Quaternary Ammonium Compounds Resistance Genes Research Articles

Virulence factors and antimicrobial resistance in Escherichia coli strains isolated from hen egg shells

Eggs may contain extraintestinal pathogenic (ExPEC) and diarrheogenic (DEC) Escherichia coli which in addition may carry antibiotic resistance. The wide use of biocides and disinfectants in the food industry may induce biocide tolerance in bacteria. The aim of the present study was to evaluate biocide tolerance and antibiotic resistance in E. coli from hen egg shells. A total of 27 isolates obtained from a screening of 180 eggs were studied. Seven isolates carried both eae and bfpA genes of typical enteropathogenic E. coli (EPEC) strains, while 14 isolates only carried eae associated with atypical EPEC strains. Shiga toxin genes stx and stx2 were detected in four isolates. Heat-stable and heat-labile enterotoxin genes as well as aggR were also detected. Several isolates had minimum inhibitory concentrations (MICs) that were higher than the wild-type for the biocide hexadecylpyridinium chloride (HDP, 18.52%) or the commercial disinfectant P3 oxonia (OX, 14.81%). Antibiotic resistance was detected for ampicillin (37.03%), streptomycin (37.03%), tetracycline (37.03%), chloramphenicol (11.11%), nalidixic acid (18.51%) and trimethoprim-sulfamethoxazole (14.81%). Eight isolates (29.63%) were biocide tolerant and antibiotic resistant. Efflux pump genes detected included acrB (96.29%), mdfA (85.18%) and oxqA (37.03%), in addition to quaternary ammonium compound (QAC) resistance genes qacA/B (11.11%) and qacE (7.40%). Antibiotic resistance genes detected included blaCTX-M-2 (22.22%), blaTEM (3.70%), blaPSE (3.70%), tet(A) (29.63%), tet(B) (29.63%), tet(C) (7.40%), tet(E) (11.11%), aac(6′)-Ib (3.70%), sul1 (14.81%), dfrA12 (3.70%) and dfrA15 (3.70%). Most isolates (96.30%) carried more than one genetic determinant of resistance. The most frequent combinations were efflux pump components acrB and mdfA with tetracycline resistance genes (33.33% of isolates). Isolates carrying QAC resistance genes also carried between 4 and 8 of the additional antimicrobial resistance genes investigated. Regardless of biocide tolerance and antibiotic resistance, all isolates were sensitive to carvacrol (0.25%), thymol (0.125%) and trisodium phosphate (1 to 1.5%), but they exhibited a heterogeneous response to sodium lactate and lysozyme-EDTA combinations that apparently were not related with antibiotic resistance. Results from the study reveal not only a low incidence of biocide tolerance but also the presence of multiple resistance strains carrying multiple genetic determinants of resistance.

Structure-Resistance Relationships: Interrogating Antiseptic Resistance in Bacteria with Multicationic Quaternary Ammonium Dyes.

Bacterial resistance toward commonly used biocides is a widespread yet underappreciated problem, one which needs not only a deeper understanding of the mechanisms by which resistance proliferates, but also means for mitigation. To advance our understanding of this issue, we recognized a polyaromatic structural core analogous to activators of QacR, a negative transcriptional regulator of the efflux pump QacA, and envisioned a series of quaternary ammonium compounds (QACs) based on this motif. Using commercially available dye scaffolds, we synthesized and evaluated the antimicrobial activity of 52 novel QACs bearing 1-3 quaternary ammonium centers. Striking differences in antimicrobial activity against bacteria bearing QAC resistance genes have been observed, with up to a 125-fold increase in minimum inhibitory concentration (MIC) for select structures against bacteria known to bear efflux pumps. Based on these findings, general trends in structure-resistance relationships have been identified, laying the groundwork for future mechanistic studies.

Aminoglycoside and chlorhexidine resistance genes in Staphylococcus aureus isolated from surgical wound infections

