Jujuy Province Research Articles

First Report of Zucchini lethal chlorosis virus in Argentina Infecting Squash Crops

Virus species of the genus Orthotospovirus are among the most economically important plant pathogens in the world because they cause severe crop losses, mainly in ornamental and horticultural crops (Pappu et al. 2009). They are exclusively transmitted by thrips. Several species of Orthotospovirus have been reported infecting cucurbits: watermelon silver mottle virus, zucchini lethal chlorosis virus (ZLCV), watermelon bud necrosis virus, melon yellow spot virus, melon severe mosaic virus, and groundnut ringspot virus (Ciuffo et al. 2017; Spadotti et al. 2014). The symptoms caused by ZLCV infection can include chlorosis and systemic necrosis on leaves, apical upward leaf curl, reduction of leaf blade, and fruit malformation (Giampan et al. 2007). The collection of 90 symptomatic leaves of squash from Salta and Jujuy provinces was carried out during early 2016. For an initial assessment of the presence of ZLCV, a plate trapped antibody enzyme-linked immunosorbent assay (Lommel et al. 1982) with antiserum against ZLCV, kindly provided by Jorge A. M. Rezende from the Universidade de Sao Paulo, Brazil, was performed. Fifty-four of the 90 samples reacted positively to ZLCV-specific antiserum: 18 and 11 positive plants of Cucurbita maxima var. zapallito redondo del tronco and var. zapallo plomo, respectively, 11 positive plants of C. pepo, 11 positive plants of C. ficifolia var. “cayote”, and three positive plants of C. moschata. Ultrathin sections of leaf samples of naturally infected plants were examined by transmission electron microscopy, and presumable orthotospovirus particles were observed. To confirm the identity of the virus, a one-step reverse transcription polymerase chain reaction (RT-PCR) assay was carried out on the RNA extracts from squash plants, using ZLCV-specific primers designed to direct amplification of nucleotides (ZLCV-F, ATCATGCTGTCCAGTCTCCT; and ZLCV-R, CCCACATTTTGCACTTGCGA) of the nucleocapsid gene region. The RT-PCR reaction for ZLCV detection consisted of reverse transcription at 46°C for 30 min, followed by denaturation at 94°C for 3 min, and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 45 s, and extension at 72°C for 45 s. Amplicons of the two ZLCV isolates (MK680830 and MK680831) were Sanger sequenced. The consensus sequences were aligned using clustalW and compared with other ZLCV sequences in the public domain using Mega 7 (Kumar et al. 2016). Alignments of the N gene sequences of these ZLCV isolates displayed nucleotide sequence identity above 94% with other ZLCV isolates available at the GenBank database. In addition, the amino acid sequence demonstrated above 97% identity with equivalent regions of S segment of Brazilian ZLCV isolate from Cucumis sativus and squash. The phylogenetic analysis of the identified sequence of ZLCV and other related sequences from GenBank showed a cluster of Argentine isolates close to ZLCV-DF isolate obtained from C. sativus (KU681011). This is the first report of ZLCV outside of Brazil. Although we have not observed the presence of Frankliniella zucchini in the field, which was identified and described as the vector of ZLCV (Riley et al. 2011), as well as virus distribution being limited to Brazil (Nakahara and Monteiro 1999), it would be important to consider the presumable entry of F. zucchini into Argentina.

Spatial and temporal variation of the vegetation of the semiarid Puna in a pastoral system in the Pozuelos Biosphere Reserve.

This study aimed to analyze the spatial and temporal variation of the vegetation in the northern Argentine Puna, utilizing both field sampling and remote-sensing tools. The study was performed within the Pozuelos Biosphere Reserve (Jujuy province, Argentina), which aims to generate socio-economic development compatible with biodiversity conservation. Our study was designed to analyze the dynamics of the Puna vegetation at local scale and assess and monitor the seasonal (dry and wet seasons), interannual, and spatial variation of the vegetation cover, biomass, dominant species, and vegetation indices. Ten vegetation units (with differences in composition, cover, and high and low stratum biomass) were identified at our study site. The diversity of these vegetation units correlated with geomorphology and soil type. In the dry season, the vegetation unit with greatest vegetation cover and biomass was the Festuca chrysophylla grassland, whereas in the wet season, the units with greatest cover and biomass were vegas (peatlands) and short grasslands. The Festuca chrysophylla grasslands and short grasslands were located in areas with clay soils, except peatlands, associated with valleys and coarse-texture soils. The vegetation indices used (NDVI, SAVI, and MSAVI2) were able to differentiate functional types of vegetation and showed a good statistical fit with cover values. Our results suggest that the integrated utilization of remote-sensing tools and field surveys improves the assessment of the Puna vegetation and would allow a periodic monitoring at production unit scale taking into account its spatial and temporal variation.

