Piperidine Cleavage Research Articles

Oligonucleotide Models of Telomeric DNA and RNA Form a Hybrid G-quadruplex Structure as a Potential Component of Telomeres

Telomeric repeat-containing RNA, a non-coding RNA molecule, has recently been found in mammalian cells. The detailed structural features and functions of the telomeric RNA at human chromosome ends remain unclear, although this RNA molecule may be a key component of the telomere machinery. In this study, using model human telomeric DNA and RNA sequences, we demonstrated that human telomeric RNA and DNA oligonucleotides form a DNA-RNA G-quadruplex. We next employed chemistry-based oligonucleotide probes to mimic the naturally formed telomeric DNA-RNA G-quadruplexes in living cells, suggesting that the process of DNA-RNA G-quadruplex formation with oligonucleotide models of telomeric DNA and RNA could occur in cells. Furthermore, we investigated the possible roles of this DNA-RNA G-quadruplex. The formation of the DNA-RNA G-quadruplex causes a significant increase in the clonogenic capacity of cells and has an effect on inhibition of cellular senescence. Here, we have used a model system to provide evidence about the formation of G-quadruplex structures involving telomeric DNA and RNA sequences that have the potential to provide a protective capping structure for telomere ends.

PNA−Nitrogen Mustard Conjugates Are Effective Suppressors of HER-2/neu and Biological Tools for Recognition of PNA/DNA Interactions

Peptide nucleic acids (PNAs) are promising tools for gene regulation. One of the challenges of using PNAs as gene regulators is the need to optimize the efficiency of interaction with critical sequences of DNA. To improve the efficiency of binding between PNAs and the HER-2/neu promoter, mono- and bis-pyrimidine-rich PNAs were conjugated to a nitrogen mustard at either the amino or carboxy terminus. Gel shift analysis demonstrated that conjugation to an alkylating agent slowed PNA binding and favored PNA:DNA:DNA triplex helix formation while preserving a high binding affinity. Sites of DNA alkylation were visualized by piperidine cleavage and showed PNA binding first by Hoogsteen bond formation with the target duplex to form a stable PNA:DNA:DNA triplex structure which is later converted to a PNA:DNA:PNA triple helix by strand invasion and Watson-Crick base pairing by a second PNA molecule. In this way, PNA-directed DNA alkylation was used to deduce the mode of PNA binding. Transient transfection experiments demonstrated that the PNA-nitrogen mustard conjugates suppressed HER-2/neu expression by up to 80%. In comparison with an unmodified mono-PNA or a bis-PNA, these results indicate that the covalent adducts stabilized PNA binding in cells and suggest that the conjugation of PNAs to nitrogen mustards is a robust strategy for developing antigene PNA oligonucleotides to prevent transcription.

The 5‘-GNC Site for DNA Interstrand Cross-Linking Is Conserved for Diepoxybutane Stereoisomers

The bifunctional alkylating agent 1,2,3,4-diepoxybutane forms interstrand DNA-DNA cross-links between the N7 positions of deoxyguanosine residues on opposite strands of the duplex. For racemic diepoxybutane, these cross-links predominate within 5'-GNC/3'CNG sequences, where N is any nucleotide. We used denaturing polyacrylamide gel electrophoresis (dPAGE) to examine the role of stereochemistry in the cross-linking reaction, subjecting a restriction fragment to cross-linking with S,S-DEB, R,R-DEB, or meso-DEB. DNA cross-links generated by each isomer were isolated by dPAGE, and the sites of cross-linking were identified by sequencing gel analysis of DNA fragments generated by hot piperidine cleavage. We found that the 5'-GNC consensus sequence of racemic DEB is conserved, but the efficiencies of cross-linking vary, with S,S- > R,R- > meso-DEB. These results help explain the observed differences between the biological activities of DEB stereoisomers.

Flanking sequences modulate diepoxide and mustard cross-linking efficiencies at the 5'-GNC site.

Diepoxybutane, diepoxyoctane, and mechlorethamine are cytotoxic agents that induce interstrand cross-links between the N7 positions of deoxyguanosine residues on opposite strands of the DNA duplex preferentially at 5'-GNC sequences. We have systematically varied the identity of either the base 5' to the cross-linked deoxyguanosine residues or the intervening base pair to determine flanking sequence effects on cross-linking efficiency. We used synthetic DNA oligomers containing four 5'-N(1)GN(2)C sites that varied either N(1) or N(2). Interstrand cross-links were purified through denaturing polyacrylamide gel electrophoresis and then subjected to piperidine cleavage. The amount of cleavage at each deoxyguanosine residue, representative of cross-linking efficiency at that site, was determined by sequencing gel analysis. Our data suggest that cross-linking efficiency varies with the identity of N(1) similarly (purines > pyrimidines) for diepoxybutane, diepoxyoctane, and mechlorethamine but that the effects of N(2) differ for the three compounds.

