First Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in China

Abstract

HomePlant DiseaseVol. 102, No. 8First Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in China PreviousNext DISEASE NOTES OPENOpen Access licenseFirst Report of Pyricularia Leaf Spot on St. Augustine grass (Stenotaphrum secundatum) in ChinaT. Liu, D. Chen, Z. Liu, Z. Y. Wang, and J. S. HuT. Liu†Corresponding author: T. Liu; E-mail: E-mail Address: liutongamy@sina.comhttp://orcid.org/0000-0002-8280-3223Search for more papers by this author, D. ChenSearch for more papers by this author, Z. LiuSearch for more papers by this author, Z. Y. WangSearch for more papers by this author, and J. S. HuSearch for more papers by this authorAffiliationsAuthors and Affiliations T. Liu † D. Chen , Institute of Tropical Agriculture and Forestry, Hainan University, Haikou, Hainan Province, 570228, P. R. China Z. Liu , College of Agronomy, Heilongjiang Bayi Agricultural University, Daqing, Heilongjiang, 163319, P. R. China Z. Y. Wang , Institute of Tropical Agriculture and Forestry, Hainan University, Haikou, Hainan Province, 570228, P. R. China J. S. Hu , Department of Plant and Environmental Protection Sciences, University of Hawaii, Honolulu, HI 96822. Published Online:14 Jun 2018https://doi.org/10.1094/PDIS-11-17-1837-PDNAboutSectionsSupplemental ToolsAdd to favoritesDownload CitationsTrack Citations ShareShare onFacebookTwitterLinked InRedditEmailWechat St. Augustine grass (Stenotaphrum secundatum [Walt.] Kuntze) is a fast-growing, perennial, salt-tolerant turf cultivated widely on beach slopes for erosion management and water conservation in coastal soils. In May of 2017, severe leaf spot symptoms were observed on St. Augustine grass at a nursery in an experimental station of Hainan University (110.19° E, 20.03° N), Hainan Province, China. Disease incidence was 15 to 25%. Initial symptoms appeared as small, round or elliptical lesions, which later developed to spindle shaped, grayish to tan necrotic lesions with yellow halos. Ten symptomatic explants were excised from diseased stolons, rinsed four to five times with sterile distilled water, and placed on moisture chamber for 48 h under continuous fluorescent light at 25°C to induce formation of conidia. Three single-conidia isolates (A71011215–A71011217) of Pyricularia-like fungi were obtained, and cultured on 1/4 potato dextrose agar for 7 days. The conidia were pyriform to obclavate, narrowed toward the tip, rounded at the base, with 1 to 2 septa. Conidiophores were pale brown, emerging singly or in small groups, straight or flexuous, geniculate toward the apex. These features are consistent with those reported for Pyricularia spp. by Ellis (1971). From single-conidia isolates, we amplified the internal transcribed spacer (ITS) regions of rDNA and glyceraldehyde-3-phosphate dehydrogenase (GAPDH) gene were amplified with primer pairs ITS4/ITS5 (5′-TCCTCCGCTTATTGATATGC-3′/5′-GGAAGTAAAAGTCGTAACAAGG-3′) and GDF/GDR (5′-GCCGTCAACGACCCCTTCATTGA-3′/GGGTGGAGTCGTACTTGAGCATGT) (White et al. 1990; Woudenberg et al. 2013), respectively. The results revealed identical sequences of ITS (GenBank accession no. KY999195) and GAPDH (KY908195) among three isolates. BLASTN searches showed the sequences matched Magnaporthe oryzae (teleomorph of Pyricularia oryzae) strains with 99% identity for ITS regions (KY825257.1, JQ747492.1, FN555115.1) and 99% identity (KY452101.2, KY452100.2, KY452078.1) for GADPH gene. In addition, a phylogenetic tree was produced using MEGA 5.0 based on the ITS sequence (A71011215), forming a single clade with high branch support with P. oryzae. Based on cultural characteristics and sequence data, the isolates were identified as P. oryzae. To confirm pathogenicity, Koch’s postulates were performed by spraying leaves of five healthy St. Augustine grass plants with a 1 × 105 CFU/ml suspension derived from single-conidia of the A71011215 isolates. The same number of plants were treated with sterile water only. After 1 week incubation in growth chamber at 25°C and 90% relative humidity, all inoculated plants showed identical symptoms to those observed in the nursery. The control plants remained symptomless. The Pyricularia-like fungus was reisolated from lesions of the inoculated leaves. The morphology of the isolates were observed and described from the colonies grown under the conditions described above. Gray leaf spot caused by Pyricularia sp. has been reported on Italian ryegrass (Xue et al. 2017), Guinea grass (Tsukiboshi et al. 2009), and St. Augustine grass in Italy (Polizzi et al. 2003). But, to our knowledge, this is the first report of gray leaf spot caused by P. oryzae in St. Augustine grass in China. Therefore, the management strategy of the disease control on St. Augustine grass needs to be developed.