Grass Plants Research Articles

Leaf anatomy of 'Marandu' grass cultivated in plant arrangements in agrosilvopastoral systems

Abstract: The objective of this work was to evaluate the effects of different arrangements of eucalyptus plants on the morphoanatomical characteristics of leaf blades of 'Marandu' grass [(Urochloa brizantha (Syn. Brachiaria brizantha)] plants cultivated in agrosilvopastoral systems. The experiment was set in field conditions in a randomized complete block design with four replicates, in which the plots were represented by planting spacings of eucalyptus (12x2 and 12x4 m), and the subplots, by the distance between 'Marandu' grass and eucalyptus rows (6, 4, and 2 m). A control was added, composed by 'Marandu' grass cultivated in full sun. Variables of the leaf anatomy of 'Marandu' grass were evaluated for shading interference by trees. The distance of 'Marandu' grass plants from the eucalyptus lines interfered with the leaf blade anatomy of the forage, and the highest modifications occurred in linear measures and tissue proportions in the arrangements with the highest eucalyptus density. The shading interference of eucalyptus on the anatomical characteristics of leaf blades of 'Marandu' grass depends on the adopted arrangement. This occurs due to the grass adaptation to the low-light incidence, with a consequent reduction in its physiological activity and growth.

Features of the Structural and Functional Organization of Pathogenic Fungi Herbage of Silvopastoral System

The materials devoted to the study of the features of the organization of the microflora communities of the pathogenic microflora of grassy vegetation of pastures of the open steppe and under the protection of artificial plantations are presented. The facilities are located on the lands of the North-Caucasus branch of the Federal Science Center for Agroecology, Russian Academy of Sciences in the Stavropol Territory. The identification of the species diversity of phytopathogens and the assessment of the intensity of plant infection were carried out by visual examination of the vegetation and subsequent analysis of the samples in the laboratory using methods generally accepted in phytopathology. The assessment of the biocenotic role of protective forest stands and the peculiarities of the formation of biotic microflora complexes was carried out using indices that are widely used to characterize biological diversity. The climate here is sharply continental, dry, with increased wind activity during the spring and autumn-winter periods. A distinctive feature is the frequent recurrence of southerly and southeastern winds. Soils are light brown, partially saline. Found 139 plant species. The species composition of pathogenic microflora, parasitic on plants of pasture grass stand, which is represented by 116 species, is described. Dominant species parasitizing on grassy vegetation of forest pastures have been established. Of the pathogens, mushrooms from the Pucciniomycetes and Dothideomycetes classes predominate. Most often on grassy vegetation of pastures there are powdery mildew fungi of the genus Erysiphe (11 species), parasitic on widespread cereals, the genus Leveillula (5 species), found on Asteraceae and Labiatae, as well as species of fungi of the genus Ustilago (7 species). Rust fungi of the genus Puccinia are widely represented in these biotopes - 39 species. Especially harmful pathogens annually cause significant damage to plants, are economically significant, and in favorable weather conditions, they cause epiphytotics: Erysiphe umbelliferarum f. falcariae, E. graminis f. agropyri, E. graminis f. bromi, Uromyces glycyrrhizae, Ustilago bromivora etc. An assessment of the α-diversity of the parasitic mycobiota revealed that the mycocomplex of the grass stand under the protection of shelterbelts with Elaeagnus angustifolia and Robinia pseudoacacia is characterized by the highest species abundance.