Dyslipidemia in schoolchildren with excess weight from Jujuy assessed by the program of school health

Excess weight (EW) and alterations in lipid metabolism constitute risk factors for cardiovascular disease in adults and children. Prevalence of dyslipidemia in schoolchildren from Jujuy with EW is analyzed in this study. Cross-sectional descriptive study of 891 schoolchildren 10-14 years old (367 girls; 524 boys) from the province of Jujuy (Northwestern Argentina). Prevalence of dyslipidemia for Overweight (OW) and Obesity (OB) were calculated, according to the International Obesity Task Force cut-off points. Prevalence of lipid alterations were analyzed and 7 dyslipidemic profiles were established. Comparisons and associations between variables were analyzed by Chi-square test. Crude and adjusted odds ratio were estimated from a logistic regressions. Regardless of sex and nutritional status, 13.7%, 21.8%, and 16.5% of schoolchildren showed high values of total cholesterol, triglycerides, and LDL cholesterol, respectively, and 20.3% had low HDL cholesterol. Significantly higher values of HDL cholesterol were found in OW, and of triglycerides in OB. A significant association was recorded between OB and high triglycerides. Schoolchildren with OB have a 54% more chances of showing at least one lipid alteration. EW, and especially OB, constitutes an important risk factor in the development of dyslipidemia in schoolchildren from Jujuy.

Highland Agricultural Knowledge in Migrant Families (Argentina)

Migrant families are key to observe the dynamic relationship between social groups and their territories. We have analyzed different aspects of the migration process of a large group of people in Argentina that currently dwell in a lowland’s peri-urban location (Buenos Aires Metropolitan Area) but whose genealogical origins are placed in Jujuy Province rural highlands (Humahuaca and Tilcara Departments). This paper presents a brief communication about our results and findings of a long-term research on agricultural practices and knowledge deployed in both geographical areas, which are united by a considerable migrant flow intensified during the last three decades. Regularities and changes in family farming type of organization and food knowledge and practices, are key to understand the cultural heritage firmly rooted in these families and the strength and sustainability of the migration process.

New specimen of Pucatherium parvum (Xenarthra, Dasypodidae), a singular dasypodid of the Paleogene (Eocene) of northwest Argentina: importance in the early evolution of armadillos

ABSTRACTA new specimen of Pucatherium parvum from the lower levels of the Upper Lumbrera Formation of Salta Province is reported. An almost complete dorsal carapace and several postcranial remains were preserved, providing important information about this particular taxon. The specimen is comparable in size to Dasypus novemcinctus, although the osteoderms are very small. The dorsal carapace seems to be completely integrated by movable osteoderms, providing a high degree of mobility in the anteroposterior axis. There is no evidence of pseudoshield, scapular shield, or pelvic shield. The dating of 39.9 ± 0.4 Ma (U-Pb zircon), taken from a tuff close to the top of the Upper Lumbrera Formation, allows us to refer this record of P. parvum to the middle Eocene (Bartonian). This, together with its broad geographic distribution, allows correlating the Upper Lumbrera Formation with the Quebrada de los Colorados Formation in Salta Province and with the Casa Grande Formation in Jujuy Province. On the other hand, the estimated depositional age of 37.3–35.4 Ma for the Geste Formation in Salta Province extends the biocron of P. parvum to the late Eocene.

Enigmatic Alluvial Sapphires from the Orosmayo Region, Jujuy Province, Northwest Argentina: Insights into Their Origin from in situ Oxygen Isotopes

This study sought to investigate in situ oxygen isotopes (δ18O) within alluvial colorless-white to blue sapphires from the Orosmayo region, Jujuy Province, NW Argentina, in order to provide additional constraints on their origin and most likely primary geological environment. Analyses were conducted using the in situ SIMS oxygen isotope technique on the same grains that were analyzed for their mineral inclusions and major and trace element geochemistry using EMPA and LA–ICP–MS methods in our previous study. Results show a significant range in δ18O across the suite, from +4.1‰ to +11.2‰. Additionally, akin to their trace element chemistry, there is significant variation in δ18O within individual grains, reaching a maximum of 1.6‰. Both the previous analyses and δ18O results from this study suggest that these sapphires crystallized within the lower crust regime, involving a complex interplay of mantle-derived lamprophyres and carbonatites with crustal felsic rocks and both mantle- and crustal-derived metasomatic fluids. This study reinforces the importance of the in situ analysis of gem corundums, due to potential significant variation in major and trace element chemistry and ratios and even oxygen isotope ratios within discrete zones in individual grains.

