In group 1, significantly more corneas were discarded due to positive serology (6.9%|3.8%, p = 0.020). There was no significant change between both groups for either contamination or the other reasons for discard. Optimization of hygiene standards from cleanroom class D to B did not reduce contamination. Serology, endothelial quality, medical contraindications and the presence of scars cannot be influenced by cleanroom conditions.

Longitudinal evaluation of environmental contamination with hazardous drugs by surface wipe sampling.

Exposure of healthcare workers to hazardous drugs can lead to adverse health effects supporting the importance of a continuous monitoring program, for example, by taking surface wipe samples. The objective was to describe the results of repeated monitoring of contamination with hazardous drugs on multiple surfaces in a hospital pharmacy and at two wards using standardized preparation techniques and cleaning procedures. Twelve surfaces in the hospital pharmacy and at two wards were sampled and analyzed for contamination with the hazardous drugs cyclophosphamide, doxorubicin, 5-fluorouracil, gemcitabine, methotrexate, and paclitaxel. The drugs were prepared with a closed-system drug transfer device (CSTD). Sampling of the drugs was performed in four trials during eight months. Liquid chromatography tandem mass spectrometry was used for the analysis of the drugs. During the four trials, contamination with five of the six hazardous drugs was found on half of the surfaces in the pharmacy and in a ward. Seventeen out of 288 possible outcomes were positive (6%), with the biological safety cabinet grate (n = 6) and scanner (n = 5) most frequently contaminated. The highest level of contamination was observed on the pass-thru window (cyclophosphamide: 2.90 ng/cm2) and the touch screen of the Diana device (5-fluorouracil: 2.38 ng/cm2). Both levels were below the action level of 10 ng/cm2. The long-term use of a CSTD in combination with appropriate cleaning has proven effective in achieving low levels of surface contamination with hazardous drugs.

Miniaturization of an enclosed electrospinning process to enhance reproducibility in the fabrication of rapidly dissolving cell-based biosensors.

There is broad interest in producing electrospun films embedded with biological materials. It is well known that electrospinning requires careful control of the process conditions, especially the environmental conditions such as relative humidity (RH). Given that commercial electrospinning systems are expensive (>$10,000) and are typically too large to be used in standard biological safety cabinets (BSC), we designed and built a miniaturized electrospinning box (E-Box) that will fit inside a BSC, and the RH can be easily controlled using simple instrumentation (gas cylinder, regulator, needle valve, rotameter). It uses an inexpensive computerized numerical control machine to control the spinneret positioning and collector rotational speed-all the parts for the device (except the syringe pump and voltage supply) can be purchased for approximately $1000. We demonstrate the usefulness of our design in optimizing the production of Escherichia coli-embedded pullulan-trehalose films to be used as rapidly dissolving biosensors for environmental monitoring. At a fixed electrospinning recipe, we showed that decreasing the RH from approximately 48% to 22% resulted in the average fiber diameter increasing from 240(±11) nm to 314(±8) nm. We also demonstrate the usefulness of our design in performing sequential electrospinning experiments to evaluate process performance reproducibility. For example, from just 1mL of a polymer solution, we produced 16 electrospun films (approximately 3cm by 8cm each)-from those films we hole-punched approximately 80 biosensor discs which were then used in subsequent experiments to determine the amount of two different biocides (Grotan BK and triclosan) in aqueous samples. The technique developed in this study is ideal for creating electrospun materials in high quantities that are highly reproducible through the precise control of RH.

