Increased incidence of class 1 integrons in trimethoprim/sulfamethoxazole-resistant clinical isolates of Stenotrophomonas maltophilia

Abstract

Sir, This study found that 21% of Stenotrophomonas maltophilia carry a class 1 integron when integrase-specific primers for intI1 or intI2 were used. S. maltophilia is a non-fermentative, Gram-negative bacillus, increasingly identified as a nosocomial pathogen in compromised patients. Trimethoprim/sulfamethoxazole is one of the most potent agents for treating S. maltophilia infection. However, resistance to trimethoprim/sulfamethoxazole is apparently increasing. Integrons capture genes as part of a genetic element known as a gene cassette. Most cassettes within integrons with known functions confer antibiotic or quaternary ammonium compound (QAC) resistance. In an Argentinian study on the correlation between class 1 integrons and increasing MICs of trimethoprim/ sulfamethoxazole for S. maltophilia isolates, Barbolla et al. reported that only 0.9% of S. maltophilia harboured class 1 integrons. In contrast, a higher prevalence of class 1 integrons was revealed in the present study. We decided to look at the relationship between the high prevalence of class 1 integrons and trimethoprim/sulfamethoxazole resistance in S. maltophilia. One hundred and three clinical S. maltophilia isolates were collected from different patients at a southern Taiwan medical centre in 2003. During the isolation period, no infectious outbreaks occurred. Identification was performed with API 20E (bioMerieux, La Balme, France) or the Vitek automated system (bioMerieux, Vitek, Hazelwood, MO, USA). Random amplified polymorphic DNA markers (Operon Technologies, Inc., Alameda, CA, USA) were used to clarify the relationships between isolates. Antimicrobial susceptibility to trimethoprim/sulfamethoxazole was determined by an agar dilution method. S. maltophilia ATCC 13637 was used as a wild-type control strain. All gene cassettes within integrons were amplified with primers specific for the integron 50 and 30 conserved segments and then sequenced. Sequences were compared using the BLAST search programme. Sulfamethoxazole resistance determinants were detected with specific primers for sul1 (F, GGATTTTTCTTGAGCCCCGC; R, CATTGCCGATC GCGTGAAGT) and sul2 (F, CCTGTTTCGTCCGACACAGA; R, GAAGCGCAGCCGCAATTCAT). Statistical calculations included x test and Fisher’s exact test. Twenty-six (25%) isolates revealed resistance to trimethoprim/ sulfamethoxazole. The trimethoprim/sulfamethoxazole-resistant isolates harboured a significantly higher (69%) proportion of class 1 integrons than trimethoprim/sulfamethoxazolesusceptible isolates (P , 0.001, Table 1). Twenty-one of 26 trimethoprim/sulfamethoxazole-resistant isolates had the sul1 gene and 81% were associated with class 1 integrons, which was significantly higher than sul1-negative isolates (P 1⁄4 0.0192). The identified gene cassettes within class 1 integrons included aminoglycoside resistance genes aacA4, aadA2, aadB and aac(6)-Ib0; chloramphenicol resistance gene cmlA and QAC resistance genes smr, qacF and qacH. Two isolates carried multigene cassettes: qacH-aadB-cmlA-aadA2 and aac(6)-Ib0/aacA4, respectively. The incidence of trimethoprim/sulfamethoxazole resistance was significantly associated with the presence of QAC resistance genes, e.g. smr, qacF and qacH, carried on class 1 integrons (P , 0.001, Table 1). Increasing proportions of isolates containing class 1 integrons were detected in S. maltophilia. However, no class 2 integrons were found. Although trimethoprim/sulfamethoxazole resistance was significantly associated with class 1 integrons, the trimethoprim resistance gene was not encoded by integrons. Recent studies indicate that resistance genes are linked to insertion sequence common region (ISCR) elements, which are DNA sequences found beyond and close to the 30 conserved sequences of class 1 integrons. These ISCR elements have been identified in numerous Gram-negative bacteria and a few Gram-positive bacteria and are responsible for the mobility and dissemination of many antibiotic resistance genes, including extendedspectrum b-lactamase and carbapenemase genes and aminoglycoside, chloramphenicol, quinolone as well as trimethoprim resistance genes. A previous study by Toleman et al. examined