Responses of Ornamental Grass and Grasslike Plants to Saline Water Irrigation

Ornamental grasses are popular in urban landscapes in Utah and the Intermountain West United States, one of the driest and fastest growing regions in the United States. This experiment evaluated the responses of five ornamental grass species [blue grama (Bouteloua gracilis), indian sea oats (Chasmanthium latifolium), ‘Blue Dune’ sand ryegrass (Leymus arenarius), pink muhly grass (Muhlenbergia capillaris), ‘Foxtrot’ fountain grass (Pennisetum alopecuroides)] and two ornamental grasslike species [fox sedge (Carex vulpinoidea), common rush (Juncus effusus)] to saline irrigation water in a greenhouse. Plants were irrigated weekly with a nutrient solution at an electrical conductivity (EC) of 1.2 dS·m–1 (control) or saline solutions at an EC of 5.0 or 10.0 dS·m–1. At the first harvest (9 weeks after the initiation of treatment), sand ryegrass, pink muhly grass, and fountain grass irrigated with solutions at an EC of 5.0 and 10 dS·m–1 had good visual quality with no or minimal foliar salt damage; however, the remaining species exhibited slight or moderate foliar salt damage. There were no significant differences in shoot dry weight (DW) among treatments within any species, except fox sedge and fountain grass. At the second harvest (18 weeks after the initiation of treatment), sand ryegrass, pink muhly grass, and fountain grass still had no or minimal foliar salt damage, and indian sea oats and fox sedge exhibited slight or moderate foliar salt damage. Compared with the control, all species irrigated with solutions at an EC of 10.0 dS·m–1 had reduced shoot DWs with the exception of blue grama. However, only common rush and pink muhly grass irrigated with solutions at an EC of 5.0 dS·m–1 had lower shoot DWs than the control. These results demonstrated that seven ornamental grass or grasslike species had a very strong tolerance to the salinity levels used in the 4-month experiment. Although plant growth was inhibited as a result of saline irrigation, plant visual quality of sand ryegrass, pink muhly grass, and fountain grass was still acceptable. These three species appear to be more suitable for landscapes in which saline irrigation water is used. Further research is needed to evaluate more ornamental grasses for landscapes in salt-prone areas and nearby coastal regions.

Genetic transformation of OsMYB6 and OsMYB7 transcription factor into Nipponbare rice cultivar for lignin content manipulation

Windiastri VE, Pantouw CF, Astuti D, Widyajayantie D, Estiati A, Nugroho S. 2018. Genetic transformation of OsMYB6 andOsMYB7 transcription factor into Nipponbare rice cultivar for lignin content manipulation. Pros Sem Nas Masy Biodiv Indon 4: 220-224. Lignin is a raw natural material for fuel and chemical industry. In near future, it is predicted that lignin demands for thoseindustries will increase significantly. In the current situation, hard woody plants, usually from the forest and plantation, are the mainresource of lignin production. It is because woody plants have higher content of lignin than non woody plants, i.e. sorghum, rice andalang-alang. Enhanced lignin content manipulation in the non woody plants, grass plants for an example, could be a solution to get otherrenewable sources, than woody plants, for lignin production. Biosynthesis of lignin are regulated by many genes and transcriptionfactors, among of them identified from rice, i.e., OsMYB6 and OsMYB7 and also involved in secondary cell wall formation. Tomanipulate lignin content in the rice plants, we transformed OsMYB6, OsMYB7 transcription factors and pC1305 empty plasmid ascontrol into Nipponbare rice cultivar mediated by Agrobacterium. Transformation efficiencies for OsMYB6, OsMYB7 and pC1305control are 5%, 11% and 4%, respectively. The result of marker gene (hptII) amplification from the total genome DNA of the transformantplants showed that OsMYB6 and OsMYB7 transcription factors were successfully transformed into Nipponbare rice cultivar.

Chromium bioaccumulation, oxidative stress metabolism and oil content in lemon grass Cymbopogon flexuosus (Nees ex Steud.) W. Watson grown in chromium rich over burden soil of Sukinda chromite mine, India

Lemon grass plants grown in Cr rich over burden soil of Sukinda chromite mine (India) countered Cr toxicity and oxidative stress with the production of reactive oxygen species and induced antioxidative defense system. Varied percentage of Cr rich over burden soil was applied to lemon grass pants to evaluate the actions of oxidative inhibitors enzymes extracted and assayed from both roots and shoots. The study also assessed the oil content and its composition in response to the different percentage of Cr available in over burden soil. In order to evaluate the defense system of a plant against oxidative stress and determine the level of reactive oxygen species, the experiments were undertaken in the presence and absence of Cr in soils. The results indicated that the action of oxidative inhibitor enzymes increased significantly in roots as compared to shoots with increasing concentration of Cr in overburden soil. Higher concentration of Cr in soils inhibited the enzyme activity both in roots and shoots. The level of ROS in plants also enhanced with the increase in the concentration of Cr in the soil. In order to control the oxidative damage in plants, lemon grass can be considered defensive in nature to build up the antioxidant system which can scavenge the reactive oxygen species (ROS).