Prácticas de labranza en el sur de Pozuelos (Puna de Jujuy, Argentina). Avances en el análisis de implementos agrícolas prehispánicos

El propósito de este trabajo es discutir los resultados obtenidos del análisis de implementos agrícolas hallados en excavaciones realizadas en unidades residenciales del asentamiento arqueológico de Moreta (Provincia de Jujuy, Argentina). Se propone un estudio integral que conforma una síntesis de análisis lítico, arqueobotánico y del contexto doméstico en el que circularon dichos objetos. Esta investigación contribuye a comprender un aspecto importante de la reproducción de la vida social en el paisaje puneño durante la primera mitad del segundo milenio de nuestra era.

Paternal heritage in Jujuy province (Northwest Argentina): Evidence for sex-biased gene flow and genetic drift effects.

This study aimed to explore the diversity of paternal lineages in Jujuy province (Argentina) by analyzing Y chromosome markers. Furthermore, we examined among-population genetic variability based both on paternally (NRY haplotypes) and maternally (mtDNA haplogroups) inherited markers. We sought to evaluate the impact of sex-biased gene flow on genetic background in Jujuy, and contribute data on the microevolutionary forces acting in this zone. DNA from 149 males from five Jujuy regions were analyzed for 12 non-recombining Y (NRY) markers. Genetic heterogeneity among Jujuy regions was evaluated through population differentiation tests. To identify potential genetic boundaries in Jujuy, analysis of molecular variance (AMOVA) and the Monmonier's algorithm implemented in the Barrier v2.2 software were employed. A clear divergence between Jujuy highlands and lowlands for NRY haplotypes was found. A marked discrepancy between genetic structuring for paternal lineages and the lack of geographical pattern for mitogenomes was confirmed by all statistical analyses. Genetic structuring of paternal lineages is most likely caused by admixture processes that have occurred since colonial times in the Jujuy lowlands. Immigrants were predominantly male that settled in the lower altitude zones, due to the steep orography of the region. Input of allochthonous male lineages because of gene flow toward the lowlands would have increased diversity of NRY markers, thus compensating for drift effects. Likewise, limited input of allochthonous mitogenomes would have promoted genetic drift, a key factor in the shaping of diversity of maternal lineages across Jujuy subpopulations, irrespective of altitude.

Pennellia yalaensis (Brassicaceae: Halimolobeae), a New Species from the Andes of Northern Argentina

Abstract—Pennellia yalaensis, a new species of Brassicaceae from Jujuy Province in Argentina, is described and illustrated, and its phylogenetic relationships with nearest relatives are discussed. This novelty is morphologically related to P. boliviensis and P. brachycarpa, which also grow in the Central Andes of Argentina. However, P. yalaensis clearly differs from both species by the plant height, inflorescence type, and petal length. In addition, trichomes of the basal leaves distinguish the new species from P. boliviensis, and fruit length and number of ovules/seed from P. brachycarpa. Phylogenetic analyses, based on DNA sequences of nuclear ITS and plastid trnL-F regions, confirmed these affinities.

Programmatic human papillomavirus testing in cervical cancer prevention in the Jujuy Demonstration Project in Argentina: a population-based, before-and-after retrospective cohort study