Research on the development of composition and technology of an emulgel with a probiotic component for the treatment of infectious and inflammatory diseases

The aim was conducted research to develop the composition and technology of a new soft preparation under the conventional name "Probioskin" for topical use with a probiotic component in the form of an emulgel.&#x0D; Materials and methods of work. The homogeneity was determined by visual inspection of the experimental samples, using a biological microscope XSP-128 ULAB. The rheological (structural and mechanical) properties of the samples were studied using a Rheolab QC rheoviscosimeter (Anton Paar, Austria) with a C-CC27/SS coaxial cylinder system. The Rheolab QC rheometer is equipped with RheoPlus software. Microbiological studies and biotesting on a biological model of infusoria were performed under aseptic conditions of a laminar flow box (biological safety cabinet AC2-4E1 "Esco", Indonesia) of the Department of Biotechnology of the National University of Pharmacy. The identification of lactobacilli and the number of live cells as critical indicators of a preparation containing live microorganisms were performed at each stage of the study. Bacterioscopic control was carried out by examining smears prepared from samples of the dissolved drug and stained by Gram stain. Bacteriological control was performed by inoculation on thick MRS-4 medium and liquid MRS-1 medium. The number of live lactobacilli (when lactobacilli were co-cultured with the drug components at the stages of development and in the finished product) was determined by surface sowing on Petri dishes with thick MRS-4 medium; after 48 h of incubation at (37±1)°C, colonies grown on the surface of the medium were counted and the number of live lactobacilli expressed in CFU was calculated in 1 ml of the drug.&#x0D; Results and discussion. Based on the conducted research, the composition of a soft preparation for topical use containing dexpanthenol, lactic acid, lyophilized lactobacillus biomass, propylene glycol, peach oil, polysorbate-80, aristoflex AVC, tocopherol, and purified water was developed. The production process of the developed Probioskin product is carried out according to a standardized scheme and consists 8 stages: preparation of raw materials, preparation of oil concentrate of the probiotic component, preparation of aqueous concentrate of active substances, preparation of gel base, preparation of emulsion, dosing into tubes, packaging of tubes into packs, packaging of packs into group containers.&#x0D; Conclusions. On the basis of a complex research, the composition and rational technology of a soft preparation for topical use under the conventional name "Probioskin" in the form of an emulsion was developed.&#x0D; Key words: pharmacological research, soft drug, emulgel, probiotics, dermatological diseases

Proposals of guidance values for surface contamination by antineoplastic drugs based on long term monitoring in Czech and Slovak hospitals and pharmacies.

The exposures to hazardous antineoplastic drugs (AD) represent serious risks for health care personnel but the exposure limits are not commonly established because of the no-threshold effects (genotoxic action, carcinogenicity) of many ADs. In this study, we discussed and derived practically applicable technical guidance values (TGV) suitable for management of AD risks. The long-term monitoring of surface contamination by eight ADs was performed in pharmacies and hospitals in the Czech Republic and Slovak Republic in 2008-2021; in total 2,223 unique samples were collected repeatedly in 48 facilities. AD contamination was studied by LC-MS/MS for cyclophosphamide, ifosfamide, methotrexate, irinotecan, paclitaxel, 5-fluorouracil and gemcitabine and by ICP-MS for total Pt as a marker of platinum-based ADs. The study highlighted importance of exposure biomarkers like 5-fluorouracil and especially carcinogenic and persistent cyclophosphamide, which should be by default included in monitoring along with other ADs. Highly contaminated spots like interiors of laminar biological safety cabinets represent a specific issue, where monitoring of contamination does not bring much added value, and prevention of staff and separated cleaning procedures should be priority. Rooms and surfaces in health care facilities that should be virtually free of ADs (e.g., offices, kitchenettes, daily rooms) were contaminated with lower frequency and concentrations but any contamination in these areas should be carefully examined. For all other working places, i.e., majority of areas in pharmacies and hospitals, where ADs are being prepared, packaged, stored, transported, or administered to patients, the study proposes a generic TGV of 100 pg/cm2. The analysis of long-term monitoring data of multiple ADs showed that the exceedance of one TGV can serve as an indicator and trigger for improvement of working practices contributing thus to minimizing of unintended exposures and creating a safe work environment.

Evaluation of the risk of occupational exposure to antineoplastic drugs in healthcare sector: part I - medical gloves.