Hamdia Askar1, Wafaa Badawy2  and Enas Hammad11Medical Microbiology and Immunology Department, Faculty of Medicine, Mansoura University, Egypt2MD.MansouraUniversity Students'Hospital,Egypt. Background:  Staphylococcus aureus is a major human pathogen resistant to many antimicrobial agents especially the methicillin-resistant Staphylococcus aureus (MRSA). In surgical site infections, MRSA is known to be an important etiologic factor. Infections range from skin and soft-tissue infections to deep tissue infections such as osteomyelitis, bacteremia, and endocarditis that are much more common in hospital environment. In staphylococci the main mechanism of aminoglycoside resistance is the drug inactivation by aminoglycoside-modifying enzymes (AMEs) and reduced biocide susceptibility is associated with the acquisition of quaternary ammonium compound (qac) gene-encoding for Qac efflux proteins.Aim of the work: To investigate the prevalence of the aminoglycosides resistance genes aac(6′)aph(2″), aph(3′)-IIIa, Ant(4′)-Ia) and the biocide resistance genes (qacA/qacB, qacC) in S. aureus isolated from surgical site infections.Methods: Swabs from 280 infected surgical sites were sent to our laboratory from different surgical words at Mansoura University Hospitals between January 2014 and December 2014. Sixty- six staphylococcal strains were isolated and included in this study. Verification of the presence of methicillin resistance gene (mecA), chlorhexidine MIC and qac resistance genes (qacA/qacB, qacC) were detected by PCR. The presence of aminoglycoside resistance genes [(aac(6′)/aph (2″), ant (4′)-1a and aph(3′)-IIIa)] in S. aureus was also tested by PCR.Results:  Seventeen of the 66 S. aureus isolates (25.75 %) were phenotypically MRSA and mecA gene was detected in 19 S. aureus isolates (28.7 %) by PCR. Aminoglycoside resistant S. aureus were 21/66 (31.8%). AME genes were detected in all aminoglycoside-resistant S. aureus; aac(6′)/aph (2″) was the most frequently detected 11/21(52.4%) followed by aph(3′)-IIIa 6/21 (28.6%) and the least frequent was ant (4′)-1a 4/21(19%). Aminoglycoside resistance in 9 out of the 21 (42.9%) aminoglycoside resistance S. aureus isolates was solely plasmid mediated being lost after plasmid curing. A total of 14 out of the 21 aminoglycoside-resistant S. aureus isolates (66.7 %) carried the mecA gene. Among the 45 aminoglycoside-sensitive S. aureus isolates 5 (11.1%) were mecA positive. Nine of the 21 aminoglycoside-resistant S. aureus isolates (42.9%) were positive for qacA/qacB genes and in all of them mecA gene co-existed. Five aminoglycoside resistant S. aureus isolates were qacC positive (23.8%).  Conclusion: In the Staphylococcus aureus isolated from infected surgical wounds, quaternary ammonium compounds resistance genes were positive at a considerable ratio and co-existed with aminoglycosides and methicillin-resistance genes in S. aureus isolates. Â

Biocide Susceptibility of Staphylococcus aureus CC398 and CC30 Isolates from Pigs and Identification of the Biocide Resistance Genes, qacG and qacC.

Methicillin-resistant Staphylococcus aureus (MRSA), in particular clonal complex (CC) 398, is increasingly found in livestock. Recently, MRSA CC30 was identified in Danish pigs. We determined the susceptibility of porcine S. aureus isolates of CC398 and CC30 to disinfectants used in pig farming (benzalkonium chloride, hydrogen peroxide, formaldehyde, sodium hypochlorite, and caustic soda). Furthermore, efflux pump activity, antimicrobial resistance profiles, hemolysis properties, and the presence of toxic shock syndrome toxin-1 (TSST-1) and Panton-Valentine Leukocidin (PVL)-encoding virulence factors were investigated. Susceptibilities to biocides and antimicrobial agents of 79 porcine S. aureus isolates were determined by the microdilution method. Isolates comprised 21 methicillin-sensitive S. aureus (MSSA) and 40 MRSA isolates belonging to CC398 and 13 MSSA and 5 MRSA isolates belonging to CC30. The presence of quaternary ammonium compound (QAC) resistance efflux pumps was analyzed using an ethidium bromide accumulation assay. The presence of qac resistance genes in active efflux pump positive isolates was determined by whole-genome sequencing data. All isolates were screened for lukPV and tst genes with PCR, and hemolytic activities were determined using an agar plate assay. S. aureus isolates did not show reduced susceptibility to the biocides tested. However, the QAC resistance gene, qacG, was detected in three MRSA CC30 isolates and the qacC in one MRSA CC30 isolate. CC30 isolates were generally more susceptible to non-beta-lactam antibiotics than CC398. Isolates generally had low hemolytic activity and none encoded PVL or TSST-1. The presence of qac genes in European porcine S. aureus isolates and in livestock-associated MRSA CC30 is for the first time described in this study. This finding is concerning as it ultimately may compromise disinfection with QACs and thereby contribute to the selection and spread of MRSA CC30.

Effects of 100 years wastewater irrigation on resistance genes, class 1 integrons and IncP-1 plasmids in Mexican soil.