Human papillomavirus (HPV) testing for cervical cancer prevention was introduced in Argentina through the Jujuy Demonstration Project (2011-14). The programme tested women aged 30 years and older attending the public health system with clinician-collected HPV tests. HPV self-collection was introduced as a programmatic strategy in 2014. We aimed to evaluate the effectiveness of programmatic HPV testing to detect cervical intraepithelial neoplasia (CIN) of grade 2 or worse (CIN2+) in comparison with cytology-based screening. We did a population-based, before-and-after retrospective cohort study using data from the National Cervical Cancer Prevention Program for the Jujuy province in northwest Argentina. We obtained data for the cytology-based screening period from Jan 1, 2010, until Dec 31, 2011, and for the HPV-based screening period from Jan 1, 2012, until Dec 31, 2014. The primary outcome was detection of histologically diagnosed CIN2+ among women aged 30 years and older. To assess the outcomes in all individuals included in the study, we used multivariable logistic regression and propensity score matching. The reach, effectiveness, adoption, implementation, and maintenance (RE-AIM) framework was used for the before-and-after analysis of programmatic dimensions. Of the 29 631 women who underwent cytology-based screening in 2010-11, CIN2+ was detected in 236 (0·8%) individuals. Of the 49 565 women HPV tested in 2012-14 (clinician-collected tests, n=44 700; self-collection tests, n=4865), 693 (1·4%; 658 clinician-collected tests; 35 self-collection tests) were found to have CIN2+ after the first round of screening. Compared with cytology-based screening, the odds ratio of being diagnosed with a CIN2+ lesion was 2·34 (95% CI 2·01-2·73; p<0·0010) with clinician-collected tests, and 1·08 (0·74-1·52; p=0·68) when screened with self-collection tests, after controlling for age and health insurance status. Screening coverage was similar in both periods (52·7% vs 53·2%); improvements of programmatic indicators were observed in the HPV testing period in relation to laboratory centralisation, lower overscreening (6·6% vs 0·0%), higher adherance to age recommendations (79·3% vs 98·8%), and a decrease of inadequate samples (3·6% vs 0·2%). HPV testing in middle-income settings increases detection of CIN2+ lesions and allows for improvement of programmatic indicators. Evidence suggests that the introduction of HPV testing will accelerate the reduction of cervical cancer burden. Argentinian National Cancer Institute and National Council of Scientific and Technologic Research.

Geographic altitude and prevalence of underweight, stunting and wasting in newborns with the INTERGROWTH‐21st standard

ObjectiveTo assess the prevalence and risks of underweight, stunting and wasting by gestational age in newborns of the Jujuy Province, Argentina at different altitude levels. MethodsLive newborns (n=48,656) born from 2009–2014 in public facilities with a gestational age between 24+0 to 42+6 weeks. Phenotypes of underweight (<P3weight/age), stunting (<P3length/age) and wasting (<P3body mass index/age) were calculated using Intergrowth‐21st standards. Risk factors were maternal age, education, body mass index, parity, diabetes, hypertension, preeclampsia, tuberculosis, prematurity, and congenital malformations. Data were grouped by the geographic altitude: ≥2.000 or <2.000m.a.s.l. Chi‐squared test and a multivariate logistic regression analysis were performed to estimate the risk of the phenotypes associated with an altitudinal level ≥2.000m.a.s.l. ResultsThe prevalence of underweight, stunting and wasting were 1.27%, 3.39% and 4.68%, respectively, and significantly higher at >2.000m.a.s.l. Maternal age, body mass index >35kg/m2, hypertension, congenital malformations, and prematurity were more strongly associated with underweight rather than stunting or wasting at ≥2.000m.a.s.l. ConclusionsUnderweight, stunting, and wasting risks were higher at a higher altitude, and were associated with recognized maternal and fetal conditions. The use of those three phenotypes will help prioritize preventive interventions and focus the management of fetal undernutrition.

Los Alisos, a new fossiliferous locality for Guanaco Formation (late Miocene) in Jujuy (Argentina), and a first approach of its paleoecological and biochronology implications

Very scarce information is available about the extinct Neogene communities of the Subandean valleys of Jujuy province, Northwestern Argentina. A new vertebrate fossiliferous locality (Los Alisos), and the first mammalian assemblage from Guanaco Formation, is described. The taxa recorded include mainly caviomorph rodents (Hystricognathi) represented by Orthomyctera sp., Lagostomus sp., and an Octodontoidea and cingulates (Xenarthra) represented by the armadillos aff. Stenotatus, Dasypus sp. nov., two Euphractinae, and a Glyptodontidae. A single remain of a turtle (Testudines) is also described. The composition of the faunistic record has similitude with Andalhuala, Chiquimil and Salicas formations, but some taxa differ from all other late Miocene Northwestern Argentina localities. The most outstanding feature of Los Alisos paleocommunity is the presence of Dasypus, which confirms the existence of the genus in times as old as the late Miocene. The presence of a tuff with known age (5.9–6.4 Ma) immediately below to the fossiliferous level gives a lower temporal constraint for the association, and this absolute age as well as the biochrons of the identified taxa are compatible with an Huayquerian stage. The integrative analysis of the mammals of Los Alisos allowed preliminary paleoecological and paleoenvironmental inferences for Guanaco Formation, indicating a landscape composed by open areas, whether extensive or arranged in patches, including grasslands, under warm and seasonal climatic conditions.