KOMPARASI KEKUATAN TEKUK PADA KOMPOSIT LAMINA DENGAN MATRIK DUA JENIS KAYU DAN REINFORCEMENT BAMBU

Natural materials are environmentally friendly materials that can be made as components of matrix and reinforcement. Wood is part of the stem or branches and twigs of hardened plant due to lignification. Bamboo is a type of grass plants belonging to the order Graminae, familia Bambuseae, rooted fibers, the trunk-shaped cylinder with a diameter that varies from base to tip, hollow, hard. The composite is a composite of two or more materials that are integrated macroscopically and form a new properties. The composite type used in the laminate composite consists of two different layers of material and combined together, using adhesive, the manufacturing process using the hand lay up method. Matrix used balsa and mahoni wood, for reinforcement used type of bamboo apus molded basket woven. Bending test, using ASTM D7264 / D7264M-07 standard. The results of the experiment by testing each test, using 3 test specimens, then taken the average value. For balsa wood matrix, with plain woven reinforcement, buckling strength with value 35.60 ± 2.30 MPa, for balsa wood matrix, with basket woven reinforcement, buckling strength with value 32.64 ± 4.20 MPa. For mahoni matrix, with plain woven reinforcement, buckling strength of 55.15 ± 4.89 MPa, for mahoni matrix, with basket woven reinforcement, buckling strength of 77.15 ± 4.88 MPa. From these data shows that by using mahoni matrix the buckling strength is greater than using balsa wood matrix, either using plain or basket woven.

Distribution and Phytoavailability of Potentially Toxic Metals in Different Fe/Mg Mine Tailings.

The environmental risk of potentially toxic metals in tailing soils is of universal concern. We conducted a 3-month pot experiment to research the distribution and variations of potentially toxic metals (PTMs), and the translocation and accumulation capability of these metals (Cr, Ni, Mn, Cu, Zu) in natural plants for three Fe/Mg tailing soils (serpentine-type, olivine-type and magnetite-type) with growth of a grass plant-Imperata cylindrica. We used comparative analysis, regression analysis and correlation analysis to process relevant experimental data. Results showed the rhizosphere tailing soils decreased from 3.70% to 16.8%, compared to the bulk soils, after growth of Imperata cylindrica, and the acid soluble fraction of Mn, Cu and Zn increased significantly. Cu and Zn were more bioavailable than other PTMs, especially for serpentine-type tailing soils. Linear regression analysis indicated that non-residual fractions showed different effects on metal concentrations of Imperata cylindrica. The non-residual metal fractions of serpentine-type and olivine-type tailing soils showed better correlations with metal concentrations in grass plants than those of magnetite-type tailing soils. We found that the chemical compositions of tailing soils showed remarkable effects on Ni and Mn compared with other elements, especially Mg and Al. Overall, the grass plant can alter the metal distribution, enhance metal bioavailability and promote land use of Fe/Mg tailing soils.

Growth-defense trade-off regulated by hormones in grass plants growing under different grazing intensities.

Herbivory creates conflicts between a plant's need to allocate resources for growth and defense. It is not yet clear how plants rebalance resource utilization between growth and defense in response to increasing grazing intensity. We measured characteristics of the primary and secondary metabolism of Leymus chinensis at five levels of grazing intensity (control, light, moderate, heavy and extremely heavy). Furthermore, we evaluated hormone signaling by quantifying the impact of key hormones on plant growth and defense. Under light grazing intensity, indole-3-acetic acid and jasmonates appeared to promote the growth of L. chinensis through a high photosynthetic rate, high water-use efficiency and high soluble protein contents, whereas abscisic acid decreased these properties. Under moderate grazing intensity, L. chinensis had a low photosynthetic capacity but greater production of secondary metabolites (tannins, total flavonoids and total phenols), possibly induced by salicylic acid. When the grazing pressure further intensified, L. chinensis translocated more carbohydrates to its roots in order to survive and regrow. Leymus chinensis therefore exhibited a trade-off between growth and defense in order to survive and reproduce under herbivory. Plants developed different mechanisms to enhance their grazing tolerance by means of hormonal regulation.