Long-term irrigation with untreated wastewater can lead to an accumulation of antibiotic substances and antibiotic resistance genes in soil. However, little is known so far about effects of wastewater, applied for decades, on the abundance of IncP-1 plasmids and class 1 integrons which may contribute to the accumulation and spread of resistance genes in the environment, and their correlation with heavy metal concentrations. Therefore, a chronosequence of soils that were irrigated with wastewater from 0 to 100 years was sampled in the Mezquital Valley in Mexico in the dry season. The total community DNA was extracted and the absolute and relative abundance (relative to 16S rRNA genes) of antibiotic resistance genes (tet(W), tet(Q), aadA), class 1 integrons (intI1), quaternary ammonium compound resistance genes (qacE+qacEΔ1) and IncP-1 plasmids (korB) were quantified by real-time PCR. Except for intI1 and qacE+qacEΔ1 the abundances of selected genes were below the detection limit in non-irrigated soil. Confirming the results of a previous study, the absolute abundance of 16S rRNA genes in the samples increased significantly over time (linear regression model, p < 0.05) suggesting an increase in bacterial biomass due to repeated irrigation with wastewater. Correspondingly, all tested antibiotic resistance genes as well as intI1 and korB significantly increased in abundance over the period of 100 years of irrigation. In parallel, concentrations of the heavy metals Zn, Cu, Pb, Ni, and Cr significantly increased. However, no significant positive correlations were observed between the relative abundance of selected genes and years of irrigation, indicating no enrichment in the soil bacterial community due to repeated wastewater irrigation or due to a potential co-selection by increasing concentrations of heavy metals.

Methicillin-resistant Staphylococcus aureus in commercial swine herds is associated with disinfectant and zinc usage.

Methicillin-resistant Staphylococcus aureus (MRSA) originating from swine is concerning for public health, but an understanding of the emergence and persistence of MRSA in nursery herds is lacking. The aim of this study was to determine whether MRSA in nursery pigs is associated with particular herd-level parameters, including the use of antimicrobials, disinfectants, and heavy metals, which may be driving the selection and persistence of antimicrobial resistance. Nasal cultures for MRSA were completed for 390 pigs from 26 farms at the end of the suckling phase and again at 3 weeks postweaning. Herd-level information was collected, and a random subset of MRSA isolates was screened for resistance to zinc and quaternary ammonium compounds (QACs). Multivariate analysis revealed that in-feed concentrations of zinc (P < 0.001) and frequent disinfection of nursery pens (P < 0.001) are associated with MRSA shedding in nursery pigs. Furthermore, 62.5% (25/40) of MRSA isolates carried the zinc resistance gene czrC and demonstrated decreased susceptibility to zinc. All MRSA isolates carried at least 1 QAC resistance gene. The most common genotype was qacG qacH smr, which occurred in 32.5% (13/40) of isolates. Seven isolates (17.5%) demonstrated a significant tolerance to benzalkonium chloride, indicating a potential to survive commercial QAC exposure in the presence of organic matter. Overall, these findings indicate that high levels of in-feed zinc and QAC-based disinfectants are important drivers in the selection and persistence of MRSA in commercial swine herds, and these agents may be coselecting for other antimicrobial resistance genes.

Presence of disinfectant resistance genes in Escherichia coli isolated from retail meats in the USA.

To examine the distribution of all genes known to be responsible for resistance to quaternary ammonium compounds (QACs), and their association with resistance to QACs and other antimicrobials, in Escherichia coli recovered from retail meats. A total of 570 strains of E. coli isolated from US retail meats in 2006 were screened for the presence of 10 QAC resistance genes [qacE, qacEΔ1, qacF, qacG, emrE, sugE(c), sugE(p), mdfA and ydgE/ydgF]. The MICs of six common disinfectants were determined using an agar dilution method. Possible associations between the presence of the gene and bacterial resistance to QACs and antimicrobials were investigated. emrE, sugE(c), mdfA and ydgE/ydgF were commonly present (77.2%-100%) in the E. coli isolates, but qac and sugE(p) were less prevalent (0.4%-22.3%). emrE-mdfA-sugE(c)-ydgE/F was the most common QAC resistance gene profile. A significant association was found between antimicrobial resistance and the presence of sugE(p) and qacEΔ1 (P < 0.05). Antimicrobial-resistant E. coli isolates tended to contain more diverse combinations of disinfectant resistance genes than susceptible ones. All isolates showed reduced susceptibility to five of six disinfectants compared with the control strains. Higher MICs were generally associated with the presence of qac and sugE(p) genes. The QAC resistance genes were commonly present among E. coli isolated from retail meats, and the qac and sugE(p) genes were highly associated with multidrug resistance phenotypes. Using QACs in the food industry may not be as effective as expected and could provide selection pressure for strains with acquired resistance to other antimicrobials.