Antineoplastic drugs (ADs) are essential tools in cancer treatment, but their cytotoxicity poses a risk to workers involved in their handling. In a hospital environment fundamental strategies for minimising exposure involve proper use of safety cabinets and closed-circuit transfer devices, along with personnel training and increased awareness of risks. However, medical gloves remain the first line of defence. In this respect the evaluation of glove materials and best choices can improve hospital safety management and prevent potential hazards and long-term consequences. The aim of this study was to assess contamination of gloves in samples taken from AD administration and preparation units of nine Italian hospitals and to raise awareness of the importance of evaluating chemico-physical properties of gloves. Our findings show that 33 % of the analysed gloves were positive for at least one AD, with contaminations ranging from 0.6 to 20,729 pg/ cm2. We proposed the alert glove values (AGVs) for each AD as a limit value for contamination assessment and good practice evaluation. Our findings also point to multiple AD contamination (43 % of positive findings in preparation units), calculated as total AGV (AGV-T), and confirm that gloves should be replaced after 30 min of AD handling, based on cumulative permeation and area under the curve (AUC), to maintain safety and limit dermal exposure.

First report of Fusarium graminearum causing Fusarium Head Blight (FHB) of wheat and barley in Lower Mainland of British Columbia, Canada.

Fusarium head blight (FHB), predominantly caused by Fusarium graminearum is one of the most economically important fungal diseases of small-grain cereals. Since the early 1990s, FHB has been a devastating wheat disease in parts of Canada and the United States, causing significant economic impacts on the cereal grain industry through reduced seed quality and yield, and grain contamination with fungal toxins (Brar et al. 2019). Spikes of wheat and barley with bleached spikelets and pinkish coloration were observed with low incidence and high severity in August 2021 field stripe rust nursery at UBC Totem Plant Science Farm in Vancouver, Canada (Supplementary File 1). FHB-like Symptomatic spikes were collected during the growing season. The Fusarium damaged kernels (FDK) were surface-sterilized with 1% sodium hypochlorite (NaOCl) for 1.5 min, rinsed three times in distilled water and dried using sterile filter paper discs in Biological Safety Cabinet. The kernels were placed on Petri dishes containing three layers of moist blotter papers and incubated in the dark at 22-25°C for 24 hours. The Petri dishes were transferred into a -20°C freezer for 24 hours, followed by five days of incubation at 22-25°C under fluorescent light, during which distilled water was added onto blotter papers every day to maintain moisture. After incubation, mycelium growing on kernels was transferred to potato dextrose agar (PDA) media and subcultured based on the colony and conidial morphology of F. graminearum (Leslie and Summerell 2006). The colonies selected grew white mycelia with a pink pigment at the bottom. Macroconidia with five to six septate were produced after seven days and microconidia were absent. Seven isolates derived from different wheat samples were derived from single conidia and identified based on amplicon sequencing using a MinION Flongle flow cell described by Boutigny et al. (2019). Reads which passed the integrated MinKNOW quality control step were mapped to the Partial translation elongation factor 1- α (EF1a) gene, using primers EF1-F2 (5'TCATC GGCCACGTCGACTCT3') and EF1-R3 (5'TACCAGCCTCGAACTCACCA3'). The consensus sequence for each sample was aligned to the reference sequence (JF740867.1) using BLASTn, revealing all the similarities of more than 99.5% (Supplementary File 2). The morphological characteristics (colony, pink pigment, shape of macroconidia, absence of microconidia) (Leslie and Summerell, 2006) and sequencing results indicated that the seven isolates from wheat were F. graminearum of the 3ADON chemotype. Besides, Koch's postulates were performed by spray-inoculating healthy inflorescences of eight wheat plants derived from the cross Avocet/CDC Silex at half anthesis stage (one isolate per plant and one non-inoculated control). Each spike was thoroughly sprayed with 1ml of spore suspension containing 5 × 104 conidia per ml (4-5 spikes per plant). The spikes on one plant were treated with distilled water (1 ml per spike) as a blank control. The inoculated spikes were covered with moist plastic bags for 48 hours, and the plants were placed in a growth chamber under a 12-h photoperiod at 18°C. Seven days later, spikes of the spores-treated plants exhibited bleached spikelets, which is a typical symptom of FHB, and there was no disease on the control plant. F. graminearum was re-isolated from FDK of diseased spikes using the isolation methodology and identified by morphology described above. To our knowledge and based on a literature review, this is the first report of F. graminearum causing FHB on wheat and barley in the Lower Mainland of British Columbia. The reason for the concealment of F. graminearum in BC might be the small acreage of commercially grown small-grain cereals. Further, there is limited cultivation of winter wheat and barley in the region for forage/silage, but the crops are harvested at the soft dough stage leaving limited grain/spike residue for the next crop. While presently there is very low acreage of cereal host crops of F. gramineraum in Lower Mainland, this acreage might increase in future years as winter cereals are slowly expanding in the region as cover crops, forages, and even grain production for sale to forgae producers or for local breweries in case of barley; therefore, finding of F. gramineraum could have economic consequences on cereal production in the region in future. Further investigation is needed to better understand the aggressiveness of the strains and their population structure of the pathogen in the Region.

