Role Of Coactivators Research Articles

Recent advances in basic research on prostate cancer: Where we are heading?

In the over 80 years since androgens were found to play a pivotal role in prostate cancer (PCa) progression, androgen deprivation therapy (ADT) has been a cornerstone in treating advanced PCa. Castration-resistant PCa persists, however, with some of these tumors evolving to androgen receptor (AR)-independent forms like neuroendocrine PCa. The development of novel diagnostic and therapeutic approaches to PCa is therefore crucial. This review provides an overview of recent basic research in PCa, focusing on two main areas: PCa cells and their tumor microenvironments. The first section describes current knowledge on the intricate mechanisms of AR signaling pathways, emphasizing the roles of coactivators and chromatin state alterations in gene regulation. Genomic analyses have revealed recurrent mutations and copy number alterations critical for precision medicine. Liquid biopsy has become a promising tool for real-time tumor monitoring, identifying genetic alterations in circulating-tumor DNA or extracellular vesicles. The second section describes the tumor microenvironment of PCa, highlighting its immunosuppressive landscape and the potential of combining ADT with immunotherapy. Advanced techniques, including single-cell RNA sequencing and spatial transcriptomics offer insights into cellular heterogeneity and interactions within the tumor microenvironment, paving the way for novel therapeutic strategies. Integration of these diverse research areas will provide a comprehensive understanding of the current state and future directions of PCa research, underscoring the importance of personalized medicine and the dynamic nature of cancer treatment strategies.

Acetylcholine receptor-β inhibition by interleukin-6 in skeletal muscles contributes to modulating neuromuscular junction during aging

BackgroundAging-related strength decline contributes to physiological deterioration and is a good predictor of poor prognosis. However, the mechanisms underlying neuromuscular junction disorders affecting contraction in aging are not well described. We hypothesized that the autocrine effect of interleukin (IL)-6 secreted by skeletal muscle inhibits acetylcholine receptor (AChR) expression, potentially causing aging-related strength decline. Therefore, we investigated IL-6 and AChR β-subunit (AChR-β) expression in the muscles and sera of aging C57BL/6J mice and verified the effect of IL-6 on AChR-β expression.MethodsAnimal experiments, in vitro studies, bioinformatics, gene manipulation, dual luciferase reporter gene assays, and chromatin immunoprecipitation experiments were used to explore the role of the transcription cofactor peroxisome proliferator-activated receptor gamma coactivator 1-α (PGC1α) and its interacting transcription factors in the IL-6-mediated regulation of AChR-β expression.ResultsIL-6 expression gradually increased during aging, inhibiting AChR-β expression, which was reversed by tocilizumab. Both tocilizumab and the PGC1α agonist reversed the inhibiting effect of IL-6 expression on AChR-β. Compared to inhibition of signal transducer and activator of transcription 3, extracellular signal-regulated kinases 1/2 (ERK1/2) inhibition suppressed the effects of IL-6 on AChR-β and PGC1α. In aging mouse muscles and myotubes, myocyte enhancer factor 2 C (MEF2C) was recruited by PGC1α, which directly binds to the AChR-β promoter to regulate its expression.ConclusionsThis study verifies AChR-β regulation by the IL-6/IL-6R-ERK1/2-PGC1α/MEF2C pathway. Hence, evaluating muscle secretion, myokines, and AChRs at an earlier stage to determine pathological progression is important. Moreover, developing intervention strategies for monitoring, maintaining, and improving muscle structure and function is necessary.

MOF-derived high oxygen vacancies CuO/CeO2 catalysts for low-temperature CO preferential oxidation

The CO preferential oxidation reaction (CO-PROX) is an effective strategy to remove residual poisonous CO in proton exchange membrane fuel cells, in which oxygen vacancies play a critical role in CO adsorption and activation. Herein, a series of CuO/CeO2 catalysts derived from Ce-MOFs precursors were synthesized using different organic ligands via the hydrothermal method and the CO-PROX performance was investigated. The CuO/CeO2-135 catalyst derived from homophthalic tricarboxylic acid (1,3,5-H3BTC) exhibited superior catalytic performance with 100 % CO conversion at a relatively low temperature (T100% = 100 °C), with a wide reaction temperature range and excellent stability. The superior catalytic properties were attributed to the structural improvements provided by the 1,3,5-H3BTC precursors and the promotional effects of oxygen vacancies. Additionally, in-situ Raman spectroscopy was performed to verify the dynamic roles of oxygen vacancies for CO adsorption and activation, while in-situ DRIFTS analysis revealed key intermediates in the CO-PROX reaction, shedding light on the mechanistic aspects of the catalytic process. This work not only demonstrates insights into the effective CuO/CeO2 catalysts for CO preferential oxidation, but also provides a feasible way to synthesize MOF-derived catalysts.