Klinik Örneklerden İzole Edilen Trimetoprim-Sülfametoksazole Dirençli Stenotrophomonas maltophilia Suşlarında İntegron, sul1-2 ve dfr Genlerinin Araştırılması

Stenotrophomonas maltophilia, which is a non-fermentative gram-negative bacillus, has an increasing importance in nosocomial and opportunistic infections. Since it exhibits resistance to numerous broad-spectrum antibiotics such as aminoglycosides, beta-lactams and tetracyclines, it may considerably limit empirical treatment options. Trimethoprim-sulfamethoxazole (SXT) is recommended as the first-line therapy in the treatment of S.maltophilia infections thanks to its high potency and usefulness in a range of patients. In recent years, however, studies in different geographical regions have started to report resistance to SXT. In this study, we aimed to investigate the genes sul1, sul2, dfrA9, dfrA10, dfrA20 and class I, class II integron gene cassettes which are known to play role in SXT resistance among SXT-resistant S.maltophilia strains. A total of 618 S.maltophilia strains isolated from various clinical samples of 339 patients between January 2006 and October 2011 at the laboratory of Medical Microbiology Department, Faculty of Medicine, Karadeniz Technical University, Trabzon, Turkey, were included in the study. The isolates were identified by both conventional methods and the Phoenix automated identification system (Becton Dickinson, USA). SXT resistance was determined in the isolates of 32 patients (32/339, 9.4%) by both the automated system and agar dilution method of them 29 (90.6%) were hospital-acquired, and 3 (9.4%) were community-acquired. The genes which are known as SXT resistance determining genes including sul1, sul2, dfr genes, and class I and class II integron gene cassettes were analyzed by using specific primers with polymerase chain reaction in the 32 SXT-resistant isolates. Subsequently, nucleotide sequence analysis of the amplified materials was performed. As a result of this assay, the presence of class I integron gene cassette and sul1 gene were detected in one isolate. Nucleotide sequence analysis of the gene cassette revealed oxacilinase (oxa2) type of beta-lactamase, an aminoglycoside 6'-N-acetyltransferase [aac(6')-IIc], leading to resistance of aminoglycosides, and a quaternary ammonium compounds resistance gene (qacF), respectively. In conclusion, to best of our knowledge the sequences of class I integron gene cassette including oxa2, aac(6')-IIc, qacF genes were identified in S.maltophilia for the first time. It should be kept in mind that the co-presence of a class I integron gene cassette and the sul1 gene in S.maltophilia may lead to the development of multi-drug resistance and may act as a potential source for the dissemination of resistance.

Decreased susceptibility to chlorhexidine and prevalence of disinfectant resistance genes among clinical isolates of Staphylococcus epidermidis

Staphylococcus epidermidis is a versatile agent, being both a commensal and a nosocomial pathogen usually with an opportunistic role in association with implanted foreign body materials. Pre-operative antiseptic preparation is an important strategy for reducing the risk of complications such as surgical site infection (SSI). Currently, the most widely used antiseptics are alcohols, quaternary ammonium compounds (QACs), and the bisbiguanide chlorhexidine. Occurrence of resistance to the latter agent has drawn increasing attention. The aim of this study was to investigate if decreased susceptibility to chlorhexidine among S. epidermidis was present in our setting, a Swedish university hospital. Staphylococcus epidermidis (n=143), retrospectively collected, were obtained from prosthetic joint infections (PJI) (n=61), post-operative infections after cardiac surgery (n=31), and the skin of the chest after routine disinfection prior to cardiac surgery (n=27). In addition, 24 commensal isolates were included. Minimum inhibitory concentration (MIC) of chlorhexidine was determined on Mueller Hinton agar plates supplemented with serial dilutions of chlorhexidine. Five QAC resistance genes, qacA/B, smr, qacH, qacJ, and qacG, were detected using PCR. Decreased susceptibility to chlorhexidine was found in 54% of PJI isolates, 68% of cardiac isolates, 21% of commensal isolates, and 7% of skin isolates from cardiac patients, respectively. The qacA/B gene was present in 62/143 isolates (43%), smr in 8/143 (6%), and qacH in one isolate (0.7%). The qacA/B gene was found in 52% of PJI isolates, 61% of cardiac isolates, 25% of commensal isolates, and 19% of the skin isolates. In conclusion, decreased susceptibility to chlorhexidine, as well as QAC resistance genes, were prevalent among S. epidermidis isolates associated with deep SSIs.

