Molecular Markers Of Apoptosis Research Articles

Kynurenic acid protects against ischemia/reperfusion injury by modulating apoptosis in cardiomyocytes

Acute myocardial infarction, often associated with ischemia/reperfusion injury (I/R), is a leading cause of death worldwide. Although the endogenous tryptophan metabolite kynurenic acid (KYNA) has been shown to exert protection against I/R injury, its mechanism of action at the cellular and molecular level is not well understood yet. Therefore, we examined the potential involvement of antiapoptotic mechanisms, as well as N-methyl-D-aspartate (NMDA) receptor modulation in the protective effect of KYNA in cardiac cells exposed to simulated I/R (SI/R). KYNA was shown to attenuate cell death induced by SI/R dose-dependently in H9c2 cells or primary rat cardiomyocytes. Analysis of morphological and molecular markers of apoptosis (i.e., membrane blebbing, apoptotic nuclear morphology, DNA double-strand breaks, activation of caspases) revealed considerably increased apoptotic activity in cardiac cells undergoing SI/R. The investigated apoptotic markers were substantially improved by treatment with the cytoprotective dose of KYNA. Although cardiac cells were shown to express NMDA receptors, another NMDA antagonist structurally different from KYNA was unable to protect against SI/R-induced cell death. Our findings provide evidence that the protective effect of KYNA against SI/R-induced cardiac cell injury involves antiapoptotic mechanisms, that seem to evoke independently of NMDA receptor signaling.

Evaluation of locking compression plate fixation of the distal phalanx to the hoof wall as a potential therapy for laminitis.

Surgical stabilisation of the distal phalanx (DP) is a potential therapeutic strategy for severe acute laminitis. To evaluate the effects of locking compression plate (LCP) fixation of the DP to the dorsal hoof wall. Ex vivo and in vivo experiments. A T-shaped LCP was applied to one limb per pair in six pairs of cadaver forelimbs subjected to a combination of thermally induced lamellar failure and vertical load to simulate severe acute laminitis. Standard radiographic measurements were used to compare DP displacement. The LCP was then applied to one forefoot in 12 healthy Standardbred horses either standing (n=6) or under general anaesthesia (n=6). Lameness was evaluated daily, then horses were euthanised (day 8) and lamellar tissue analysed using light microscopy, histomorphometery and molecular markers of apoptosis. In the cadaver limb model, LCP fixation prevented the significant changes in hoof-distal phalanx distance, coronary extensor process distance and sole depth that characterised DP displacement in untreated limbs (p < 0.05). Application of the construct in vivo was well tolerated with minimal lameness (10/12 horses were sound at the trot on day 8); however, histology revealed dorsal lamellar pathology consistent with laminitis, but with extensive keratinocyte apoptosis. Adjacent to the LCP, caspase-3 positive cell counts were approximately 20-fold higher than control (p < 0.001). Pathology was evaluated at a single time point. Microvascular perfusion was not evaluated. Rigid fixation of the DP to the hoof capsule was achieved with the LCP construct in a cadaver limb laminitis model. In live horses, LCP fixation caused regional lamellar pathology with extensive apoptosis, likely due to disturbed lamellar microvascular perfusion and/or mechanostasis. Understanding these mechanisms is critical for refinement of the technique in order to avoid iatrogenic lamellar damage.

Molecular characterization, expression, and apoptosis regulation of siva1 in protogynous hermaphrodite fish ricefield eel (Monopterus albus).

Siva1, which induces extensive apoptosis, has been well characterized. To elucidate the molecular function of Siva1 in ricefield eel, molecular characterization and phylogenetic analysis were performed, and the mRNA expression in the ovary at different developmental stages and ovary tissues exposed to H2O2 and Z-VAD-FMK in vitro were also evaluated. The results indicated that ricefield eel Siva1 was highly conserved and contains three conserved motifs, despite 83 amino acid differences upstream of the initiation codon. Phylogenetic analysis demonstrated that ricefield eel Siva1 clusters together with the Siva1 protein of the other fish, with high sequence homology with that of Lates calcarifer. Quantitative real-time polymerase chain reaction analysis showed high siva1 expression levels in the ovary and low expression levels in the liver. The higher mRNA levels of siva1 were detected in the IE and IM, and the lower siva1 mRNA levels were found in the OM, IL, and TE during gonadal development. Additionally, siva1 expression levels in the ovarian tissues were significantly increased at 1h post incubation (hpi) with H2O2 and then significantly decreased at 2 hpi; however, siva1 expression was upregulated significantly at 4 and 8 hpi, similar to the patterns observed with caspase3, which was used as a molecular marker of apoptosis. Moreover, the siva1 mRNAs were elevated significantly than that in control groups at 1 hpi, but the expression of siva1 was down-regulated dramatically at 2, 4, and 8 hpi, which were similar with that of caspase3 expression profiles after Z-VAD-FMK incubation. What's more, Pearson's correlation coefficients showed strongly positive relationships between siva1 and caspase3. These findings suggest that Siva1 plays an important apoptosis role in gonadal development of ricefield eel.