Fibroblast Yap/Taz Signaling in Extracellular Matrix Homeostasis and Tissue Fibrosis.

Tissue fibrosis represents a complex pathological condition characterized by the excessive accumulation of collagenous extracellular matrix (ECM) components, resulting in impaired organ function. Fibroblasts are central to the fibrotic process and crucially involved in producing and depositing collagen-rich ECM. Apart from their primary function in ECM synthesis, fibroblasts engage in diverse activities such as inflammation and shaping the tissue microenvironment, which significantly influence cellular and tissue functions. This review explores the role of Yes-associated protein (Yap) and Transcriptional co-activator with PDZ-binding motif (Taz) in fibroblast signaling and their impact on tissue fibrosis. Gaining a comprehensive understanding of the intricate molecular mechanisms of Yap/Taz signaling in fibroblasts may reveal novel therapeutic targets for fibrotic diseases.

Effects of various load magnitudes on ACL: an in vitro study using adolescent porcine stifle joints

IntroductionThe escalating incidence of anterior cruciate ligament (ACL) injuries, particularly among adolescents, is a pressing concern. The study of ACL biomechanics in this demographic presents challenges due to the scarcity of cadaveric specimens. This research endeavors to validate the adolescent porcine stifle joint as a fitting model for ACL studies.MethodsWe conducted experiments on 30 fresh porcine stifle knee joints. (Breed: Yorkshire, Weight: avg 90 lbs, Age Range: 2–4 months). They were stored at − 22 °C and a subsequent 24-h thaw at room temperature before being prepared for the experiment. These joints were randomly assigned to three groups. The first group served as a control and underwent only the load-to-failure test. The remaining two groups were subjected to 100 cycles, with forces of 300N and 520N, respectively. The load values of 300N and 520N correspond to three and five times the body weight (BW) of our juvenile porcine, respectively.ResultThe 520N force demonstrated a higher strain than the 300N, indicating a direct correlation between ACL strain and augmented loads. A significant difference in load-to-failure (p = 0.014) was observed between non-cyclically loaded ACLs and those subjected to 100 cycles at 520N. Three of the ten samples in the 520N group failed before completing 100 cycles. The ruptured ACLs from these tests closely resembled adolescent ACL injuries in detachment patterns. ACL stiffness was also measured post-cyclical loading by applying force and pulling the ACL at a rate of 1 mm per sec. Moreover, ACL stiffness measurements decreased from 152.46 N/mm in the control group to 129.42 N/mm after 100 cycles at 300N and a more significant drop to 86.90 N/mm after 100 cycles at 520N. A one-way analysis of variance (ANOVA) and t-test were chosen for statistical analysis.ConclusionsThe porcine stifle joint is an appropriate model for understanding ACL biomechanics in the skeletally immature demographic. The results emphasize the ligament’s susceptibility to injury under high-impact loads pertinent to sports activities. The study advocates for further research into different loading scenarios and the protective role of muscle co-activation in ACL injury prevention.

Inhibition of TAZ impairs the migration ability of melanoma cells.

Malignant melanoma (MM) is characterized by rapid growth, frequent metastasis, and high mortality. Targeted therapy for MM is still a research hotspot due to the increasing understanding of the hippo pathway. The aim of this study is to investigate the role of transcriptional coactivator with PDZ-binding motif (TAZ) in MM tumorigenesis. Based on the database analysis, we found that the median mRNA expression of TAZ (5.4) was found to be similar to that of YAP (5.5) in 473 human melanoma specimens. However, in 63 MM cell lines, the median expression of TAZ (10.8) was expressed at a higher level than that of YAP (9.5), which was then validated in A375. TAZ down-regulation by siRNA decreased the migration (72%) and invasion (74%) abilities of A375. Furthermore, the down-regulation of TAZ inhibited the proliferation of A375 without affecting apoptosis. We subsequently blocked hippo signaling with verteporfin and found that verteporfin application decreased the number of migrating (63%) and invading (69%) cells, respectively. We further found that Cyr61 declined following TAZ down-regulation. Moreover, TAZ negatively correlates with melanoma patient's overall survival. Our data proved that TAZ contributed to MM metastasis, which might be a potential therapeutic target in the future.

Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’

Genes to CellsEarly View CORRECTIONFree Access Correction to ‘The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation’ This article corrects the following: The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation Norinaga Urahama, Mitsuhiro Ito, Akiko Sada, Kimikazu Yakushijin, Katsuya Yamamoto, Atsuo Okamura, Kentaro Minagawa, Akio Hato, Kazuo Chihara, Robert G. Roeder, Toshimitsu Matsui, Volume 10Issue 12Genes to Cells pages: 1127-1137 First Published online: October 31, 2005 First published: 06 March 2023 https://doi.org/10.1111/gtc.13012AboutSectionsPDF ToolsRequest permissionExport citationAdd to favoritesTrack citation ShareShare Give accessShare full text accessShare full-text accessPlease review our Terms and Conditions of Use and check box below to share full-text version of article.I have read and accept the Wiley Online Library Terms and Conditions of UseShareable LinkUse the link below to share a full-text version of this article with your friends and colleagues. Learn more.Copy URL Share a linkShare onFacebookTwitterLinkedInRedditWechat In the original version of Figure 1B, identical images of stained BFU-E cells were erroneously used for wild-type and knockout panels. Representative data from repeated experiments are now provided in corrected Figure 1B. The errors were in presentation only, and do not affect any results or discussion in the article. FIGURE 1BOpen in figure viewerPowerPoint It was also brought to the attention of the journal and the authors that in the original version of Figure 4A there were closely similar Northern blot images. Specifically, GAPDH lanes of 1,25-(OH)2D3-treated cells and background noises in VDH lanes of DMSO-treated cells were similar to GAPDH lanes and SRC-1 lanes of 1,25-(OH)2D3-treated cells in Figure 3, respectively; and TRAP220 lanes of control, TPA-treated and DMSO-treated cells at 0 hr were similar to each other. The authors have provided new versions of the figures as corrected Figure 4A by repeating experiments and measuring by RT-qPCR, a contemporary method that may be more accurate than Northern blot. This correction does not affect the results or conclusions of the work. The authors apologize for these mistakes. FIGURE 4AOpen in figure viewerPowerPoint Method for corrected Figure 4A: HL-60 cells were used to induce differentiation as described. Total RNAs (0.5 μg), isolated by using Isogen II (Toyobo), were used to reverse-transcribe by ReverTra Ace qPCR RT Master Mix with gDNA Remover (Toyobo) in triplicates. Then mRNAs were quantificated by using KOD SYBR qPCR Mix (Toyobo) and StepOnePlus Real-Time PCR System (Thermo Fisher). Values were normalized by the values for GAPDH, and means ± SD of relative values are shown. The sequences of the primers used for qPCR are as the followings: for TRAP220, GGCGGATCTAGCTTCTCCTC and CTTCTCCATGACTTGACGCAC; for VDH, TGCCAGCGATAATACGCCTC and TGGTGCTGACACAGGTGAAG; for CD38, CGCGATGCGTCAAGTACAC and TGCAAGGTACGGTCTGAGTTC; for gp91, ACTGCATGCTGATTCTCTTGC and TTCGAACTCTTGTTGAGCAGC; and for GAPDH, CAGCAAGAGCACAAGAGGAAG and ACATGACAAGGTGCGGCT. REFERENCE Urahama, N., Ito, M., Sada, A., Yakushijin, K., Yamamoto, K., Okamura, A., Minagawa, K., Hato, A., Chihara, K., Roeder, R.G., & Matsui, T. (2005). The role of transcriptional coactivator TRAP220 in myelomonocytic differentiation. Genes to Cells, 10(12), 1127– 1137. https://doi.org/10.1111/j.1365-2443.2005.00906.x Early ViewOnline Version of Record before inclusion in an issue FiguresReferencesRelatedInformation

Yeast Mediator facilitates transcription initiation at most promoters via a Tail-independent mechanism

Mediator (MED) is a conserved factor with important roles in basal and activated transcription. Here, weinvestigate the genome-wide roles of yeast MED by rapid depletion of its activator-binding domain (Tail) and monitoring changes in nascent transcription. Rapid Tail depletion surprisingly reduces transcription from only a small subset of genes. At most of these Tail-dependent genes, in unperturbed conditions, MED is detected at both the UASs and promoters. In contrast, at most Tail-independent genes, we findMED primarily at promoters but not at the UASs. These results suggest that MED Tail and activator-mediated MED recruitment regulates only a small subset of genes. Furthermore, we define three classes of genes that differ in PIC assembly pathways and the requirements for MED Tail, SAGA, TFIID, and BET factors Bdf1/2. Our combined results have broad implications for the roles of MED, other coactivators, and mechanisms of transcriptional regulation at different gene classes.