Detection of class 1 integrons in Salmonella Weltevreden and silent antibiotic resistance genes in some seafood-associated nontyphoidal isolates of Salmonella in south-west coast of India

To study the antibiogram of 40 seafood isolates of Salmonella and use of PCR to detect the presence of integrons and genes coding for antibiotic resistance. In this study, 40 isolates of Salmonella were used for antibiogram analysis. The multidrug-resistant isolates were analyzed for the presence of integron using integron-specific primers. Twenty-five percentage of the isolates were multidrug resistant while 67·50% were resistant to at least two antibiotics. Antibiotic resistance genes catA1 and tetA were present in 57·52 and 60%, respectively. Although widespread presence of genes was observed, only 26·08% of the catA1-carrying isolates exhibited phenotypic resistance against the respective antibiotic. Integrons present in representative isolates of Salmonella Weltevreden and Salmonella Newport were sequenced. The former contained class 1 integron with a single gene dfrA7 in the integron cassette and an adjacent dihydropteroate synthetase gene along with the usual quaternary ammonium compound resistance gene, while the later contained class 1 integron with dhfrA1, OrfC, in the integron cassette and an adjacent dihydropteroate synthetase gene along with the usual quaternary ammonium compound resistance gene. This study demonstrates the presence of silent antibiotic resistance genes and class I integrons in seafood-associated Salmonella strains. The study also demonstrates the first report of class I integron in Salm. Weltevreden. Detection of catA1 genes in phenotypically sensitive bacteria suggests that these could be reservoirs in the environment. The manuscript provides novel results describing the existence of a high rate of antibiotic resistance in the Salmonella populations prevailing in environmental sources as well as an absence of correspondence between the presence of antibiotic resistance genes, and the exhibition of a the corresponding phenotypic trait of resistance against the respective antibiotic compound was observed. In addition, the manuscript reports the presence of the class I integron in Salm. Weltevreden.

Impacts of anthropogenic activity on the ecology of class 1 integrons and integron-associated genes in the environment.

The impact of human activity on the selection for antibiotic resistance in the environment is largely unknown, although considerable amounts of antibiotics are introduced through domestic wastewater and farm animal waste. Selection for resistance may occur by exposure to antibiotic residues or by co-selection for mobile genetic elements (MGEs) which carry genes of varying activity. Class 1 integrons are genetic elements that carry antibiotic and quaternary ammonium compound (QAC) resistance genes that confer resistance to detergents and biocides. This study aimed to investigate the prevalence and diversity of class 1 integron and integron-associated QAC resistance genes in bacteria associated with industrial waste, sewage sludge and pig slurry. We show that prevalence of class 1 integrons is higher in bacteria exposed to detergents and/or antibiotic residues, specifically in sewage sludge and pig slurry compared with agricultural soils to which these waste products are amended. We also show that QAC resistance genes are more prevalent in the presence of detergents. Studies of class 1 integron prevalence in sewage sludge amended soil showed measurable differences compared with controls. Insertion sequence elements were discovered in integrons from QAC contaminated sediment, acting as powerful promoters likely to upregulate cassette gene expression. On the basis of this data, >1 × 10(19) bacteria carrying class 1 integrons enter the United Kingdom environment by disposal of sewage sludge each year.

Analysis of a novel class 1 integron containing metallo-β-lactamase gene VIM-2 in Pseudomonas aeruginosa