How integrative taxonomy can save a species from extinction: The supposedly extinct mouse opossum Cryptonanus ignitus (Diaz, Flores and Barquez, 2000) is a synonym of the living C. chacoensis (Tate, 1931)

We reviewed the taxonomic status of the “extinct” mouse opossum Cryptonanus ignitus (Diaz, Flores and Barquez, 2000). This species is only known from the type, an adult male collected in the province of Jujuy, northwestern Argentina, in 1962. Based on both qualitative and quantitative external and cranial traits and the analysis of DNA sequences extracted from the 57-year-old type skin, we confirm the suggestion of previous researchers that C. ignitus is an elderly example of the living species C. chacoensis (Tate, 1931). Most of the supposedly diagnostic morphological traits of C. ignitus (e.g., zygomatic arches unusually wide and robust, postorbital process of the jugal massively developed, prominent temporal scars) are age-correlated in didelphids and were observed in other adult specimens of C. chacoensis. The clay coloration of the ventral pelage of C. ignitus, which allegedly sets apart this species from other congeners, is here reported for new examples of C. chacoensis from other localities. Our results suggest the need to carefully evaluate the taxonomic status of other species supposed to have become extinct in recent times in mainland South America.

La enfermería en el Noroeste argentino. Cambios y permanencias en el proceso de profesionalización de la enfermería en Jujuy durante el primer peronismo (1946-1955)

Este artículo se inserta dentro del conjunto de estudios que analizan la historia de la enfermería en la Argentina. Tiene como objetivo examinar los cambios y permanencias producidos en el proceso de profesionalización de la enfermería en la provincia de Jujuy, a partir de la creación de la escuela de enfermería durante el gobierno del primer peronismo (1946-1955). En un distrito que por entonces exhibía preocupantes condiciones sanitarias, esta etapa estará signada por relevantes avances en la materia, aunque no exenta de revisiones y reformulaciones, al calor de debates y reorganizaciones llevados a cabo también a nivel nacional.

A new species of Farlowella (Siluriformes: Loricariidae) from the upper Bermejo River, La Plata River basin, northwestern Argentina

ABSTRACT A new species of Farlowella is described from the Bermejo River basin, in Salta and Jujuy provinces, northwestern Argentina. The new species belongs to the Farlowella nattereri species group. The new species is diagnosed by the following combination of characters: marbled rostrum, five rows of lateral plates series, relatively short snout (snout-mouth length less than 50.0% of head length), complete half-moon shaped spot on caudal fin, and short predorsal distance (37.8-41.8% of standard length).

An Updated Review of the Avian Footprint Record from the Yacoraite Formation (Maastrichtian-Danian), Northwestern Argentina

The Yacoraite Formation (Maastrichtian–Danian; Balbuena Subgroup; Salta Group), from Northwestern Argentina, represents a shallow epeiric unit which is the result of transgressions in the Andean basin of South America. Herein, we study the avian footprints from the Maimará locality, Jujuy province, and Quebrada del Tapón ichnosite, Salta province. The avian footprints from the Maimará locality is less diverse, made up: cf. Alaripeda isp., Avipeda isp., cf. Gruipeda filiportatis, and cf. Gruipeda isp. The avian track record from the Quebrada del Tapón ichnosite is composed of: cf. Alaripeda isp., Ardeipeda cf. egretta., Gruipeda filiportatis (=Yacoraitichnus avis) and others Gruipeda or compared to this ichnogenus, cf. Uhangrichnus isp., and several indetermined avian footprints. Both ichnological assemblages have tracks assigned to shorebirds or Charadriiformes. The facies distribution of trace fossils reinforces the overall model of a shorebird tracks dominance in moderate to low energy settings. This distribution can be divided into three sub-environments: (1) a moderate to high energy shoreline under wave action, (2) a supratidal body of ephemeral ponds, far away from direct wave influence and (3) a landward position, beyond the ephemeral ponds system. We have included all the ichnoassemblages within the shorebird ichnosubfacies as a subset of the Scoyenia Ichnofacies.

El día de los muertos y el cuidado del espíritu en el noroeste argentino.