PGC-1α Is Indispensable in Purple Potato Promoted Intestinal Epithelial Differentiation and Mitochondrial Biogenesis

ObjectivesPurple potato (PP) is a good dietary source of polyphenol and promotes gut epithelial health. The objective of this study is to examine the impact of PP extract on mitochondrial biogenesis and evaluate the role of peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α in this.MethodsIn cultured colonic epithelial Caco-2 cells, the effects of PP extract on PGC-1α, cell differentiation, and markers of mitochondrial biogenesis, including mitochondrial DNA content, mitochondrial enzyme gene expression, and levels of metabolic intermediates, were first evaluated. Then, inhibition of PGC-1α induced by either inhibitor SR-18,292 or siRNA-mediated knockdown were used to evaluate its role in PP extract-promoted differentiation and mitochondrial biogenesis.ResultsPP extract up-regulated the level of PGC-1α, mitochondrial gene expression, mitochondrial DNA (mtDNA) copy number, and the level of citric acid cycle metabolites in Caco-2 cells. Inhibition of PGC-1α eliminated the enhancing effects of PP extract on the expression of differentiation markers, mitochondrial metabolites and mtDNA content, as well as the mRNA expression of mitochondria-encoded proteins.ConclusionsPP extract promoted the differentiation of intestinal epithelial cells, mitochondrial biogenesis and oxidative metabolism, which is in a PGC-1α-dependent way.Funding SourcesUnited States Department of Agriculture-National Institute of Food and Agriculture (USDA-NIFA) (2018-67,017-27,517) and Washington State University Agricultural Research Center Emerging Research Issues Competitive Grant.

Hemisphere Asymmetry during Different Levels of Co-activation of Antagonist Muscles: a Transcranial Magnetic Stimulation Study

Contralateral and ipsilateral silent periods were recorded from first dorsal interosseous muscles of the dominant and the non-dominant hand in response to contralateral and ipsilateral transcranial magnetic stimulation (TMS) in twelve right-handed healthy volunteers during isometric index finger abduction and co-activation of antagonist muscles.
 In the dominant hand, contralateral silent period recorded during coactivation of antagonist muscles was significantly shorter than contralateral silent period recorded during isometric index finger abduction. In the nondominant hand, we did not find significant differences.
 In the dominant hand, ipsilateral silent period recorded during co-activation of antagonist muscles was significantly shorter than ipsilateral silent period recorded during isometric index finger abduction. In the non-dominant hand, we did not find significant differences.
 In conclusion, our main finding was the hemisphere asymmetry during co-activation of antagonist muscles. Both, contralateral and ipsilateral silent periods recorded from the dominant right hand were shorter in comparison to those recorded from the non-dominant hand. These findings illustrate the role of co-activation for the better and precise usage of the dominant hand.

Regulation of PXR Function by Coactivator and Corepressor Proteins: Ligand Binding Is Just the Beginning.

The pregnane X receptor (PXR, NR1I2) is a nuclear receptor which exerts its regulatory function by heterodimerization with the retinoid-X-receptor α (RXRα, NR2B1) and binding to the promoter and enhancer regions of diverse target genes. PXR is involved in the regulation of drug metabolism and excretion, metabolic and immunological functions and cancer pathogenesis. PXR activity is strongly regulated by the association with coactivator and corepressor proteins. Coactivator proteins exhibit histone acetyltransferase or histone methyltransferase activity or associate with proteins having one of these activities, thus promoting chromatin decondensation and activation of the gene expression. On the contrary, corepressor proteins promote histone deacetylation and therefore favor chromatin condensation and repression of the gene expression. Several studies pointed to clear cell- and ligand-specific differences in the activation of PXR. In this article, we will review the critical role of coactivator and corepressor proteins as molecular determinants of the specificity of PXR-mediated effects. As already known for other nuclear receptors, understanding the complex mechanism of PXR activation in each cell type and under particular physiological and pathophysiological conditions may lead to the development of selective modulators with therapeutic potential.