Carbapenems such as imipenem are stable to most beta-lactamases. Recently, increased numbers of carbapenemase producing Gram-negative bacterial strains have been isolated because of the increased use of cabapenems. In this respect, control of these infectious carbapenemase producing Gram-negative bacteria and understanding their resistance mechanism are becoming more important. These carbapenem-hydrolyzing beta-lactamase genes have been reported to exist mostly as gene cassettes in an integron. This implies that antibiotic resistance genes may be transferred to other bacteria via the integron. In the present study, we identified and analyzed an integron containing VIM-2 type metallo-beta-lactamase gene in a carbapenemase producing Pseudomonas aeruginosa. In addition, the possibility of resistance spread by integron located in a plasmid was tested. Among glucose non-fermenting Gram-negative bacilli with reduced imipenem susceptibility (MIC > or = 8 microg/ml) isolated from Korean patients, P. aeruginosa 1082 showed resistance to most beta-lactams, cephalosporin, and aminoglycoside. We found that P. aeruginosa 1082 was inhibited by EDTA in EDTA double disk synergy test which means that this strain produces metallo-beta-lactamase. Class 1 integron containing bla (VIM-2) (carbapenem resistance gene), qacF (quaternary ammonium compound resistance gene), aacA4 (aminoglycoside resistance gene), catB3 (chloramphenicol resistance gene), bla (oxa-30) (extended-spectrum beta-lactam resistance gene), and aadAl (aminoglycoside resistance gene) gene cassettes was detected in P. aeruginosa 1082. The size of the integron was 5,246 bp and the structure and arrangement of the integron was a novel one in comparison with other integrons found in other P. aeruginosa. The integron could be transferred to Escherichia coli JM109 from P. aeruginosa 1082 possibly via self-transferable plasmid DNA. The integron and a bla (VIM-2) gene were detected in the plasmid DNA of the transconjugants whose imipenem resistance was slightly increased as a result of accepting the integron from the donor strain.

Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia

Sir, This study found that 21% of Stenotrophomonas maltophilia carry a class 1 integron when integrase-specific primers for intI1 or intI2 were used. S. maltophilia is a non-fermentative, Gram-negative bacillus, increasingly identified as a nosocomial pathogen in compromised patients. Trimethoprim/sulfamethoxazole is one of the most potent agents for treating S. maltophilia infection. However, resistance to trimethoprim/sulfamethoxazole is apparently increasing. Integrons capture genes as part of a genetic element known as a gene cassette. Most cassettes within integrons with known functions confer antibiotic or quaternary ammonium compound (QAC) resistance. In an Argentinian study on the correlation between class 1 integrons and increasing MICs of trimethoprim/ sulfamethoxazole for S. maltophilia isolates, Barbolla et al. reported that only 0.9% of S. maltophilia harboured class 1 integrons. In contrast, a higher prevalence of class 1 integrons was revealed in the present study. We decided to look at the relationship between the high prevalence of class 1 integrons and trimethoprim/sulfamethoxazole resistance in S. maltophilia. One hundred and three clinical S. maltophilia isolates were collected from different patients at a southern Taiwan medical centre in 2003. During the isolation period, no infectious outbreaks occurred. Identification was performed with API 20E (bioMerieux, La Balme, France) or the Vitek automated system (bioMerieux, Vitek, Hazelwood, MO, USA). Random amplified polymorphic DNA markers (Operon Technologies, Inc., Alameda, CA, USA) were used to clarify the relationships between isolates. Antimicrobial susceptibility to trimethoprim/sulfamethoxazole was determined by an agar dilution method. S. maltophilia ATCC 13637 was used as a wild-type control strain. All gene cassettes within integrons were amplified with primers specific for the integron 50 and 30 conserved segments and then sequenced. Sequences were compared using the BLAST search programme. Sulfamethoxazole resistance determinants were detected with specific primers for sul1 (F, GGATTTTTCTTGAGCCCCGC; R, CATTGCCGATC GCGTGAAGT) and sul2 (F, CCTGTTTCGTCCGACACAGA; R, GAAGCGCAGCCGCAATTCAT). Statistical calculations included x test and Fisher’s exact test. Twenty-six (25%) isolates revealed resistance to trimethoprim/ sulfamethoxazole. The trimethoprim/sulfamethoxazole-resistant isolates harboured a significantly higher (69%) proportion of class 1 integrons than trimethoprim/sulfamethoxazolesusceptible isolates (P , 0.001, Table 1). Twenty-one of 26 trimethoprim/sulfamethoxazole-resistant isolates had the sul1 gene and 81% were associated with class 1 integrons, which was significantly higher than sul1-negative isolates (P 1⁄4 0.0192). The identified gene cassettes within class 1 integrons included aminoglycoside resistance genes aacA4, aadA2, aadB and aac(6)-Ib0; chloramphenicol resistance gene cmlA and QAC resistance genes smr, qacF and qacH. Two isolates carried multigene cassettes: qacH-aadB-cmlA-aadA2 and aac(6)-Ib0/aacA4, respectively. The incidence of trimethoprim/sulfamethoxazole resistance was significantly associated with the presence of QAC resistance genes, e.g. smr, qacF and qacH, carried on class 1 integrons (P , 0.001, Table 1). Increasing proportions of isolates containing class 1 integrons were detected in S. maltophilia. However, no class 2 integrons were found. Although trimethoprim/sulfamethoxazole resistance was significantly associated with class 1 integrons, the trimethoprim resistance gene was not encoded by integrons. Recent studies indicate that resistance genes are linked to insertion sequence common region (ISCR) elements, which are DNA sequences found beyond and close to the 30 conserved sequences of class 1 integrons. These ISCR elements have been identified in numerous Gram-negative bacteria and a few Gram-positive bacteria and are responsible for the mobility and dissemination of many antibiotic resistance genes, including extendedspectrum b-lactamase and carbapenemase genes and aminoglycoside, chloramphenicol, quinolone as well as trimethoprim resistance genes. A previous study by Toleman et al. examined