Understanding biomass recalcitrance in grasses for their efficient utilization as biorefinery feedstock

One of the main challenges for the deployment of lignocellulosic biorefineries in future years is to find renewable and secured biomass sources in order to obtain bio-sourced products, as an alternative to petroleum-based commodities. Grass biomass, considering its characteristics (availability, composition, productivity, possibility of being harvested from both arable (post-harvest residues) and non-agricultural lands), can be considered as a biomass source for the future. Nevertheless, because of its complex structure and composition, which need deconstructive pre-treatments to render possible further biological conversions, grasses utilisation in biorefinery is today not widespread. Indeed, recalcitrance to polymers degradation in grasses concerns structural and compositional characteristics and can result in costly and complicated biorefinery processes. Grass recalcitrance is due to various natural factors strongly related and difficult to dissociate: rind and vascular structures; composition (lignin content is a key factor for cellulose hydrolysis acting like a physical barrier while hemicelluloses seem to play a more significant role in woody biomass than in grass plants); physical structures (crystalline nature and insoluble surface of cellulose, specific surface area, particle size), etc. Physico-chemical pretreatments are efficient solutions to overcome recalcitrance, while phenotypic selections are interesting but not efficient enough to obtain an optimal enzymatic hydrolysis. In some cases, the structural elements of grass biomass can be negatively affected by physico-chemical pretreatments, causing pre-treatment-induced recalcitrance, like cellulose hornification (irreversible alteration of cellulose microfibers), vascular structure collapsed and reduced cellulose bioaccesibility to enzymes due to cellulose covering by lignin, following lignin solubilisation.

Dynamics of grass stand formation in poplar plantations on different types of reclamations of disturbed lands of Western Donbass

The purpose of our research was to study the long-term dynamics of the herbage cover at different stages of growth and development of poplar plantations on the types of artificial soils of the forest reclamation area. The object of research is flora phytotoxic dumps of «Blagodatna» coal mine, where imported substrates such as sand-clay, clay loam, red-brown earth and humic soil in various combination were applied to create reclamations layer on the surface of the mine dumps (Dnipropetrovsk region, Pavlograd region). Type 1: 30 cm of soil mass of typical chernozem (SMTC), 50 cm of red-brown earth, 80 cm of alluvial sand-clay and sand, and deeper there is the coal mine solid; type 2: 30 cm of SMTC, 80 cm of sand, and mine solid deeper; type 3: 30 cm of SMTC, 60 cm of alluvial sand-clay, 60 cm of clay, and deeper there is mine solid; type 4: 40 cm of SMTC, 30 cm of red-brown earth, 40 cm of sand and mine solid deeper; type 5: 55 cm of alluvial sand-clay, deeper there is mine solid. Stationary observations were carried out in poplar plantations of 8-, 16-, 27- and 34-year-old age on permanent trial plots. They were presented with a black poplar and seven hybrid poplars. The research has established that climatic conditions, influence of surrounding phytocenoses of undisturbed lands, inheritance by pedozems of seed material of grass plants with a fertile layer of the soil set the direction of succession on the way of formation of zonal herbal group. The long-term growth of the role of the arid element indicates the formation of a structure close to the zonal flora. The formation of the flora of technical soils in poplar plantations occurs in four stages: the first is pioneer plant communities, which begins with the completion of the technical phase of reclamation and confined to the stages of forest formation; the second is a simple grouping that is associated with the development of the stand until the closure of canopy and inter-row soil cultivation; the third is a complex grouping that is fraught with pole wood stage of stand development and partial getting sparse; the fourth in our studies, is partially closed when gradually tree plants disappear and their influence disappears. In addition to the influence of tree vegetation, its age and stage of development, the formation of lower layers of biogeocenoses is significantly influenced by the conditions stipulated by the stratigraphy and the power of artificial substrates, as well as the elements of the landscape, both created initially and formed as a result of the fragmentary subsidence of the dump territory. These factors, depending on their dynamic changes, regulate correlation between various groups of biomorphs, climamorphs, trofomorphs, hygromorphs, heliomorph and zenomorphs in the grass cover. Created forest vegetation conditions on the plateau and the upper third of the dump do not meet the needs of hybrid poplars under conditions of acute shortage of moisture, which are characteristic of the steppe zone. Fast-growing poplar hybrids can be used as a pioneer culture up to 15–20 years of age.

Establishment and Trends in Persistence of Selected Perennial Cool-Season Grasses in Western United States