Paradigmatic Relations Interact During the Production of Complex Words: Evidence From Variable Plurals in Dutch.

A growing body of work in psycholinguistics suggests that morphological relations between word forms affect the processing of complex words. Previous studies have usually focused on a particular type of paradigmatic relation, for example the relation between paradigm members, or the relation between alternative forms filling a particular paradigm cell. However, potential interactions between different types of paradigmatic relations have remained relatively unexplored. This paper presents two corpus studies of variable plurals in Dutch to test hypotheses about potentially interacting paradigmatic effects. The first study shows that generalization across noun paradigms predicts the distribution of plural variants, and that this effect is diminished for paradigms in which the plural variants are more likely to have a strong representation in the mental lexicon. The second study demonstrates that the pronunciation of a target plural variant is affected by coactivation of the alternative variant, resulting in shorter segmental durations. This effect is dependent on the representational strength of the alternative plural variant. In sum, by exploring interactions between different types of paradigmatic relations, this paper provides evidence that storage of morphologically complex words may affect the role of generalization and coactivation during production.

Operando optical studies of sulfur contamination in syngas operation of solid oxide fuel cells

Near-infrared thermal imaging, voltammetry, and chronocoulometry have been used to examine electrochemical oxidation mechanisms in solid oxide fuel cells (SOFCs) operating with model syngas mixtures (CO + H2) at 800 °C with and without a sulfur-containing contaminant. Questions persist regarding the electrochemical oxidation of H2 vs. CO especially on the role of CO activation and CO mobility in porous SOFC cermet anodes. Chronocoulometry, electrochemical impedance spectroscopy, and operando optical methods are also used to characterize contaminant effects of SOFC operation at 800 °C in the presence of 50 ppmv sulfur to gain insight into its effect on syngas SOFC operation. The chronocoulometry results indicate that in the absence of sulfur contaminants, electrochemical oxidation of adsorbed CO does not contribute to current production, possibly because of rapid carbon formation at the anode surface. This discovery suggests that initially adsorbed H2 is the primary source of charge at early times in the electro-oxidation of syngas fuels. Furthermore, in the presence of sulfur contaminants, chronocoulometry data show that S competitively occupies ~30% of the electroactive sites at the triple phase boundary and contributes to the total initial charge likely via electrochemical oxidation of S to SO2.

Concomitant accumulations of ions, osmoprotectants and antioxidant system-related substances provide salt tolerance capability to succulent extreme-halophyte Scorzonera hieraciifolia

Halophytes adapting to live in salinized areas can activate some tolerance mechanism through signal compounds to cope with salinity. However, the role of co-activity of signal compounds in salt tolerance of halophytes has not yet fully understood. We researched the changes in signal compounds involved in the salt tolerance mechanism, including inorganic ions, osmoprotectants and substances related to the antioxidant system in

The corepressors GPS2 and SMRT control enhancer and silencer remodeling via eRNA transcription during inflammatory activation of macrophages

While the role of transcription factors and coactivators in controlling enhancer activity and chromatin structure linked to gene expression is well established, the involvement of corepressors is not. Using inflammatory macrophage activation as a model, we investigate here a corepressor complex containing GPS2 and SMRT both genome-wide and at the Ccl2 locus, encoding the chemokine CCL2 (MCP-1). We report that corepressors co-occupy candidate enhancers along with the coactivators CBP (H3K27 acetylase) and MED1 (mediator) but act antagonistically by repressing eRNA transcription-coupled H3K27 acetylation. Genome editing, transcriptional interference, and cistrome analysis reveals that apparently related enhancer and silencer elements control Ccl2 transcription in opposite ways. 4C-seq indicates that corepressor depletion or inflammatory signaling functions mechanistically similarly to trigger enhancer activation. In ob/ob mice, adipose tissue macrophage-selective depletion of the Ccl2 enhancer-transcribed eRNA reduces metaflammation. Thus, the identified corepressor-eRNA-chemokine pathway operates invivo and suggests therapeutic opportunities by targeting eRNAs in immuno-metabolic diseases.

Neuromuscular Strategies in Stretch-Shortening Exercises with Increasing Drop Heights: The Role of Muscle Coactivation in Leg Stiffness and Power Propulsion.