Effect of H2S on pyridine HDN over Ir, Mo and Ir-Mo/Al2O3 sulfide catalysts

The effect of H2S on hydrodenitrogenation (HDN) of pyridine over alumina supported Mo, Ir and mixed Ir-Mo sulfide catalysts was studied. The pyridine hydrogenation was inhibited by H2S on all catalysts, while the cleavage of the C-N bond of intermediate piperidine was facilitated on the Mo and inhibited on the Ir and Ir-Mo catalysts. The promotional offect between Ir and Mo was observed in the piperidine cleavage both in the presence and absence of H2S.

Recognition and cleavage at the DNA major groove

DNA recognition agents based on the indole-based aziridinyl eneimine and the cyclopent[ b]indole methide species were designed and evaluated. The recognition process involved either selective alkylation or intercalating interactions in the major groove. DNA cleavage resulted from phosphate backbone alkylation (hydrolytic cleavage) and N(7) -alkylation (piperidine cleavage). The formation and fate of the eneimine was studied using enriched 13C NMR spectra and X-ray crystallography. The aziridinyl eneimine specifically alkylates the N(7) position of DNA resulting in direction of the aziridinyl alkylating center to either the 3′- or 5′-phosphate of the alkylated base. The eneimine species forms dimers and trimers that appear to recognize DNA at up to three base pairs. The cyclopent[ b]indole quinone methide recognizes the 3′-GT-5′ sequence and alkylates the guanine N(7) and the thymine 6-carbonyl oxygen causing the hydrolytic removal of these bases. In summary, new classes of DNA recognition agents are described and the utility of 13C-enrichment and 13C NMR to study DNA alkylation reactions is illustrated.

Template-Directed Interference Footprinting of Protein−Phosphate Contacts in DNA

[figure: see text] We have developed a method for interference footprinting of contacted phosphates in protein-DNA complexes. Template-directed enzymatic polymerization using a synthetic triphosphate analogue (alpha Me-dTTP) generates a product having a modified Internucleotide linkage, which perturbs protein-phosphate contacts. We found that treatment of the methylphosphonodiester-substituted extension product under nonaqueous conditions (MeO-/MeOH) led to the formation of a single cleavage product at each T residue but to two cleavage products when treated under the standard aqueous piperidine cleavage protocol.

Peroxynitrite-induced secondary oxidative lesions at guanine nucleobases: chemical stability and recognition by the Fpg DNA repair enzyme.

Synthetic oligodeoxynucleotides containing secondary oxidative lesions at guanine nucleobases have been prepared by the site-specific oxidation by ONOO(-) of oligomers containing 8-oxoguanine (8-oxo-G). The oligomers have been tested for their stability to the standard hot piperidine treatment that is commonly used to uncover oxidized DNA lesions. While DNA containing oxaluric acid and oxazolone was cleaved at the site of modification under hot piperidine conditions, the corresponding cyanuric acid and 8-oxo-G lesions were resistant to piperidine. The recognition of the oxidative lesions by formamidopyrimidine glycosylase (Fpg enzyme) was examined in double-stranded versions of the synthetic oligodeoxynucleotides. Fpg efficiently excised 8-oxo-G and oxaluric acid and to some extent oxazolone, but not cyanuric acid. These data suggest that some DNA lesions formed via ONOO(-) exposures (cyanuric acid) are not repaired by Fpg and are not uncovered by assays based on piperidine cleavage at the site of lesion. Our results indicate that cryptic secondary and tertiary oxidation products arising from 8-oxo-G may contribute to the overall mutational spectra arising from oxidative stress.

Site-specific synthesis of aflatoxin B(1) adducts within an oligodeoxyribonucleotide containing the human p53 codon 249 sequence.

