Peanut Stunt Virus Research Articles

Peanut stunt virus movement protein is the limiting factor in Capsicum annuum infection

Cucumber mosaic virus (CMV) is one of the most devastating plant viruses, with more than 1,200 species of host plants. The host range and economic importance of peanut stunt virus (PSV) are mostly limited to legumes, despite the similar taxonomy and genome structure with CMV. Since no data are available on the background of the limited host range of PSV, RNA 3 recombinant and reassortant viruses were generated (C12P3, P12C3, C12CP3, C12PC3, C12PΔC3) to study their infection phenotype on a common host (Nicotiana benthamiana) and on a selective host (Capsicum annuum cv. Brody). The PSV movement protein (MP) was not able to function with the coat protein (CP) of CMV unless the C-terminal 42 amino acids were deleted from the PSV MP. As a result of the inoculation experiments, MP was considered the protein influencing symptom phenotypes on N. benthamiana and responsible for the host range difference on the pepper. Since plasmodesmata (PD) localization of viral MPs is essential for cell-to-cell movement, subcellular localization of GFP-tagged MPs (CMV-MP-eGFP, PSV-MP-eGFP) was observed. In the case of CMV-MP-eGFP, clear colocalization with PD was detected in both hosts, but PSV-MP-eGFP was not tightly connected to the PD in N. benthamiana and barely localized to the PD in C. annuum epidermal cells. Measuring Pearson correlation coefficients (PCCs) also supported the visual observation.

The influence of peanut stunt virus infection on black soybean seed quality

The influence of peanut stunt virus infection on black soybean seed quality

The Virome of 'Lamon Bean': Application of MinION Sequencing to Investigate the Virus Population Associated with Symptomatic Beans in the Lamon Area, Italy.

‘Lamon bean’ is a protected geographical indication (PGI) for a product of four varieties of bean (Phaseolus vulgaris L.) grown in a specific area of production, which is located in the Belluno district, Veneto region (N.E. of Italy). In the last decade, the ‘Lamon bean’ has been threatened by severe virus epidemics that have compromised its profitability. In this work, the full virome of seven bean samples showing different foliar symptoms was obtained by MinION sequencing. Evidence that emerged from sequencing was validated through RT-PCR and ELISA in a large number of plants, including different ecotypes of Lamon bean and wild herbaceous hosts that may represent a virus reservoir in the field. Results revealed the presence of bean common mosaic virus (BCMV), cucumber mosaic virus (CMV), peanut stunt virus (PSV), and bean yellow mosaic virus (BYMV), which often occurred as mixed infections. Moreover, both CMV and PSV were reported in association with strain-specific satellite RNAs (satRNAs). In conclusion, this work sheds light on the cause of the severe diseases affecting the ‘Lamon bean’ by exploitation of MinION sequencing.

First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea) in China.

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer's instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5'-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5'RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.

Effect of mutations in the 2b protein of tomato aspermy virus on RNA silencing suppressor activity, virulence, and virus-induced gene silencing.

Tomato aspermy virus (TAV) and cucumber mosaic virus (CMV) belong to the genus Cucumovirus in the family Bromoviridae. The cucumovirus 2b protein is one of the first identified viral suppressors of RNA silencing (VSR). The cucumovirus 2b protein contains a conserved amino acid motif consisting of several highly conserved amino acid residues. Here, we demonstrate that the TAV 2b protein N-terminal region, Arg46, Ser40, and Ser42 as well as the CMV 2b protein are essential for VSR activity, virulence, and viral RNA accumulation. Furthermore, we developed the first TAV-induced gene silencing (VIGS) vector. In contrast to other cucumovirus vectors, such as CMV and peanut stunt virus, the TAV vector did not induce a silencing phenotype in Nicotiana benthamiana when 2b protein VSR activity was retained. These findings suggest that the cucumovirus 2b proteins share amino acid residues for VSR activity but may have different roles in VIGS induction.

Analysis of the Role of Bradysia impatiens (Diptera: Sciaridae) as a Vector Transmitting Peanut Stunt Virus on the Model Plant Nicotiana benthamiana.