When applying drop jump exercises, knowing the magnitude of the stimulus is fundamental to stabilize the leg joints and to generate movements with the highest power. The effects of different drop heights on leg muscles coactivation, leg stiffness and power propulsion were investigated in fifteen sport science students. Drop jumps from heights of 20, 30, 40, 50, and 60 cm in a random order were performed on a force platform. During each drop jump, the ground reaction force, knee angle displacement, and synchronized surface-electromyography root-mean-square (sEMGRMS) activity (vastus lateralis, VL; vastus medialis, VM; rectus femoris, RF; biceps femoris, BF; tibialis anterior, TA and lateral gastrocnemius, LG) were recorded. The coactivation in the pre-contact phase, between VL and BF, VM and BF as well as RF and BF, was dependent on the drop height (p < 0.01; effect size (ES) ranged from 0.45 to 0.90). Leg stiffness was dependent on the drop height (p < 0.001; ES = 0.27–0.28) and was modulated by the coactivation of VM–BF (p = 0.034) and RF–BF (p = 0.046) during the braking phase. Power propulsion was also dependent on the drop height (p < 0.001; ES = 0.34); however, it was primarily modulated by the coactivation of LG–TA during the braking phase (p = 0.002). The coactivation of thigh muscles explains leg stiffness adjustments at different drop heights. On the contrary, the coactivation of shank muscles is mostly responsible for the power propulsion.

The roles of post-translational modifications and coactivators of STAT6 signaling in tumor growth and progression.

Signal transducers and activators of transcription 6 (STAT6) arehighly expressed in various tumors and associated with tumorigenesis, immunosuppression, proliferation, metastasisand poor prognosis in human cancers. In response to IL-4/13, STAT6 is phosphorylated, dimerizesand triggers transcriptional regulation after recruitment of coactivators to transcriptosome, such as CBP/p300, SRC-1, PARP-14 and PSF. Post-translational modifications, including phosphorylation, ubiquitination, ADP-ribosylation and acetylation, have been explored for molecular mechanisms of STAT6 in tumor development and management. STAT6 has been developed as a specific biomarker for distinguishing and diagnosing tumor phenotypes, although it is observed to be frequently mutated in metastatic tumors. In this article, we focus mainly on the structural characteristics ofSTAT6 and its rolein tumor growth and progression.

Role of muscle coactivation in adaptation of standing posture during arm reaching.

The ability to maintain stable, upright standing in the face of perturbations is a critical component of daily life. A common strategy for resisting perturbations and maintaining stability is muscle coactivation. Although arm muscle coactivation is often used during adaptation of seated reaching movements, little is known about postural muscle activation during concurrent adaptation of arm and standing posture to novel perturbations. In this study we investigate whether coactivation strategies are employed during adaptation of standing postural control, and how these strategies are prioritized for adaptation of standing posture and arm reaching, in two different postural stability conditions. Healthy adults practiced planar reaching movements while grasping the handle of a robotic arm and standing on a force plate; the robotic arm generated a velocity-dependent force field that created novel perturbations in the forward (more stable) or backward (less stable) direction. Surprisingly, the degree of arm and postural adaptation was not influenced by stability, with similar adaptation observed between conditions in the control of both arm movement and standing posture. We found that an early coactivation strategy can be used in postural adaptation, similar to what is observed in adaptation of arm reaching movements. However, the emergence of a coactivation strategy was dependent on perturbation direction. Despite similar adaptation in both directions, postural coactivation was largely specific to forward perturbations. Backward perturbations led to less coactivation and less modulation of postural muscle activity. These findings provide insight into how postural stability can affect prioritization of postural control objectives and movement adaptation strategies.NEW & NOTEWORTHY Muscle coactivation is a key strategy for modulating movement stability; this is centrally important in the control of standing posture. Our study investigates the little-known role of coactivation in adaptation of whole body standing postural control. We demonstrate that an early coactivation strategy can be used in postural adaptation, but muscle activation strategies may differ depending on postural stability conditions.