Widespread Distribution of Disinfectant Resistance Genes among Staphylococci of Bovine and Caprine Origin in Norway

We demonstrate here a widespread distribution of genes mediating efflux-based resistance to quaternary ammonium compounds (QACs) in staphylococci from unpasteurized milk from 127 dairy cattle herds and 70 dairy goat herds. QAC resistance genes were identified in 21% of the cattle herds (qacA/B, smr, qacG, and qacJ) and in 10% of the goat herds (qacA/B and smr). Further examination of 42 QAC-resistant bovine and caprine isolates revealed the following genes: qacA/B (12 isolates) was present in four different species of coagulase-negative staphylococci (CoNS), smr (27 isolates) was detected in eight different CoNS species and in Staphylococcus aureus on a previously reported plasmid (pNVH99), qacG (two isolates) was detected on two plasmids (pST94-like) in Staphylococcus cohnii and Staphylococcus warneri, and qacJ (two isolates) was found in Staphylococcus hominis and Staphylococcus delphini on a plasmid (pNVH01) previously found in equine staphylococci. Isolation of indistinguishable pulsed-field gel electrophoresis (PFGE) CoNS types from tank milk and mammary quarter milk samples in a dairy cattle herd suggested that these QAC-resistant staphylococci were of intramammary origin. Indistinguishable or closely related PFGE types of bovine QAC-resistant CoNS were observed in different herds. One particular bovine S. warneri PFGE type was isolated repeatedly from samples collected during a 30-month period in a herd, showing long-term persistence. In conclusion, it seems that the widespread distribution of staphylococci carrying QAC resistance genes in Norwegian dairy cattle and goat herds is the result of both the intra- and interspecies spread of QAC resistance plasmids and the clonal spread of QAC-resistant strains.

Novel Plasmid-Borne Gene qacJ Mediates Resistance to Quaternary Ammonium Compounds in Equine Staphylococcus aureus , Staphylococcus simulans , and Staphylococcus intermedius

We identified a novel plasmid-borne gene (designated qacJ) encoding resistance to quaternary ammonium compounds (QACs) in three staphylococcal species associated with chronic infections in four horses. qacJ was located on a 2,650-bp plasmid (designated pNVH01), a new member of the pC194 family of rolling-circle replication plasmids. The 107-amino-acid protein, QacJ, showed similarities to known proteins of the small multidrug resistance family: Smr/QacC (72.5%), QacG (82.6%), and QacH (73.4%). The benzalkonium chloride MIC for a qacJ-containing recombinant was higher than those for otherwise isogenic recombinants expressing Smr, QacG, or QacH. Molecular epidemiological analyses by pulsed-field gel electrophoresis suggested both the clonal spread of a qacJ-harboring Staphylococcus aureus strain and the horizontal transfer of pNVH01 within and between different equine staphylococcal species. The presence of pNVH01 of identical nucleotide sequence in different staphylococcal species suggests that recent transfer has occurred. In three of the horses, a skin preparation containing cetyltrimethylammonium bromide had been used extensively for several years; this might explain the selection of staphylococci harboring the novel QAC resistance gene.