This work describes the preparation of the cationic trans-8, 9-dihydro-8-(N7-guanyl)-9-hydroxyaflatoxin B(1) ((AFB)G) adducts at the positions corresponding to G(746) or G(747), within the oligodeoxyribonucleotide d(GGAGGCCT) containing the codon 249 sequence (underlined) of the p53 gene, using DNA triplexes to target adduction at the desired site. This approach enabled the successful preparation and purification of sufficient quantities of d(GGAG(AFB)GCCT) for NMR structural studies, using only standard phosphoramidites. The presence of multiple guanines in this oligodeoxynucleotide precluded the direct reaction of d(GGAGGCCT). d(AGGCCTCC) with aflatoxin epoxide as a method for producing large quantities of site-specific adducts for physical studies. Of the multiple potential alkylation sites at guanine N7 in d(GGAGGCCT). d(AGGCCTCC), it was found that sites G(2) and G(5) exhibited approximately equal reactivity with aflatoxin B(1)-exo-8,9-epoxide; the reactivity at site G(4) was reduced by approximately a factor of 2 as compared to that at G(2) or G(5). To successfully prepare the site-specific adducts, the p53 oligodeoxyribonucleotide was annealed with either the blocking strand d(CTCCATTTTCCT) or d(CCTCCATTTTCCTC) to form the corresponding partial triplexes which targeted AFB(1) adduction either to G(4) or to G(5). Piperidine cleavage, followed by heating, confirmed that in each instance, the product corresponded to the lone guanine not protected from adduction by the partial DNA triplex. The adducted oligodeoxyribonucleotides were examined with regard to purity by capillary electrophoresis. The primary advantage of this modified triple helix methodology is that it requires only standard phosphoramidites; thus, it is applicable to large-scale preparations that are necessary for NMR structural studies or other physical measurements.

Anomalous cross-linking by mechlorethamine of DNA duplexes containing C-C mismatch pairs.

Nitrogen mustards such as mechlorethamine have previously been shown to covalently cross-link DNA through the N7 position of the two guanine bases of a d[GXC].d[GYC] duplex sequence, a so-called 1,3 G-G-cross-link, when X-Y = C-G or T-A. Here, we report the formation of a new mechlorethamine cross-link with the d[GXC].d[GYC] fragment when X-Y is a C-C mismatch pair. Mechlorethamine cross-links this fragment preferentially between the two mismatched cytosine bases, rather than between the guanine bases. The cross-link also forms when one or both of the guanine bases of the d[GCC].d[GCC] fragment are replaced by N7-deazaguanine, and, more generally, forms with any C-C mismatch, regardless of the flanking base pairs. Piperidine cleavage of the cross-link species containing the d[GCC].d[GCC] sequence gives DNA fragments consistent with alkylation at the mismatched cytosine bases. We also provide evidence that the cross-link reaction occurs between the N3 atoms of the two cytosine bases by showing that the formation of the C-C cross-link is pH dependent for both mechlorethamine and chlorambucil. Dimethyl sulfate (DMS) probing of the cross-linked d[GCC].d[GCC] fragment showed that the major groove of the guanine adjacent to the C-C mismatch is still accessible to DMS. In contrast, the known minor groove binder Hoechst 33258 inhibits the cross-link formation with a C-C mismatch pair flanked by A-T base pairs. These results suggest that the C-C mismatch is cross-linked by mechlorethamine in the minor groove. Since C-C pairs may be involved in unusual secondary structures formed by the trinucleotide repeat sequence d[CCG]n, and associated with triplet repeat expansion diseases, mechlorethamine may serve as a useful probe for these structures.

Meta-PCR: a novel method for creating chimeric DNA molecules and increasing the productivity of mutation scanning techniques.

Many mutation scanning techniques are capable of locating mutations in DNA fragments much larger than the average exon. We have developed a system called Meta-PCR that can maximize the length of sequence scanned by these techniques, improving their productivity and realizing their full potential. Meta-PCR is a simple, versatile, and powerful method for generating chimeric DNA molecules. Currently, up to five PCR amplifiable fragments can be combined to form a single linear amplimer. The Meta-PCR reaction is self-assembling and takes place in two coupled stages carried out in a single reaction vessel. The order of fragments is reproducible and determined by primer design. We have developed two Meta-PCR assays, one comprising exons 6-10 of the Neurofibromatosis type 2 (NF2) gene and the second exons 8-12 of the human mismatch repair gene, hMLH1. We verified by direct sequencing that the order and sequence of the component exons in the Meta-PCR products is as predicted. Meta-PCR products from seven previously ascertained heterozygotes for NF2 mutations were directly sequenced. All seven mutations were clearly visible as mixed bases at the expected nucleotide, confirming that Meta-PCR faithfully reproduces the original sample genotype. We have evaluated the downstream use of the NF2 Meta-PCR products in fluorescent solid-phase chemical cleavage of mismatches (CCM). Meta-PCR products from eleven NF2 mutant heterozygotes were screened retrospectively for piperidine cleavage after hydroxylamine or potassium permanganate modification of mismatched bases. Ten of the 11 mutants were detected by visible cleavage. One mutation predicted to be cleaved after potassium permanganate modification was not detected. However, we were able to attribute this false negative to a failure in the CCM method. Meta-PCR is likely to be useful to clinical molecular diagnostic laboratories, helping them to fulfill demand for rapid and accurate screening for point mutations in large multi-exon genes.