Abstract LB-A14: Combinational therapy by targeting LSD1 and BRD4 in prostate cancer

Abstract As a nuclear transcriptional factor, androgen receptor (AR) plays a significant role in prostate cancer (PCa) development. Androgen deprivation therapy (ADT) blunting the AR activity is the mainstream strategy for treating PCa. Despite the initial effectiveness of ADTs, most cases will relapse to a lethal stage termed castration-resistant prostate cancer (CRPC), where AR regains activity and drives tumor growth. This unmet clinical challenge to further target AR has led to a number of clinical investigations of targeting some of the key components in AR signaling. Epigenetic regulators are promising targets as they are critical players for rewiring the AR network during PCa progression. Lysine specific demethylase 1 (LSD1), an important epigenetic modifier that is well known for its repressor function through demethylating histone 3 lysine 4 (H3K4), can also function as an activator. In PCa cells, our epigenomic profiling study showed that LSD1 resides at active chromatin regions marked by high H3K27ac and FOXA1. Further genome-wide studies showed that inhibiting LSD1 disrupts AR cistrome and impairs its transcriptional output. Our mechanistic studies show that the activator function of LSD1 is through controlling the chromatin binding of FOXA1, which is a critical pioneer factor for AR. Importantly, at the AR-regulated enhancers, we observed that LSD1 inhibition also caused a rapid and broad decrease of H3K27ac signal, which directs Bromodomain-containing protein 4 (BRD4) chromatin binding. BRD4 belongs to BET (bromodomain and extra terminal domain) family, which plays an essential role in promoting the initiation and elongation steps in gene transcription process. The most credited function of BRD4 is its regulation of oncogene c-MYC via binding to the highly active super enhancers. Moreover, the oncogenic function of BRD4 in PCa has been well attributed to its coactivator role with AR. Multiple inhibitors targeting BRD4 have been developed and shown early promising clinical outcomes, however the drug resistance also emerges in the preclinical models. Herein, we reason that targeting LSD1 and BRD4 together could further impair the AR action and achieve better anti-tumor effect. To examine whether there is a synergistic effect, we employed inhibitors that have been tested in clinical trials: ORY-1001 and I-BET762, which target LSD1 and BRD4 respectively. We found that the combinational treatment lead to a more effective reduction of AR transcriptional activity than either single treatment. The proliferation of AR-positive LNCaP PCa cell line and CWR22RV1 CRPC cell line which expresses high levels of C-terminal truncated AR splicing variants (AR-Vs) was also more profoundly inhibited by combined therapy. Besides disrupting the full-length AR cistrome, LSD1 inhibition also impairs the activity of AR-V7, a major form of AR-Vs that drives developing ADT resistance in CRPC. However, the function of BRD4 in regulating AR-V7 activity remains to be elucidated. Therefore, we tested the combined treatment in CWR22RV1 cells under hormone-depleted condition. By targeting LSD1 and BRD4 together, AR-V7 regulated gene expression was significantly reduced. Currently, we are investigating the genome-wide effect of targeting both epigenetic regulators on AR and AR-V7. To provide clinical evidence, we are testing this combined treatment in patient-derived xenograft models, which recapitulate the CRPC by harboring high levels of AR and AR-Vs and ETS gene translocation. Citation Format: Muqing Li, Dong Han, zifeng wang, shuai gao, Changmeng Cai. Combinational therapy by targeting LSD1 and BRD4 in prostate cancer [abstract]. In: Proceedings of the AACR-NCI-EORTC International Conference on Molecular Targets and Cancer Therapeutics; 2019 Oct 26-30; Boston, MA. Philadelphia (PA): AACR; Mol Cancer Ther 2019;18(12 Suppl):Abstract nr LB-A14. doi:10.1158/1535-7163.TARG-19-LB-A14

TAZ Is a Negative Regulator of PPARγ Activity in Adipocytes and TAZ Deletion Improves Insulin Sensitivity and Glucose Tolerance

Insulin resistance is a major factor in obesity-linked type 2 diabetes. PPARγ is a master regulator of adipogenesis, and small molecule agonists, termed thiazolidinediones, are potent therapeutic insulin sensitizers. Here, we studied the role of transcriptional co-activator with PDZ-binding motif (TAZ) as a transcriptional co-repressor of PPARγ. We found that adipocyte-specific TAZ knockout (TAZ AKO) mice demonstrate a constitutively active PPARγ state. Obese TAZ AKO mice show improved glucose tolerance and insulin sensitivity compared to littermate controls. PPARγ response genes are upregulated in adipose tissue from TAZ AKO mice and adipose tissue inflammation was also decreased. Invitro and invivo mechanistic studies revealed that the TAZ-PPARγ interaction is partially dependent on ERK-mediated Ser112 PPARγ phosphorylation. As adipocyte PPARγ Ser112 phosphorylation is increased in obesity, repression of PPARγ activity by TAZ could contribute to insulin resistance. These results identify TAZ as a new factor in the development of obesity-induced insulin resistance.