The Use of Hypochlorous Acid, Test-and-removal, and Cross-fostering to Eradicate Mouse Pathogens in an Animal Facility.

Hypochlorous acid (HOCl), used as a liquid or a fog, has broad antimicrobial and deodorizing effects. Our facility was the first in Taiwan that was built with a system to supply stabilized, biosafe HOCl solution (50 ppm available chlorine concentration, pH 6) into a new animal barrier facility that housed genetically modified mice. The HOCl system creates an extremely clean environment that allows us to raise mice in static, filter-top cages and to handle them on open tables without the need for biologic safety cabinets (BSC). Our animal facility (AF) sometimes receives mice from outside sources that are infected with pathogens, notably murine norovirus (MNV), Helicobacter spp., and trichomonads. We found that our standard operation procedure (SOP) prevented cross-contamination to other mice, including those in adjacent cages. After the removal of infected mice from a room, the remaining mice remained uninfected, without the need for extensive environmental decontamination. Learning this allowed us to use a test-and-removal method to eliminate pathogens. In addition, infected mouse strains that were not commercially available were rederived by using cross-fostering. After finding unexpected infections, we were able to identify all infected mice by widespread screening. We then removed contaminated cages and performed cross-fostering as needed. This approach was able to successfully eliminate murine norovirus, Helicobacter spp., and trichomonads. Over the 12 y in which we managed this AF, we refined our husbandry methods and our approach to the detection and eradication of pathogens by using HOCl fog and solution, the test-and-removal, and cross-fostering.

Occupational protection effect of two protective devices for manual cleaning and oiling of dental handpieces on operators

Objective: To explore the occupational protective effect of different protective devices on the operators during manual cleaning and oiling of dental handpieces, and to provide a basis for the selection of appropriate protective methods. Methods: From November 2020 to December 2021, 20 high-speed dental handpieces of the same brand were selected and randomly divided into disposable protective bag group and small aerosol safety cabinet group by drawing lots, with 10 in each group. After recording the model, they were distributed to the clinical fixed consulting room for use, and were collected by specially-assigned personnel every day for manual cleaning under the protection of the two devices. By measuring the number of airborne colonies, the concentrations of particulate matter and the satisfaction of operators, the occupational protection effect of the two protective devices on operators was evaluated. Results: Under the protection of the two devices, the average number of airborne colonies after operation was less than 1 CFU/ml. When no protective device was used, the number concentration of particulate matter produced during operation was (21595.70±8164.26) pieces/cm(3). The number concentrations of particles produced by disposable protective bag group [ (6800.24±515.05) pieces/cm(3)] and small aerosol safety cabinet group [ (5797.15±790.50) pieces/cm(3)] were significantly lower than those without any protective device (P<0.001). The number concentration of particle matter of small aerosol safety cabinet group was significantly lower than that of disposable protective bag group (P<0.001). In the satisfaction evaluation of operators, small aerosol safety cabinet group [ (3.53±0.82) points] was significantly better than disposable protective bag group [ (2.23±1.10) points] (P<0.001) . Conclusion: The use of small aerosol safety cabinet during manual cleaning and oiling of dental handpieces has good protective effect, superior safety performance and strong clinical applicability, and has advantages in occupational protection of clinical operators.