Bradysia species, commonly known as fungus gnats, are ubiquitous in greenhouses, nurseries of horticultural plants, and commercial mushroom houses, causing significant economic losses. Moreover, the insects from the Bradysia genus have a well-documented role in plant pathogenic fungi transmission. Here, a study on the potential of Bradysia impatiens to acquire and transmit the peanut stunt virus (PSV) from plant to plant was undertaken. Four-day-old larvae of B. impatiens were exposed to PSV-P strain by feeding on virus-infected leaves of Nicotiana benthamiana and then transferred to healthy plants in laboratory conditions. Using the reverse transcription-polymerase chain reaction (RT-PCR), real-time PCR (RT-qPCR), and digital droplet PCR (RT-ddPCR), the PSV RNAs in the larva, pupa, and imago of B. impatiens were detected and quantified. The presence of PSV genomic RNA strands as well as viral coat protein in N. benthamiana, on which the viruliferous larvae were feeding, was also confirmed at the molecular level, even though the characteristic symptoms of PSV infection were not observed. The results have shown that larvae of B. impatiens could acquire the virus and transmit it to healthy plants. Moreover, it has been proven that PSV might persist in the insect body transstadially. Although the molecular mechanisms of virion acquisition and retention during insect development need further studies, this is the first report on B. impatiens playing a potential role in plant virus transmission.

Multiple cellular compartments engagement in Nicotiana benthamiana-peanut stunt virus-satRNA interactions revealed by systems biology approach

Key messagePSV infection changed the abundance of host plant’s transcripts and proteins associated with various cellular compartments, including ribosomes, chloroplasts, mitochondria, the nucleus and cytosol, affecting photosynthesis, translation, transcription, and splicing.Virus infection is a process resulting in numerous molecular, cellular, and physiological changes, a wide range of which can be analyzed due to development of many high-throughput techniques. Plant RNA viruses are known to replicate in the cytoplasm; however, the roles of chloroplasts and other cellular structures in the viral replication cycle and in plant antiviral defense have been recently emphasized. Therefore, the aim of this study was to analyze the small RNAs, transcripts, proteins, and phosphoproteins affected during peanut stunt virus strain P (PSV-P)–Nicotiana benthamiana interactions with or without satellite RNA (satRNA) in the context of their cellular localization or functional connections with particular cellular compartments to elucidate the compartments most affected during pathogenesis at the early stages of infection. Moreover, the processes associated with particular cell compartments were determined. The ‘omic’ results were subjected to comparative data analyses. Transcriptomic and small RNA (sRNA)–seq data were obtained to provide new insights into PSV-P–satRNA–plant interactions, whereas previously obtained proteomic and phosphoproteomic data were used to broaden the analysis to terms associated with cellular compartments affected by virus infection. Based on the collected results, infection with PSV-P contributed to changes in the abundance of transcripts and proteins associated with various cellular compartments, including ribosomes, chloroplasts, mitochondria, the nucleus and the cytosol, and the most affected processes were photosynthesis, translation, transcription, and mRNA splicing. Furthermore, sRNA-seq and phosphoproteomic analyses indicated that kinase regulation resulted in decreases in phosphorylation levels. The kinases were associated with the membrane, cytoplasm, and nucleus components.

Estimation of the functions of viral RNA silencing suppressors by apple latent spherical virus vector.

Apple latent spherical virus (ALSV) is a latent virus with wide host range of plant species. In the present study, we prepared ALSV vectors expressing RNA silencing suppressors (RSSs) from eight plant viruses: P19 of carnation Italian ring spot virus (tombusvirus), 2b of peanut stunt virus (cucumovirus), NSs of tomato spotted wilt virus (tospovirus), HC-Pro of bean yellow mosaic virus (potyvirus), γb of barley stripe mosaic virus (hordeivirus), P15 of peanut clump virus (pecluvirus), P1 of rice yellow mottle virus (sobemovirus), or P21 of beet yellows virus (closterovirus). These vectors were inoculated to Nicotiana benthamiana to investigate the effects of RSSs on the virulence and accumulation of ALSV. Among the vectors, ALSV expressing NSs (ALSV-NSs) developed severe mosaic symptoms in newly developed leaves followed by plant death. Infection of ALSV-γb induced characteristic concentric ringspot symptoms on leaves, and plants infected with ALSV-HC-Pro showed mosaic and dwarf symptoms. Infection of the other five ALSV vectors did not show symptoms. ELISA and immunoblot assay indicated that virus titer increased in leaves infected with ALSV-NSs, γb, HC-Pro, or P19. RT-qPCR indicated that the amount of ALSV in plants infected with ALSV-NSs was increased by approximately 45 times compared with that of wtALSV without expression of any RSS. When ALSV-P19, NSs, or HC-Pro was inoculated to Cucumis sativus plants, none of these ALSV vectors induced symptoms, but accumulation of ALSV in plants infected with ALSV-NSs was increased, suggesting that functions of RSSs on virulence and accumulation of ALSV depend on host species.