Site-specific targeting of aflatoxin adduction directed by triple helix formation in the major groove of oligodeoxyribonucleotides.

The targeted adduction of aflatoxin B1- exo -8,9-epoxide (AFB1- exo -8,9-epoxide) to a specific guanine within an oligodeoxyribonucleotide containing multiple guanines was achieved using a DNA triplex to control sequence selectivity. The oligodeoxyribonucleotide d(AGAGAAGATTTTCTTCTCTTTTTTTTCTCTT), designated '3G', spontaneously formed a triplex in which nucleotides C27*G2*C18 and C29*G4*C16 formed base triplets, and nucleotides G7*C13formed a Watson-Crick base pair. The oligodeoxyribonucleotide d(AAGAAATTTTTTCTTTTTTTTTTCTT), designated '1G', also formed a triplex in which nucleotides C24*G3*C24 formed a triplet. Reaction of the two oligodeoxyribonucleotides with AFB1-exo-8,9-epoxide revealed that only the 3G sequence formed an adduct, as determined by UV absorbance and piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis. This site was identified as G7by comparison to the guanine-specific cleavage pattern. The chemistry was extended to a series of nicked bimolecular triple helices, constructed from d(AAAGGGGGAA) and d(CnTTCTTTTTCCCCCTTTATTTTTTC5-n) (n = 1-5). Each oligomer in the series differed only in the placement of the nick. Reaction of the nicked triplexes with AFB1- exo -8,9-epoxide, piperidine cleavage of the 5'-labeled adduct, followed by denaturing polyacrylamide gel electrophoresis, revealed cleavage corresponding to the guanine closest to the pyrimidine strand nick. By using the appropriate pyrimidine sequence the lesion was positioned within the purine strand.

Mechanism of open complex and dual incision formation by human nucleotide excision repair factors.

During nucleotide excision repair in human cells, a damaged DNA strand is cleaved by two endonucleases, XPG on the 3' side of the lesion and ERCC1-XPF on the 5' side. These structure-specific enzymes act at junctions between duplex and single-stranded DNA. ATP-dependent formation of an open DNA structure of approximately 25 nt around the adduct precedes this dual incision. We investigated the mechanism of open complex formation and find that mutations in XPB or XPD, the DNA helicase subunits of the transcription and repair factor TFIIH, can completely prevent opening and dual incision in cell-free extracts. A deficiency in XPC protein also prevents opening. The absence of RPA, XPA or XPG activities leads to an intermediate level of strand separation. In contrast, XPF or ERCC1-defective extracts open normally and generate a 3' incision, but fail to form the 5' incision. This same repair defect was observed in extracts from human xeroderma pigmentosum cells with an alteration in the C-terminal domain of XPB, suggesting that XPB has an additional role in facilitating 5' incision by ERCC1-XPF nuclease. These data support a mechanism in which TFIIH-associated helicase activity and XPC protein catalyze initial formation of the key open intermediate, with full extension to the cleavage sites promoted by the other core nucleotide excision repair factors. Opening is followed by dual incision, with the 3' cleavage made first.

The Na+-specific interaction between the LysR-type regulator, NhaR, and the nhaA gene encoding the Na+/H+ antiporter of Escherichia coli.