New concept infusion pump with an anticancer drug exposure prevention function.

e18722 Background: In recent years, cancer chemotherapy has taken measures to prevent exposure to anticancer drugs. Major exposure prevention measures include the use of safety cabinets and closed dispensing devices during preparation, closed infusion sets, and patient education to avoid exposure to the surrounding environment, such as through defecation. On the other hand, the closed circuit needs to be opened after the continuous infusion pumping of anticancer drugs, and the risk of exposure to anticancer drugs during this process remains an issue. In response to this issue, we aimed to develop a pump with an anticancer drug exposure prevention function. Methods: We designed a pump for the continuous infusion of anticancer drugs equipped with an additional circuit in the pump vessel for root flushing and heparin lock without opening the closed circuit. The additional circuit was connected downstream of the continuous infusion flow control mechanism to allow the circuit to be flushed without opening the closed circuit. Results: We successfully developed a continuous infusion pump (PCT/JP2020/017083) with anticancer drug exposure protection. Our newly developed hexagonal cylindrical pump (length: 6 cm; width: 6 cm; height: 13.5 cm) is portable, lightweight (70 g), has a maximum capacity of 85 mL, and allows 46-h continuous infusion of anticancer drugs such as FOLFOX, FOLFIRI, FOLFOXIRI, and FOLFIRINOX. The port for flushing is covered with a sterile seal to keep it clean until use. Our new pump eliminates the risk of releasing routes filled with anticancer drugs and prevents unnecessary exposure to anticancer drugs by handlers such as health-care professionals, patients, family members, and caregivers. Furthermore, the risk of infection is reduced as the system can be cleaned while closed. Conclusions: Our newly developed infusion pump with an anticancer drug exposure prevention function may help enable the next generation of cancer drug exposure prevention measures. Support: Japan Agency for Medical Research and Development, Medical Innovation Project, Development and Commercialization Project (Adoption No.: 21he0122019j000).

UV Sterilization Biological Safety Cabinet

Abstract: In the past three years COVID-19 has been a major health concern. The World Health (WHO) Organization declared COVID-19 as a pandemic and WHO said that the chances of more pandemics happening in near future are very high. To avoid such pandemics basic safety measures, have to be taken seriously such as sanitization and sterilization. COVID-19 was identified to be transmitting through various mediums such as currencies, cards, daily household objects, medical supplies and etc. Things like PPE kit, surgical masks and N95 respirators are crucially important for the safety of patient and medical personnel working during the pandemic. Due to the pandemic the demandof safety kits outnumbered the supply and medical professionals were left to use the already used PPEkits. The primary goal of the Biological Safety Cabinet(BSC) is to sterilize things like medical equipment anddaily use objects. Ultraviolet (UV) light is used for the purpose of disinfection or sterilization of rooms and surfaces. UV-C has germicidal properties but it is also harmful for human beings. Hence, for the purpose of sterilization without human interference, a UV BSC has been designed to sterilize daily use objects and medical essentials.