Peanut Stunt Virus and Its Satellite RNA Trigger Changes in Phosphorylation in N. benthamiana Infected Plants at the Early Stage of the Infection.

Signaling in host plants is an integral part of a successful infection by pathogenic RNA viruses. Therefore, identifying early signaling events in host plants that play an important role in establishing the infection process will help our understanding of the disease process. In this context, phosphorylation constitutes one of the most important post-translational protein modifications, regulating many cellular signaling processes. In this study, we aimed to identify the processes affected by infection with Peanut stunt virus (PSV) and its satellite RNA (satRNA) in Nicotiana benthamiana at the early stage of pathogenesis. To achieve this, we performed proteome and phosphoproteome analyses on plants treated with PSV and its satRNA. The analysis of the number of differentially phosphorylated proteins showed strong down-regulation in phosphorylation in virus-treated plants (without satRNA). Moreover, proteome analysis revealed more down-regulated proteins in PSV and satRNA-treated plants, which indicated a complex dependence between proteins and their modifications. Apart from changes in photosynthesis and carbon metabolism, which are usually observed in virus-infected plants, alterations in proteins involved in RNA synthesis, transport, and turnover were observed. As a whole, this is the first community (phospho)proteome resource upon infection of N. benthamiana with a cucumovirus and its satRNA and this resource constitutes a valuable data set for future studies.

The Defense Response of Nicotiana benthamiana to Peanut Stunt Virus Infection in the Presence of Symptom Exacerbating Satellite RNA.

Peanut stunt virus (PSV) is a widespread pathogen infecting legumes. The PSV strains are classified into four subgroups and some are defined by the association of satellite RNAs (satRNAs). In the case of PSV, the presence of satRNAs alters the symptoms of disease in infected plants. In this study, we elucidated the plant response to PSV-G strain, which occurs in natural conditions without satRNA. However, it was found that it might easily acquire satRNA, which exacerbated pathogenesis in Nicotiana benthamiana. To explain the mechanisms underlying PSV infection and symptoms exacerbation caused by satRNA, we carried out transcriptome profiling of N. benthamiana challenged by PSV-G and satRNA using species-specific microarrays. Co-infection of plants with PSV-G + satRNA increased the number of identified differentially expressed genes (DEGs) compared with the number identified in PSV-G-infected plants. In both treatments, the majority of up-regulated DEGs were engaged in translation, ribosome biogenesis, RNA metabolism, and response to stimuli, while the down-regulated DEGs were required for photosynthesis. The presence of satRNA in PSV-G-infected plants caused different trends in expression of DEGs associated with phosphorylation, ATP binding, and plasma membrane.

First report of Peanut stunt virus on beans in Bulgaria

First report of Peanut stunt virus on beans in Bulgaria

First report of Peanut stunt virus on beans in Bulgaria

Common bean (Phaseolus vulgaris) is a traditional vegetable in Bulgaria. The area grown in for 2013 was estimated to be 344 ha which increased gradually to reach 708 ha in 2016. During the summer of 2013, leaf samples (n=76) with …