We used partially purified NhaR and a highly purified His-tagged NhaR derivative to identify the cis-regulatory sequences of nhaA recognized by NhaR and to study the specific effect of Na+ on this interaction. Gel retardation assay with DNase I footprinting analysis showed that NhaR binds a region of nhaA which spans 92 bp and contains three copies of the conserved LysR-binding motif. Na+, up to 100 mM, had no effect on the binding of NhaR to nhaA. The dimethylsulfate methylation protection assay in vivo and in vitro, showed that bases G-92, G-60, G-29 and A-24 form direct contacts with NhaR; in the absence of added Na+ in vivo, these bases were protected but became exposed to methylation in a DeltanhaR strain; accordingly, these bases were protected in vitro by the purified His-tagged NhaR. 100 mM Na+, but not K+, removed the protection of G-60 conferred by His-tagged NhaR in vitro. Exposure of intact cells to 100 mM Na+, but not K+, exposed G-60. The maximal effect of Na+ in vitro was observed at 20 mM and was pH dependent, vanishing below pH 7.5. In contrast to G-60, G-92 was exposed to methylation by the ion only in vivo, suggesting a requirement for another factor existing only in vivo for this interaction. We suggest that NhaR is both sensor and transducer of the Na+ signal and that it regulates nhaA expression by undergoing a conformational change upon Na+ binding which modifies the NhaR-nhaA contact points.

Absence of an Unusual “Densely Methylated Island” at the Hamster dhfr ori-β

An unusual "densely methylated island" (DMI), in which all cytosine residues are methylated on both strands for 127-516 base pairs, has been reported at mammalian origins of DNA replication. This report had far-reaching implications in understanding of DNA methylation and DNA replication. For example, since this DMI appeared in about 90% of proliferating cells, but not in stationary cells, it may regulate origin activation. In an effort to confirm and extend these observations, the DMI at the well characterized ori-beta locus 17 kilobases downstream of the dhfr gene in chromosomes of Chinese hamster ovary cells was checked for methylated cytosines in genomic DNA. The methylation status of this region was examined in randomly proliferating and stationary cells and in cell populations enriched in the G1, S, or G2 + M phases of their cell division cycle. DNA was subjected to 1) cleavage by methylation-sensitive restriction endonucleases, 2) hydrazine modification of cytosines followed by piperidine cleavage, and 3) permanganate modification of 5-methylcytosines (mC) followed by piperidine cleavage. The permanganate reaction is a novel method for direct detection of mC residues that complements the more commonly used hydrazine method. These methods were capable of detecting mC in 2% of the cells. At the region of the proposed DMI, only one mC at a CpG site was detected. However, the ori-beta DMI was not detected in any of these cell populations using any of these methods.

Ultrarapid Mutation Detection by Multiplex, Solid-Phase Chemical Cleavage

The chemical cleavage of mismatches in heteroduplexes formed by probe and test DNA detects and locates any sequence change in long DNA segments (∼1.8 kb), and its efficiency has been well tested in the analysis of both average (e.g., coagulation factor IX) and large, complex genes (e.g., coagulation factor VIII and dystrophin). In the latter application RT/PCR products allow the examination of all essential sequences of the gene in a minimum number of reactions. We use two specific chemical reactants (hydroxylamine and osmium tetroxide) and piperidine cleavage of the above procedure to develop a very fast mutation screening method. This is based on: (1) 5′ or internal fluorescent labeling to allow concurrent screening of three to four DNA fragments and (2) solid-phase chemistry to use a microtiter format and reduce the time required for the procedure, from amplification of sequence to gel loading inclusive, to one person-working-day. We test the two variations of the method, one entailing 5′ labeling of probe DNA and the other uniform labeling of both probe and target DNA, by detecting 114 known hemophilia B (coagulation factor IX) mutations and by analyzing 129 new patients. Uniform labeling of both probe and target DNA prior to formation of the heteroduplexes leads to almost two-fold redundancy in the ability to detect mutations. Alternatively, the latter procedure may offer very efficient though less than 100% screening for sequence changes with only hydroxylamine. The full method with two chemical reactions (hydroxylamine and osmium tetroxide) should allow one person to screen with virtually 100% accuracy more than 300 kb of sequence in three ABI 373 gels in 1 day.

A new solid-phase chemical DNA sequencing method which uses streptavidin-coated magnetic beads.

To simplify the chemical DNA sequencing protocol, we developed a new solid-phase method which uses streptavidin-coated magnetic beads. This method is based on the finding that the biotinylated DNA-streptavidin complex was stable under the conditions for some chemical sequencing reactions. The 5'-biotinylated DNA generated by the polymerase chain reaction was first captured by streptavidin-coated magnetic beads and then subjected to a set of simplified chemical sequencing reactions on the beads at room temperature. Followed by the piperidine cleavage reaction, the products were resolved by gel electrophoresis, transferred onto a nylon membrane and visualized by chemiluminescent detection. As a consequence, high-quality sequencing ladders were obtained, due to complete removal of contaminating chemicals, without the time-consuming precipitation/centrifugation steps used in the conventional chemical sequencing protocol.