Knowledge and Practice of Medical Technologists on COVID-19 Infection Prevention in Laboratory

Background: COVID-19 is an acute respiratory condition caused by a virus and it is declared at pandemic condition. Health sector faced challenged and medical technologists are direct contact of infected patients and sample. Objective: The study was to assess the knowledge and practice of medical technologists on COVID-19 infection prevention in laboratory in tertiary level hospital and institute Dhaka city. Methodology: A descriptive cross-sectional study was conducted among purposive selected 221 medical technologists working in six hospital and institute (public hospital &amp; public institute) in Bangladesh. Data were collected by self-administrated structure questionnaire. Results: The study n-221 revealed that 100% respondents had knowledge about doing and doffing of PPE, 100% of the respondents had known that RT-PCR was confirm test for COVID-19 infection, 100% of the respondents had known about caused of COVID-19 by virus, 75.1% of the respondents were not getting training about COVID-19 sample packaging and 64.3% of the respondents were not getting training in laboratory safety against COVID-19 infection. Around 99.5% of respondents use color code bin for waste disposal, around 99.5% of the respondents were used respiratory safety cabinet and highest 96.8% of the respondents were used PPE during samples processing. Conclusion: Through periodic training and motivation, adequate supply of resources and infection prevention materials, quarantine facility for medical technologists should be available in hospital and institute that can improve overall knowledge and practice on COVID-19 infection prevention of medical technologists.

Relevance of Project Evaluation and Review Technique (PERT) for Procurement of Equipments in a Government Medical College and Hospital in North-East India

Introduction: Continuous procurement of various equipments in the hospitals is essential to keep up with global progress of healthcare services. In public sectors, procurement process largely depends on budget sanctions and also by a number of formal procedures and rules which leads to delayed procurement. With this prevalent scenario, the present study was carried out to evaluate the procurement of two major equipments in an apex tertiary care institute using Project Evaluation and Review Technique (PERT). Objective: This study was done to evaluate the procurement of two major equipments using PERT in a tertiary care institute. Method: This study was conducted using Operational Research technique in an apex tertiary care institute i.e., medical college and hospital, in one of the North Eastern states of India. All the procurements related to equipments in that teaching hospital initiated in the financial year 2021 were listed. Out of them, two procurement files were selected by simple random sampling; procurement of Operating Table and Bio Safety cabinet Level – III. Project Evaluation and Review Technique (PERT) was applied to calculate the possible reduction in time in the whole procurement process. Results: The present study showed that procurement of Operating table took 185 days where minimum 8 days could have been saved and procurement of Bio-Safety cabinet Level-III was completed by 702 days where minimum 196 days could have been saved. Conclusion: Application of PERT in this procurement evaluation process can play significant role by calculating critical path and predicting the possible delay.

A Nationwide Survey on Detection of Chlamydia trachomatis in Health Facilities in China.

This study evaluated the clinical laboratory capacity for the diagnosis of Chlamydia trachomatis (CT) in China to provide recommendations to improve the diagnostic capacity and quality of this clinically important sexually transmitted disease. An electronic questionnaire-based cross-sectional, survey study was conducted by the National Center for STD Control among different types of healthcare facilities in China from July to December 2021. The surveyed laboratory facilities were located in 332 cities in 31 provinces in China. A total of 4640 records from clinical laboratories were included in the data set for the final analysis. Less than half of the laboratories (41.6% [1931 of 4640]) performed the CT diagnostic test; of these, 721 laboratories (15.5% [721 of 4640]) carried out nucleic acid amplification test (NAAT) methods, and 1318 laboratories (28.4% [1318 of 4640]) performed antigen-based immunochromatographic assays. Most laboratories were equipped with biological safety cabinets (93.7% [4348 of 4640]), 49.2% (2283 of 4640) were equipped with fully automated nucleic acid extractors, and 55.2% (2560 of 4640) were equipped with polymerase chain reaction amplification instruments. The laboratories from Southern China or third-class hospitals (i.e., the highest rated hospitals) had the highest proportion using NAATs to diagnose CT among the surveyed health facilities. Advancing laboratories to use NAAT to detect CT should be phased step-by-step by different areas and levels of hospitals according to the current situation.