Disinfectant resistance mechanisms, cross-resistance, and co-resistance

Six major classes of disinfectants and sanitizers are iodophors, quaternary ammonium compounds (QAC), peroxides, phenols, chlorine, and glutaraldehyde. Bacterial resistance to each of these classes has been reported in literature, and anecdotal reports within the biocide industry are common. Resistance to disinfectants and sanitizers can have significant impact on human health as well as serious economic consequences. The mechanisms associated with resistance have received uneven attention; in the case of resistance to QAC disinfectants and peroxides our knowledge extends to the genetic level while for the other classes the literature consists of largely phenomenological descriptions of its occurrence. Even less is known about the frequency with which resistance develops and the impact of environmental factors on resistance development. Amongst environmental factors the role of biofilms is of interest particularly as they relate to the exposure of bacteria to sublethal concentrations of disinfectant. In industrial systems the selective pressure from preservative usage has been postulated to play a role in disinfectant resistance development through mechanisms of cross-resistance; some isothiazolone and formaldehyde resistant bacteria are cross-resistant to QAC and/or peroxide disinfectants. Mechanism-based cross-resistance of disinfectant-resistant bacteria to antibiotics is of great interest recently, but remains a ripe area for systematic investigation. Co-resistance of disinfectant-resistant bacteria to antibiotics occurs as a result of QAC resistance genes being located on transmissible plasmids and within conserved regions of integrons, each of which has been shown to carry multiple antibiotic resistance genes.

Disinfectant and antibiotic resistance of lactic acid bacteria isolated from the food industry.

Quaternary ammonium compounds (QACs) are widely used as disinfectant in medical and food environments. There is a growing concern about the increasing incidence of disinfectant-resistant microorganisms from food. Disinfectant-resistant lactic acid bacteria (LAB) may survive disinfection and cause spoilage problems. Moreover, resistant LAB may potentially act as a reservoir for resistance genes. A total number of 320 LAB from food industry and meat were screened for resistance to the QAC benzalkonium chloride (BC). Out of 320 strains, five strains (1.5%) were considered to be resistant and 56 (17.5%) were tolerant to BC. The resistant strains were isolated from food processing equipment after disinfection. The resistant, tolerant, and some sensitive control bacteria were examined for susceptibility to 18 different antibiotics, disinfectants, and dyes using disc agar diffusion test and microdilution method. Little systematic cross-resistance between BC and any of the antimicrobial agents tested were detected except for gentamycin and chlorhexidine. A BC-tolerant strain was much easier to adapt to higher levels of BC as compared to a BC-sensitive strain. No known gram-positive QAC resistance genes (qacA/B, qacC, qacG, and qacH) were detected in the BC-resistant strains. Identification to species level of the BC-resistant isolates was carried out by comparative analysis of 16S-rDNA sequencing. In conclusion, resistance to BC is not frequent in LAB isolated from food and food environments. Resistance may occur after exposure to BC. The BC resistant isolates showed no cross-resistance with other antimicrobial compounds, except for gentamycin and chlorhexidine. Nevertheless, BC-resistant LAB may be isolated after disinfection and may contribute to the dissemination of resistance.

Bacterial resistance to disinfectants containing quaternary ammonium compounds

Quaternary ammonium compounds (QAC) are widely used as disinfectants in both medical and food environments. Microbial contaminants are, therefore, regularly exposed to their action and the isolation from clinical and food sources of resistant bacteria continues to be reported in many countries. Resistance to QAC in clinical strains of staphylococci is encoded by one of at least three resistance genes, designated qacA, qacB and qacC. Using hybridisation analysis, we have shown that these QAC resistance genes are also distributed among staphylococcal strains in the food industry. In addition, we have discovered two new resistance determinants in these food isolates, which are now being characterised and sequenced. Although the general level of resistance of pure cultures is low, the resistant strains have originally been isolated after exposure to the recommended user concentration of a commercial brand of QAC. We have also studied resistance to QAC in pseudomonads isolated from the food industry. Their level of resistance is much higher than that found in staphylococci. About 30% of the collected strains were able to grow in 200 μg·ml −1 benzalkonium chloride, the lowest recommended use concentration for this commonly used type of QAC.

Resistance to quaternary ammonium compounds in Staphylococcus spp. isolated from the food industry and nucleotide sequence of the resistance plasmid pST827

The complete nucleotide sequence of the 2.8 kb plasmid pST827 involved in resistance to the quaternary ammonium compound (QAC) benzalkonium chloride in meat-associated staphylococci was determined. An open reading frame (ORF) similar to the QAC resistance genes qacC, ebr and smr previously reported from clinical staphylococcal strains was identified (qacC'). In addition an ORF coding for a protein (Rep827) showing extensive homology to reported replication proteins of Gram-positive organisms was found. The occurrence of known QAC resistance gene (qacA-C) among staphylococcal strains isolated from food processing plants was studied by hybridization analysis. Of 191 isolates, 25 were resistant to benzalkonium chloride. Five of these gave no hybridization signals to probes specific for qacA-C. Further hybridization analysis indicated that pST827 or closely related plasmids are widespread among QAC-resistant staphylococcal strains. The finding of resistant staphylococci in different areas of the food processing industry indicates that QAC resistance is a potential problem in the food processing industry.