The ultimate carcinogen of 4-nitroquinoline 1-oxide does not react with Z-DNA and hyperreacts with B-Z junctions.

DNA secondary and tertiary structures are known to affect the reaction between the double helix and several damaging agents. We have previously shown that the tertiary structure of DNA influences the reactivity of 4-acetoxyaminoquinoline 1-oxide (Ac-4-HAQO), the ultimate carcinogen of 4-nitroquinoline 1-oxide (4-NQO), being more reactive with naturally supercoiled DNA than with relaxed DNA. The relative proportion of the three main stable adducts and of an unstable adduct, that resulted in strand scission and/or AP sites, was also affected by the degree of supercoiling of plasmid DNA. In this study we examined the influence of Z-DNA structure on the reactivity of Ac-4-HAQO by mapping the distribution of the two main Ac-4-HAQO adducts, C8-guanine and N2-guanine, along a (dC-dG)16 sequence inserted at the BamHI site of pBR322 plasmid DNA. This insert adopted the left-handed Z and right-handed B structure depending on the superhelical density of the plasmid. Sites of C8-guanine adduct formation were determined by hot piperidine cleavage of Ac-4-HAQO modified DNA, while N2-guanine adducts were mapped by the arrest of the 3'-5' exonuclease activity of T4 DNA polymerase. The results showed that Ac-4-HAQO did not react with guanine residues when the (dC-dG)16 sequence was in Z conformation, while hyperreactivity at the B-Z junction was observed. These results indicate that Ac-4-HAQO can probe the polymorphism of DNA at the nucleotide level.

Sequence-selective alkylation and cross-linking induced by mitomycin C upon activation by DT-diaphorase

Aerobic reduction of MMC by DTD, an obligate two-electron reductase, or chemical reduction by sodium borohydride results predominantly in monoalkylation of DNA at the guanine N7 position within 5'-GG-3' and 5'-GTC-3' sequences. The level of guanine N7 alkylation after DTD reduction increased as the pH was decreased from 7.8 and was optimal at pH 6.6. A similar profile of alkylation was obtained when the major metabolite of DTD-mediated MMC metabolism, 2,7-diaminomitosene, was further reduced by DTD. The sequence preference for DNA interstrand cross-linking (ISC) was also determined using singly end-labeled oligonucleotide duplexes. Reduction of MMC by DTD induced DNA cross-links which were resistant to piperidine cleavage. Exposure of cross-linked DNA to dimethyl sulfate or formic acid and subsequent piperidine cleavage displayed a discontinuity in band pattern which suggested a 5'-CG-3' preference for DNA ISC. Major groove alkylation is proposed to occur via generation, and subsequent metabolism by DTD, of 2,7-diaminomitosene. Cross-linking of DNA, at 5'-CG-3' sequences, is proposed to require the formation of either the protonated leucomitomycin C or the leucoaziridinomitosene during DTD-mediated metabolism of MMC.

8] Probing DNA structure with osmium tetroxide complexes in vitro

Publisher Summary This chapter discusses the structure of DNA by probing osmium tetroxide (Os-py) complexes. Os-py has been applied to study local supercoil-stabilized DNA structures in vitro as well as parallel stranded DNA, DNA-drug interactions, etc. In local supercoil stabilized DNA structures, it reacts site specifically with bases in the formally single-stranded cruciform loop, triplex loop, displaced half of the homopyrimidine strand in triplex DNA, and with bases at the B-Z junctions. Substituting monodentate pyridine in Os-py reagent by bidentate 2,2'- bipyridine results in more stable DNA adducts and allows working with osmium tetroxide and the ligand at equimolar concentrations. Different ligands have been tested for their ability to modify site specifically the cruciform loop and B-Z junctions in supercoiled plasmids. It has been shown the OsO 4 complexes with tetramethylethylenediamine (TEMED) or bathophenanthrolinedisulfonic acid (bpds) can site specifically modify the above-mentioned structures at millimolar and sub-millimolar concentrations. The adducts resulting from DNA treatment with Os-bipy, Os-bpds, or Os-TEMED labilize the sugar-phosphate backbone in a way similar to the Os-py adducts, and their reaction sites in the polynucleotide chain can be detected by hot piperidine cleavage and sequencing.