Restoring western US rangelands from a site dominated by invasive annuals, such as cheatgrass and medusahead, to a diverse, healthy, perennial plant−dominated ecosystem can be difficult with native grasses. This study describes the establishment and trends in persistence (plant/m2) of native grass cultivars and germplasm compared with typically used crested and Siberian wheatgrasses at four locations in Idaho (one), Wyoming (one), and Utah (two) that range in mean average annual precipitation (MAP) from 290 to 415 mm. Sites were cultivated and fallowed 1 yr before planting using two glyphosate applications to control weeds. We monitored seedling establishment of 10 perennial cool-season grass species and plant persistence over 5 yr. Precipitation during the seeding year varied with the Utah sites locations reviving below MAP (4% and 14%), while the Wyoming and Idaho sites received above MAP at 8% and 26%, respectively. Across these four sites, native grass seedling establishment of bottlebrush squirreltail (29 ± 0.08 [standard error] seedling/m2), bluebunch (28 ± 0.05), slender (30 ± 0.05), and Snake River wheatgrasses (28 ± 0.08) was similar to “Vavilov II” Siberian wheatgrass (36 ± 3.20). By yr 5, western, Snake River, and thickspike wheatgrasses were the only native grasses to have plant densities similar to Vavilov II (37 ± 0.29) Siberian and “Hycrest II” (36 ± 0.29) crested wheatgrasses. On sites receiving between 290 and 415 mm MAP, our data suggest that native grasses are able to establish but in general lack the ability to persist except for western, Snake River, and thickspike wheatgrasses, which had plant densities similar to crested and Siberian wheatgrasses after 5 yr.

Influence of forest plantations of fine-leaved linden on main properties of dark-chestnut soil of agrobiostation – botanical garden of KSU

The aim of this work – determination of soil-transforming role of fine-leaved linden fall in forest plantations on dark-chestnut soil. Research materials and methods . Dark-chestnut soil was chosen as an object of our research. For making the comparative analysis, indices of soil properties were determined in forest plantations of fine-leaved linden and in motley ― fescue-feather grass steppe in the period from 2014 to 2018 years at the territory of Agrobiostation-botanical garden of KSU, where two experimental plots were founded. Soil samples were taken in a layer in 0-50 cm. Fall and remains of steppe plantations were not excluded since the beginning of experiment in autumn. All laboratory studies were realized according to standard conventional methods. Research results . At realizing the work we established that the humus content in dark-chestnut soil with plantations of middle-aged trees of fine-leaved linden increased by 0,13%; the steady alkaline medium formed, the granulometric (mechanical) composition changed from the light to the heavy one by the content of physical mud. The humus content in dark-chest-nut soil with motley ― fescue - feather grass plantations increased in 1,1 times that is 0,10 %; the light-sour medium formed, the granulometric (mechanical) composition changed from the light to the middle one by the content of physical mud. Conclusions . Under the influence of fine-leaved linden fall dark-chestnut soil essentially improves its natural properties, but at that the environment for plants, adopted for other conditions essentially changes. Steppe plantations form the light-sour medium, so humus and calcium accumulate slowly, and magnesium – intensively. Dark-chestnut soil has a high absorbing capacity and is a kind of natural cleaner of biogeocenose that must be taken into account at forming urban ecosystems. The quality increase of dark-chestnut soil by biological means is recommended to be realized not only be intensifying metabolism in the system “forest-soil”, but also by strengthening accumulation processes that is increasing the total absorbing capacity of forest biogeocenose

Mineralogical, Geotechnical Characterization and Stability of the Cut Slopes of Widikum and its Surroundings (North-West Cameroon)

The Widikum highlands and its surroundings are located in the North West Region of Cameroon. These five last years, landslides are frequently affecting movement on this portion of the highway. An investigation for understanding the mechanism of these phenomena was recently performed to clarify and to propose suitable remediable solutions. The study included mineralogical and geotechnical characterization of the local soil materials. The X-ray diffraction mineralogical analysis on clay fractions reveals the presence of phyllitic minerals (kaolinite, gibbsite, montmorillonite, illite and biotite). Associated minerals are mainly represented by quartz. Montmorillonite has the small crystal and largest surface which aid in increasing its adsorptive capacity. Clayed minerals can cause swelling and consequently the change or variation of the mechanical characteristics of the materials. The natural water content of weathered products vary from 27 to 47.4% which are close or even lower than the liquid limit included between 59.4 and 71.9%, this justify their unstable character. In addition, the high plasticity index ranges between 17.9 and 29.3% and is indicative of plastic materials thus very sensitive to creep. Moreover, the saturation ratio is very high (60 - 96%) thus attesting to their quasi saturated state. It is advisable to reduce the height of the steps to 2.3m by opting for a bench of 3m and adopting an inclination angle of β = 37.5°. Building retaining structures as well as eucalyptus and vertiva grass planting is recommended to reduce landslide incidences.