Container closure integrity testing and process validation of closed system transfer devices for aseptic reconstitution of drug vials connected to fluid bags

ObjectivesThe closure integrity and process validation of closed system transfer devices (CSTDs) should be confirmed before implementation in clinical settings. We aimed to investigate the closure integrity and validate the...

Handheld virus concentration method using a hollow fiber filter module

A virus concentration method is required for viral vaccine manufacturing and virus-related research. However, concentration methods, such as ultracentrifugation, often require capital investment. We report a simple and easy-to-use handheld syringe method for virus concentration using a hollow fiber (HF) filter module, which can be applicable to viruses of different sizes, without incorporating any special machines or reagents. This virus concentration method does not use pumps, which might cause shear stress for virus particles; therefore, it is useful for stress-sensitive virus particles, and virus-like particles, as well as other proteins.The clarified harvest of flavivirus (Zika virus) was concentrated using an HF filter module and compared with a centrifugal ultrafiltration device (CUD) for demonstration of the HF filter method. The HF filter method achieved concentration of the virus solution in less time than the CUD. The yield comparison of the recovered virus solution indicated that recovery from the developed method was comparable to using the CUD, and infectivity was maintained throughout.•The Zika virus was concentrated from 200 mL to 5 mL within 45 min using the HF filter and handheld syringe module method.•The handheld HF filter method may be applicable to stress-sensitive viruses and proteins of different sizes.•The virus concentration process should be conducted in a safety cabinet, which is preferred for virus containment.

Digital Twin for biological safety cabinet to reproduce performance and field certification test specified by NSF/ANSI 49 - 2019

The airflow balance test to confirm the physical performance of biological safety cabinets (BSC) is standardized by JIS K 3800 in accordance with NSF/ANSI 49 in Japan. In the test, Bacillus atrophaeus spores are used as an evaluation index, which poses a few limitations, such as their dependence on the environmental conditions to be tested. The aim of this study is to develop BSC digital twins and discuss reasonable alternatives for performance evaluation tests while maintaining the accuracy of the bacterial test performance. Herein, we provide the outline of a digital twin model for BSCs and the results of a numerical analysis, where a passive scalar is used as an alternative pollutant in the evaluation index.

A review of medical devices used for safe chemotherapy applications: Focus on ONCOERA® IV GROUP products.

The healthcare workers and the workers in the manufacturing industry of chemotherapy drugs are exposed to the "hazardous" effects of these drugs during production, transportation, distribution, administration, and disposal. In order to be protected from these harmful effects, personal protective equipment and medical devices providing safe applications are used. The aim of the present article is to review of medical devices used for safe chemotherapy applications in line with the information obtained from the literature. The international and national reliable sources, were used in the literature review for data analysis by using the keywords including chemotherapy, chemotherapy drugs, antineoplastic drugs, cytotoxic drugs, hazardous drugs, exposure to chemotherapy drugs, side effects of chemotherapy drugs, closed-system drug transfer devices, healthcare staff, needle-free devices, needle-free connectors, surface contamination, and phthalates. In order to minimize cytotoxic drug exposure, international standards were developed in the mid-1980s stating that all cytotoxic drugs should be prepared preferably in a ventilated biological safety cabinet, nurses dealing with the use of these drugs should use appropriate personal protective equipment, and in case of cytotoxic drug spillage, predefined cleaning and decontamination protocols should be followed. Although the risk of acute and long-term toxic effects in healthcare workers has decreased in recent years with these applications in the preparation and administration of cancer drugs, measurable contamination occurs in the workplace. A large number of medical devices have been developed for minimizing this type of contamination with chemotherapy drugs. In this article, these medical devices have been reviewed in detail under subtitles of closed system transfer devices, needle-free devices, and valve technology. Until the results of the evaluations to be made in new studies prove the opposite, the use of these devices with additional protection measures taken, especially during the application of dangerous drugs, is of great importance in terms of patient and employee safety.