Rapid detection of fifteen known soybean viruses by dot-immunobinding assay

A dot-immunobinding assay (DIBA) was optimized and used successfully for the rapid detection of 15 known viruses [Alfalfa mosaic virus (AMV), Bean pod mottle virus (BPMV), Bean yellow mosaic virus (BYMV), Cowpea mild mottle virus (CPMMV), Cowpea severe mosaic virus (CPSMV), Cucumber mosaic virus (CMV), Peanut mottle virus (PeMoV), Peanut stunt virus (PSV), Southern bean mosaic virus (SBMV), Soybean dwarf virus (SbDV), Soybean mosaic virus (SMV), Soybean vein necrosis virus (SVNV), Tobacco ringspot virus (TRSV), Tomato ringspot virus (ToRSV), and Tobacco streak virus (TSV)] infecting soybean plants in Oklahoma. More than 1000 leaf samples were collected in approximately 100 commercial soybean fields in 24 counties of Oklahoma, during the 2012–2013 growing seasons. All samples were tested by DIBA using polyclonal antibodies of the above 15 plant viruses. Thirteen viruses were detected, and 8 of them were reported for the first time in soybean crops of Oklahoma. The highest average incidence was recorded for PeMoV (13.5%) followed by SVNV (6.9%), TSV (6.4%), BYMV, (4.5%), and TRSV (3.9%), while the remaining seven viruses were detected in less than 2% of the samples tested. The DIBA was quick, and economical to screen more than 1000 samples against 15 known plant viruses in a very short time.

Nucleotide sequence analyses of coat protein gene of peanut stunt virus isolates from alfalfa and different hosts show a new tentative subgroup from Iran.

Alfalfa cultivars grown in 14 provinces in Iran were surveyed for the relative incidence of peanut stunt virus (PSV) during 2013-2016. PSV were detected in 41.89% of symptomatic alfalfa samples and a few alternate hosts by plate-trapped antigen ELISA. Among other hosts tested only Chenopodium album, Robinia pseudoacacia and Arachis hypogaea were found naturally infected with PSV. Twenty five isolates of PSV were chosen for biological and molecular characterizations based on their geographical distributions. There was not any differences in experimental host range of these isolates; however, variation in systemic symptoms observed on Nicotiana glutinosa. Total RNA from 25 of viral isolates were subjected to reverse transcription polymerase chain reaction analysis using primers directed against coat protein (CP) gene. The CP genes of 25 Iranian PSV isolates were either 651 or 666 nucleotides long. The nucleotide and amino acid identities for CP gene among Iranian PSV isolates were 79.3-99.7 and 72-100%, respectively. They also shared between 67.4 and 82.4% pairwise nucleotide identity with other PSV isolates reported elsewhere in the world. Phylogenetic analyses of CP gene sequences showed formation of a new subgroup comprising only the Iranian isolates. Natural infection of a few alternate hosts with PSV is reported for the first time from Iran.

Recombination-based generation of the agroinfectious clones of Peanut stunt virus

Full-length cDNA clones of Peanut stunt virus strain P (PSV-P) were constructed and introduced into Nicotiana benthamiana plants via Agrobacterium tumefaciens. The cDNA fragments corresponding to three PSV genomic RNAs and satellite RNA were cloned into pGreen binary vector between Cauliflower mosaic virus (CaMV) 35S promoter and nopaline synthase (NOS) terminator employing seamless recombinational cloning system. The plasmids were delivered into A. tumefaciens, followed by infiltration of hosts plants. The typical symptoms on systemic leaves of infected plants similar to those of wild-type PSV-P were observed. The presence of the virus was confirmed by means of RT-PCR and Western blotting. Re-inoculation to N. benthamiana, Phaseolus vulgaris, and Pisum sativum resulted in analogous results. Generation of infectious clones of PSV-P enables studies on virus-host interaction as well as revealing viral genes functions.

Detection of new viruses in alfalfa, weeds and cultivated plants growing adjacent to alfalfa fields in Saudi Arabia.