Recovery of Pasture Forage Production Following Winter Rest in Continuous and Rotational Horse Grazing Systems

Winter rest is commonly recommended to aid in regrowth of spring forage in horse pastures. The purpose of this study was to determine the effect of previous grazing method (continuous [CON] vs. rotational [ROT]) on recovery of pasture production following a period of winter grazing exclusion. Pasture forage yield, persistence, and quality were assessed monthly in two horse pastures, one CON and one ROT, from April to August 2017. Herbage mass was greater in ROT in May (ROT 2,701.8 ± 176.0; CON 1,439.0 ± 155.06 kg/ha; P = .0008), June (ROT 3,778 ± 21.59; CON 2,507.0 ± 274.7 kg/ha; P = .0007), and July (ROT 4,755.8 ± 263.1; CON 3,627.8 ± 318.66 kg/ha; P = .0053), while sward height only differed by grazing system in May (ROT 21.87 ± 0.68; CON 13.02 ± 0.68 cm; P < .0001). Overall, prevalence of planted grass species was greater in ROT (35.17 ± 2.47%) than CON (22.67 ± 0.92%; P = .0009). Furthermore, there was an association between pasture forage composition and grazing management system at all sample points other than in August (P < .05). In addition, sward components were most affected by previous grazing system in April and May, with a greater proportion of live leaf in ROT than CON (P < .03). These results demonstrated that even after prolonged rest, previous management of pasture influenced forage regrowth. Findings of this study support the implementation of ROT grazing practices as a means of optimizing long-term pasture production.

Decomposition of straw resulting from different strategies of recovery of degraded pastures using an integrated crop-livestock system

Several strategies have been used to improve soil fertility using integrated crop-livestock (ICL) systems, and the harvest of the accompanying crop used for silage may have several benefits to the soil depending on the quantity and quality of the remaining litter, providing dry matter (DM) for no-tillage systems and nutrient mineralization for the subsequent crop. The objective of this study is to evaluate the rate of decomposition of macro- and micronutrients of the DM of litter produced in ICL systems at different harvest heights in one year. The study was developed at the Experimental Farm of UNESP in Selvíria, Mato Grosso do Sul, Brazil, in the dry season. The study included five replications in plots of 200 m2 and was arranged in a completely randomized block design. The following treatments were analyzed: control sample-degraded pasture of signal grass; Marandu grass-pasture renewal from signal grass to Marandu grass; succession 45-planting of sorghum (forage sorghum cv. Volumax) and crop harvest at the height of 45 cm for silage followed by planting of Marandu grass; simultaneous seeding of Marandu grass and sorghum, and crop harvesting for silage at the height of 15 cm (Marandu + sorghum 15) and 45 cm (Marandu + sorghum 45) from the soil surface. After crop harvesting, proportional amounts of green mass remaining from each unit were collected, transferred to nylon bags, and placed in direct contact with the soil of the respective experimental unit. Each bag was opened every 30 days after closure for up to 270 days. In each bag, the DM, and macro- and micronutrients were analyzed, and the percentage of remaining material, daily decomposition rate, and half-life were calculated. The litter of the Marandu + sorghum 45 treatment contained the highest DM, decomposition rate, and nutrient content. The crop succession provided the best condition of the litter, with the highest DM on the soil surface, which improved soil conditions and made the soil less susceptible to degradation.

First Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in China

HomePlant DiseaseVol. 102, No. 8First Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in ChinaT. Liu, D. Chen, Z. Liu, Z. Y. Wang, and J. S. HuT. Liu†Corresponding author: T. Liu; E-mail: E-mail Address: liutongamy@sina.comhttp://orcid.org/0000-0002-8280-3223Search for more papers by this author, D. ChenSearch for more papers by this author, Z. LiuSearch for more papers by this author, Z. Y. WangSearch for more papers by this author, and J. S. HuSearch for more papers by this authorAffiliationsAuthors and Affiliations T. Liu † D. Chen , Institute of Tropical Agriculture and Forestry, Hainan University, Haikou, Hainan Province, 570228, P. R. China Z. Liu , College of Agronomy, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang, 163319, P. R. China Z. Y. Wang , Institute of Tropical Agriculture and Forestry, Hainan University, Haikou, Hainan Province, 570228, P. R. China J. S. Hu , Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI 96822. Published Online:14 Jun 2018https://doi.org/10.1094/PDIS-11-17-1837-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat St. Augustine grass (Stenotaphrum secundatum [Walt.] Kuntze) is a fast-growing, perennial, salt-tolerant turf cultivated widely on beach slopes for erosion management and water conservation in coastal soils. In May of 2017, severe leaf spot symptoms were observed on St. Augustine grass at a nursery in an experimental station of Hainan University (110.19° E, 20.03° N), Hainan Province, China. Disease incidence was 15 to 25%. Initial symptoms appeared as small, round or elliptical lesions, which later developed to spindle shaped, grayish to tan necrotic lesions with yellow halos. Ten symptomatic explants were excised from diseased stolons, rinsed four to five times with sterile distilled water, and placed on moisture chamber for 48 h under continuous fluorescent light at 25°C to induce formation of conidia. Three single-conidia isolates (A71011215–A71011217) of Pyricularia-like fungi were obtained, and cultured on 1/4 potato dextrose agar for 7 days. The conidia were pyriform to obclavate, narrowed toward the tip, rounded at the base, with 1 to 2 septa. Conidiophores were pale brown, emerging singly or in small groups, straight or flexuous, geniculate toward the apex. These features are consistent with those reported for Pyricularia spp. by Ellis (1971). From single-conidia isolates, we amplified the internal transcribed spacer (ITS) regions of rDNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified with primer pairs ITS4/ITS5 (5′-TCCTCCGCTTATTGATATGC-3′/5′-GGAAGTAAAAGTCGTAACAAGG-3′) and GDF/GDR (5′-GCCGTCAACGACCCCTTCATTGA-3′/GGGTGGAGTCGTACTTGAGCATGT) (White et al. 1990; Woudenberg et al. 2013), respectively. The results revealed identical sequences of ITS (GenBank accession no. KY999195) and GAPDH (KY908195) among three isolates. BLASTN searches showed the sequences matched Magnaporthe oryzae (teleomorph of Pyricularia oryzae) strains with 99% identity for ITS regions (KY825257.1, JQ747492.1, FN555115.1) and 99% identity (KY452101.2, KY452100.2, KY452078.1) for GADPH gene. In addition, a phylogenetic tree was produced using MEGA 5.0 based on the ITS sequence (A71011215), forming a single clade with high branch support with P. oryzae. Based on cultural characteristics and sequence data, the isolates were identified as P. oryzae. To confirm pathogenicity, Koch’s postulates were performed by spraying leaves of five healthy St. Augustine grass plants with a 1 × 105 CFU/ml suspension derived from single-conidia of the A71011215 isolates. The same number of plants were treated with sterile water only. After 1 week incubation in growth chamber at 25°C and 90% relative humidity, all inoculated plants showed identical symptoms to those observed in the nursery. The control plants remained symptomless. The Pyricularia-like fungus was reisolated from lesions of the inoculated leaves. The morphology of the isolates were observed and described from the colonies grown under the conditions described above. Gray leaf spot caused by Pyricularia sp. has been reported on Italian ryegrass (Xue et al. 2017), Guinea grass (Tsukiboshi et al. 2009), and St. Augustine grass in Italy (Polizzi et al. 2003). But, to our knowledge, this is the first report of gray leaf spot caused by P. oryzae in St. Augustine grass in China. Therefore, the management strategy of the disease control on St. Augustine grass needs to be developed.

Determination of the Bonding Force Between the Rettery and Flax Swaths in Their Picking Up by Pick-­Up Device Fingers

The quality of flax products depends on the way of flax straw retting. Currently, the best and most widely used method of flax straw retting is way of dew retting. Flax stems are laid in a thin layer on the flax field where they were grown or on a clover or grass field. During the retting process, plants tend to grow through the flax swaths depending on the air temperature (starting from 18°C) and humidity (50­-60%). Therefore, the flax straw picking up process should be done with certain efforts, however, without damaging the stems. (Research purpose) To determine the bonding forces of the flax straw with the rettery (a flax field or a grass field). (Materials and methods) The authors have designed an instrument to measure and register the considered forces as well as a general mechanism of the flax straw picking up process, which operates in conjunction with the IP 264 (BS) measurement information system, and also developed a research methodology. This system is integrated with to a laptop with the pre-­installed «Testing» software. The system is adopted to use the MS Excel software to transfer data in MS Excel format for further plotting. (Results and discussion) It has been shown that the bonding forces of flax stems, their changing pattern, and the maximum value during the picking up process depend on the degree of penetration by grass plants into flax swaths and the grass plant density per square meter. (Conclusions) In process of picking up the grass-­penetrated swaths, they show weak strength characteristics for transportation and an increased tendency to break the continuity of their picking up. The values of the ratio of the translational speed of a pick-­up device and the rotary speed of a picking device fingertip can be greater than the value of the relative elongation at the point of pulling the swath away from the ground. The coefficient of strength to pick up the swaths from a clover rettery is higher than that of flax and grass retteries.