Se describen y analizan las prácticas de cuidado ante la muerte y su expresión narrativa en el contexto ritual de Perico, una localidad de la Provincia de Jujuy, Argentina. Abordamos una relación poco explorada entre cuidados y muerte, a partir de materiales originales recabados mediante observación y entrevistas abiertas, extensas y recurrentes, en el marco de un extenso trabajo de campo entre los años 2009 y 2014. Desde un abordaje cualitativo, desarrollamos una estrategia interpretativa a partir de la deconstrucción de significados en torno de las creencias sostenidas por nuestros informantes. Prestamos especial atención a los ritos mortuorios en el contexto del Día de los Muertos, los que ponen en evidencia la combinación de concepciones ancestrales y experiencias religiosas, como las estrategias cognitivas relativas a la significación de la vida y la muerte.

Technological change during final Mid-Holocene and early Late Holocene (ca. 5000-2000 years BP) in Barrancas (Jujuy province, Argentina)

The archaeological evidence from the end of the Middle Holocene and the beginning of the Late Holocene (ca. 5000-2000 years BP) shows a period of great changes. These appear to be the main result of low residential mobility occupations and subsistence strategies based in the specialized hunting of camelids, their domestication and further herding. Even though there is no consensus over the relative importance of each adopted strategy (hunting vs. herding) during this temporal sequence, several and relevant changes can be observed, related to many social spheres. In this paper, we present the particular changes over lithic technology during the temporal sequence proposed through two sites analysed from Barrancas: Laguna Media 7 and Morro Blanco. First, we will clarify the concept of technical system and describe the operative chains observed in both sites. This context is suitable for the topic addressed in this paper, since the chronological difference between both sites (ca. 3400-3200 years BP) is almost contemporary with the appearance in the region of the domesticated camelid Lama glama. Thus, we explain the changes in lithic technology and their relation with the other raw materials used in different technologies from a qualitative characterization. Afterwards this change is characterized by performing separate Chi square analysis from the quantification between both sites of: transformative and prehensile techno-units, shaping and knapping methods. We detect some continuities related to the operative chains, but some changes as well, with the disappearance of blade knapping. Finally, we conclude that the changes during this time period are mainly related with the prehensile and hafting system, associated to a broader regional technological change, influenced by the circulation and exchange of goods, knowledge and people.

Descripción morfológica de los estadíos larvales I y II y redescripción de la hembra de Chaetanaphothrips orchidii Moulton (Thysanoptera: Thripidae), con comentarios sobre sus plantas hospederas

The external morphology of larval stages I and II is described for the first time, and the female of Chaetanaphothrips orchidii Moulton is redescribed, from specimens obtained from the breeding of the insect under laboratory conditions and from samples collected on grapefruit fruits (Citrus paradisi Macfad) var. flame, foster and rouge; orange (Citrus sinensis L.) var. valencia; lemon (Citrus limon Burm) var. genova, and spontaneous flowering vegetation from citrus crops in the provinces of Jujuy and Salta (Argentina)

The asymmetry of dermatoglyphic finger ridge counts and the geographic altitude of the Jujenean population in northwest Argentina

Asymmetry is omnipresent in the living world and therefore is a measure of developmental noise and instability. The main stressing agent in high-altitude ecosystems is hypobaric hypoxia. The variation in bilateral dermatoglyphic symmetry in populations from the Province of Jujuy in northwest Argentina is analyzed, and these results are compared to those for other populations with different ethnic and environmental backgrounds. Fingerprints were collected from 310 healthy students (140 males and 170 females) aged 18–20 years from three localities in Jujuy Province—Abra Pampa (3484 m above sea level), Humahuaca (2939 m above sea level), and San Salvador de Jujuy (1260 m above sea level). Asymmetry by sex was assessed based on radial and ulnar ridge counts to determine its pattern of variability (directional asymmetry [DA], fluctuating asymmetry [FA] and antisymmetry), and asymmetry and diversity indices were calculated. A bivariate plot and principal component analysis (PCA) were used to compare these indices with those for other populations. Homogeneity was found between populations and sexes when radial and ulnar ridges were counted. FA values did not show significant differences by locality or side (ulnar and radial), but significant differences were found by finger and sex, with males showing significantly greater FA values. The asymmetry and diversity indices clearly group the Andean populations and separate them from populations of different ethnic and geographic origin. Only the diversity index showed significant differences by locality in males, which suggests a substantially different genetic component in Abra Pampa male samples.