A total of 1368 symptomatic plant samples showing different virus-like symptoms such as mottling, chlorosis, mosaic, yellow mosaic, vein clearing and stunting were collected from alfalfa, weed and cultivated plant species growing in vicinity of alfalfa fields in five principal regions of alfalfa production in Saudi Arabia. DAS-ELISA test indicated occurrence of 11 different viruses in these samples, 10 of which were detected for the first time in Saudi Arabia. Eighty percent of the alfalfa samples and 97.5% of the weed and cultivated plants samples were found to be infected with one or more of these viruses. Nine weed plant species were found to harbor these viruses namely, Sonchus oleraceus, Chenopodium spp., Hibiscus spp., Cichorium intybus, Convolvulus arvensis, Malva parviflora, Rubus fruticosus, Hippuris vulgaris, and Flaveria trinervia. These viruses were also detected in seven cultivated crop plants growing adjacent to the alfalfa fields including Vigna unguiculata, Solanum tuberosum, Solanum melongena, Phaseolus vulgaris, Cucurbita maxima, Capsicum annuum, and Vicia faba. The newly reported viruses together with their respective percent of detection in alfalfa, and in both weeds and cultivated crop plant species together were as follows: Bean leaf roll virus (BLRV) {12.5 and 4.5%}, Lucerne transient streak virus (LTSV) {2.9 and 3.5%}, Bean yellow mosaic virus (BYMV) {1.4 and 4.5%}, Bean common mosaic virus (BCMV) {1.2 and 4.5%}, Red clover vein mosaic virus (RCVMV) {1.2 and 4%}, White clover mosaic virus (WCIMV) {1.0 and 5%}, Cucumber mosaic virus (CMV) {0.8 and 3%}, Pea streak virus (PeSV) {0.4 and 4.5%} and Tobacco streak virus (TSV) {0.3 and 2.5%}. Alfalfa mosaic virus (AMV), the previously reported virus in alfalfa, had the highest percentage of detection in alfalfa accounting for 58.4% and 62.8% in the weeds and cultivated plants. Peanut stunt virus (PSV) was also detected for the first time in Saudi Arabia with a 66.7% of infection in 90 alfalfa samples collected from the surveyed regions during the last visit that tested negative to all the previously detected viruses.

Sward Structure, Light Interception, and Rhizome‐Root Responses of Rhizoma Peanut Cultivars and Germplasm to Grazing Management

‘Florigraze’ rhizoma peanut (RP; Arachis glabrata Benth.) is a persistent forage legume for the US Gulf Coast, but peanut stunt virus (Cucumovirus spp.) reduces herbage accumulation (HA). Less susceptible germplasms and cultivars of RP have been released, but their responses to grazing management are not known. The objective was to quantify aboveground and belowground sward responses to grazing management of RP entries differing in growth habit to explain HA and persistence. Treatments were all combinations of four RP entries (Florigraze, ‘UF Peace’, ‘UF Tito’, and germplasm Ecoturf), two grazing intensities (50 and 75% removal of pre‐grazing canopy height), and two regrowth intervals (3 or 6 wk). UF Tito swards were the tallest and Ecoturf the shortest, but Ecoturf had greater herbage bulk density than any entry. Pre‐grazing leaf percentage was greatest for Ecoturf (61%); there were no differences among the upright entries (56–57%). Ecoturf (0.88) and UF Tito (0.76) had greater post‐grazing residual leaf area index than Florigraze (0.61). Ecoturf and UF Tito had greater rhizome‐root mass (4450 and 4110 kg ha‐1, respectively) than Florigraze and UF Peace (3490 and 3170 kg ha‐1, respectively). Pre‐grazing light interception was greater for the 6‐ than 3‐wk grazing frequency (85 vs. 70%, respectively), and rhizome‐root mass followed a similar pattern (3990 vs. 2730 kg ha‐1, respectively). Sward structure, leaf, and rhizome‐root data explain lack of differences among entries in HA, excellent persistence of Ecoturf and UF Tito, and generally greater HA and persistence for 6‐ vs. 3‐wk regrowth intervals.

Effect of temperature on the pathogenesis, accumulation of viral and satellite RNAs and on plant proteome in peanut stunt virus and satellite RNA-infected plants.