Purification efficiency of zeolite and two planted grasses on sewage and relationship with carbon-nitrogen-phosphorus ratios in simulated constructed wetland system.

For achieving the economical and efficient configuration of constructed wetlands (CWs), a simulated device of vertical flow CWs was used to investigate the effects of different volume ratios of substrates to two cold-resistant plants on pollutant concentrations as well as their ratios in effluent under different inflow domestic sewage concentrations. The average removal rates (ARRs) of ammonia nitrogen, total nitrogen (TN) and total phosphorus were 82.7%, 84.9% and 80.6% respectively in the treatments with zeolite but no plants, which increased by 22.6%, 20.8% and 14.9% compared with those without zeolite and plants. However, in the treatments with zeolite and planted grasses, the ARRs of the three pollutants were over 90%, and those of chemical oxygen demand were lower. The removal rates of ammonia nitrogen, TN and total phosphorus had negative correlations with C:N and N:P ratios and positive correlations with the C:P ratios. Increasing the ratio of zeolite to soil from 1:1 to 2:1 had no significant effects in the removal efficiency. It was suggested that planting Lolium perenne or Poa annua on the substrate with a zeolite to soil volume ratio of 1:1 could be considered as the optimum combination to purify the domestic sewage in north rural areas of China.

HUBUNGAN LUAS DAUN TERHADAP PERTAMBAHAN BERAT KERING RUMPUT GAJAH DI BERBAGAI PERLAKUAN DI MEDIA TAILING TIMAH

Elephant grass (Pannisetum purpureum) can grow in various types of land conditions and produces and is resistant to environmental stress. The predominant sand tin tailing conditions and poor nutrients cause limited plant growth above them. This research tested some kind of fertilizer treatment on sand tailing media after tin addition by using elephant grass plants. The results showed that the type of fertilizer had significant effect on the specific leaf area variant, the ratio of leaf area and the leaf weight ratio. Overall growth were greatly depressed on the 100% tailings treatment. Lime applied in conjunction with NPK fertilizer was not show the total leaf weight that was different from the addition of NPK alone. NPK fertilizers better influence the growth of elephant leaves in tin tailings than organic fertilizers. The best treatment was obtained on organic fertilization with NPK inorganic fertilization. The association of total dry weight of elephant grass with specific area of elephant grass leaf was only visible in organic fertilization treatment together with NPK inorganic fertilizer. In the best condition of elephant grass growth, the specific leaf area had a significant role to increase the total weight of the plant with the value of r2 = 0.864 or LDS will affect the total dry weight of elephant grass in the tailings medium with the addition of organic and inorganic materials NPK of 86.4 percent the remaining 13.6% increase in total dry weight was influenced by factors other than specific leaf area.

The influence of quadrat size on spatial heterogeneity of meadow grassland, Northern China

The objective of this study was to determine influence of survey quadrats size on spatial heterogeneity of meadow grassland in north China. An integrative approach was used based on field survey method that the sample line combined with sample quadrat to analyze the vegetation heterogeneity characteristics of Stipa + Leymus Mss. steppe in Hulunbeier grassland. Results showed that: perennial plants, C3 plants, and cluster grass plants were dominant communities in Hulunbeier grassland under different functional classification. And species richness of them were accounted for the total species richness of more than 86%, 90% and 23.4%, respectively. Despite the species richness of bunch grass plants was little in the functional composition classification, the above ground biomass was accounted for a larger proportion of 50.2%. From the spatial heterogeneity characteristics of Stipa+Leymus Mss. steppe, 6m2 is the turning point of the spatial heterogeneity of total species richness, species richness of perennial plant, cluster plant and C3 plant. That’s because when the quadrat size is less than 6m2, the spatial heterogeneity of the total species richness, species richness of perennial plant, cluster plant and C3 plant were changed significantly with the quadrat size changed, and when the quadrat size is larger than that of 6m2, its spatial heterogeneity becomes small. The above analysis shows that in the field survey of Stipa+Leymus Mss. steppe, the quadrat size used in the survey should be not less than 6m2, for the summary vegetation information of quadrat size with 6m2 can describe the general characteristics of vegetation investigation well.