Temperature is an important environmental factor influencing plant development in natural and diseased conditions. The growth rate of plants grown at C27°C is more rapid than for plants grown at 21°C. Thus, temperature affects the rate of pathogenesis progression in individual plants. We have analyzed the effect of temperature conditions (either 21°C or 27°C during the day) on the accumulation rate of the virus and satellite RNA (satRNA) in Nicotiana benthamiana plants infected by peanut stunt virus (PSV) with and without its satRNA, at four time points. In addition, we extracted proteins from PSV and PSV plus satRNA-infected plants harvested at 21 dpi, when disease symptoms began to appear on plants grown at 21°C and were well developed on those grown at 27°C, to assess the proteome profile in infected plants compared to mock-inoculated plants grown at these two temperatures, using 2D-gel electrophoresis and mass spectrometry approaches. The accumulation rate of the viral RNAs and satRNA was more rapid at 27°C at the beginning of the infection and then rapidly decreased in PSV-infected plants. At 21 dpi, PSV and satRNA accumulation was higher at 21°C and had a tendency to increase further. In all studied plants grown at 27°C, we observed a significant drop in the identified proteins participating in photosynthesis and carbohydrate metabolism at the proteome level, in comparison to plants maintained at 21°C. On the other hand, the proteins involved in protein metabolic processes were all more abundant in plants grown at 27°C. This was especially evident when PSV-infected plants were analyzed, where increase in abundance of proteins involved in protein synthesis, degradation, and folding was revealed. In mock-inoculated and PSV-infected plants we found an increase in abundance of the majority of stress-related differently-regulated proteins and those associated with protein metabolism. In contrast, in PSV plus satRNA-infected plants the shift in the temperature barely increased the level of stress-related proteins.

Biological and Molecular Characterization of Alfalfa Mosaic Virus Infecting Trumpet Creeper (Campsis radicans) in Iran

AbstractSamples of trumpet creeper (Campsis radicans) leaves showing mottling and mosaic were collected from plants growing in a private garden in Tehran province, Iran, in 2012. Symptomatic leaf samples were tested for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV) and Peanut stunt virus (PSV) infection in enzyme‐linked immunosorbent assay (ELISA), using specific antibodies. None of the samples were positive for CMV and PSV; however, all reacted positively with that of AMV antiserum. In biological assay, systemic infection was found on Datura stramonium, Nicotiana tabacum cvs., White Burley, and Xanthi, 21 days postinoculation (DPI), while necrotic local lesions were obtained following inoculation of Phaseolus vulgaris and Vigna unguiculata within three to four DPI. Using a pair of primers specific for AMV, a DNA fragment of 880 bp was RT‐PCR‐amplified. Analysis of the sequences revealed the presence of 657 nucleotides of AMV complete coat protein (CP) gene (translating 218 amino acid residues). Phylogenetic analysis using neighbour‐joining (NJ) method clustered AMV isolates into two main types and the IRN‐Tru (GenBank Accession No. JX865593) isolate fell into type I. Pairwise nucleotide distances also confirmed two main types with the highest and lowest similarities for type I and II, respectively. The association of AMV with mosaic disease of C. radicans represents the first record from the world.

<i>Peanut stunt virus</i>-induced gene silencing in white lupin (<i>Lupinus albus</i>)

White lupin (Lupinus albus L.) plants develop cluster roots and have strong resistance to phosphorus starvation. Although many expressed sequences have been identified to explain the mechanisms used by white lupin to acquire phosphorus, the lack of a stable transformation technique has made it challenging to evaluate the functions of these expressed sequences. Virus-induced gene silencing (VIGS) is an attractive method for assaying gene function in species that are difficult to stably transform. Here, we show that the Peanut stunt virus (PSV) vector effectively induces silencing of endogenous genes in white lupin. It is unknown whether PSV is useful for VIGS; therefore, we first inoculated Nicotiana benthamiana plants with PSV harbouring fragments of the N. benthamiana phytoene desaturase gene (NbPDS). Two out of four distinct sequence fragments of NbPDS induced photo-bleaching in N. benthamiana, indicating that PSV can be used to knockdown endogenous gene sequences in a sequence-dependent manner. White lupin plants inoculated with PSV harbouring fragments of the L. albus PDS gene (LaPDS) developed photo-bleaching that was associated with a significant reduction in LaPDS mRNA accumulation. PSV spread systemically in leaves, roots, and cluster roots, and small interfering RNA of LaPDS was detected in these organs. This is the first study to demonstrate the use of VIGS by PSV, suggesting that this vector can be applied to supress endogenous gene expression in shoots and roots of white lupin and to clarify the mechanisms of phosphorus starvation resistance.