A Larval Zebrafish Model for Assessing Hypoxic‐Induced In Vivo Cardiomyocyte Damage: Time Course for Induction and Cardiac Output Recovery

Larval zebrafish are used to study regenerative properties of cardiac muscle and treatments that may enhance this process. Cardiac injury models in zebrafish larva currently include cryoinjury, laser ablation, pharmacological treatment and cardiac dysfunction mutations. Effective in damaging cardiomyocytes, these models lack the critical element of tissue hypoxia, which induces molecular cascades within cardiac muscle. We have developed a potentially more realistic model for studying cardiac arrest and recovery in larval zebrafish (Danio rerio) by using acute, severe hypoxic exposure to briefly induce cardiac arrest. Exposure to PO2s of 6–9 mmHg induces loss of mobility followed by cardiac arrest within 120 min in 5 days post fertilization (dpf) and within 40 min at 10 dpf. Approximately 90% of 5dpf larvae survived acute, severe hypoxic exposure, but survival fell to 30% by 10 dpf. Heart beat resumed in surviving larvae and returned to air‐saturated water at 4 min in 5 dpf and 6–8 min at 8–10 dpf. Heart rate, stroke volume and cardiac output in control 6–7 dpf larvae before hypoxic exposure were 188±5 bpm, 0.20±0.001nl and 35.5.3±2.2 nl/min (n=35), respectively. In larvae with hypoxia‐induced cardiac arrest, heart rate returned to control values by 24 h of recovery, but stroke volume and cardiac output remained ~50% depressed from control values at 24 h of recovery. Full restoration of cardiac performance was evident at 72h, indicating that regenerative properties of the zebrafish heart extend to critical physiological measures. Molecular markers for apoptosis (Caspase‐3) were elevated &gt;5‐fold immediately after resumption of heart beat, peaking after 4 hours into the recovery period. A cell regeneration marker (PCNA) increased &gt;4‐fold beginning after a lag of 2 hours, and was still elevated ~6 hours after resumption of heart beat, presumably contributing to recovery of heart function. The highly reproducible cardiac effects of acute hypoxia‐induced cardiac arrest in the larval zebrafish presents an alternative, realistic model for studying cardiac tissue hypoxia injury and recovery of function.Support or Funding InformationAstraZenecaTime course of changes in heart rate, stroke volume, and cardiac output in 5–7 day larval zebrafish following induction of cardiac arrest by acute hypoxic exposure (PO2 ~ 7–9 mmHg).Figure 1

Temporal Requirement of Mab21l2 During Eye Development in Chick Reveals Stage-Dependent Functions for Retinogenesis.

Different missense mutations in the single exon gene Mab21l2 have been identified in unrelated families with various bilateral eye malformations, including microphthalmia, anophthalmia, and coloboma, but the molecular function of Mab21l2 during eye development still remains largely unknown. We have established an in vivo Mab21l2-deficient eye development model in chick, by using a Mab21l2 RNA interference construct that we electroporated in ovo in prospective retinal cells. In addition, we designed a Mab21l2 gain-of-function electroporation vector. Mab21l2-modulated retinas were analyzed on consecutive sections in terms of morphology, and molecular markers for apoptosis, cell proliferation, and retinogenesis. Our Mab21l2-deficient chick model mimics human ocular phenotypes. When Mab21l2 is downregulated prior to optic vesicle formation, the embryos develop anophthalmia, and Mab21l2 inhibition by optic cup stages results in a microphthalmic colobomatous phenotype. Our results show that inhibition of Mab21l2 affects cell proliferation, cell cycle exit, and the expression of Atoh7/Ath5, NeuroD4/Ath3, Isl1, Pax6, AP-2α, and Prox1. In addition, Mab21l2 overexpression hampers cell cycle exit and differentiation of retinal progenitor cells (RPCs). Our results highlight the importance of a regulated temporal expression of Mab21l2 during eye development: At early stages, Mab21l2 is required to maintain RPC proliferation and expansion of cell number; before retinogenesis, a decrease in Mab21l2 expression in proliferating RPCs is required for cell cycle exit and differentiation; during retinogenesis, Mab21l2 is chronologically upregulated in RGCs, followed by differentiated horizontal and amacrine cells and cone photoreceptor cells.

Proliferative events and apoptotic remodelling in retinal development of common toad (Bufo bufo).

Proliferation and apoptosis are fundamental processes in the development of the retina, and a proper balance of the two phenomena is crucial to correct development of the organ. Despite intense investigation in different vertebrates, only a few studies have analyzed the cell death and the cell division quantitatively in the same species during development. Here we studied the time course of apoptosis and proliferation in the retina of common toad, Bufo bufo, and discuss the findings in an evolutionary perspective. We found cells that were dividing first scattered throughout the retina, then, in later stages, proliferation was confined to the ciliary marginal zone. This pattern was confirmed by the expression of the proliferative marker PCNA. Both proliferation and apoptosis occurred in successive waves, and two apoptotic peaks were detected: one at premetamorphosis 1 and the second at prometamorphosis. PARP-1, a known molecular marker of apoptosis, was used to confirm the data obtained by counting pyknotic nuclei. In summary, proliferative and apoptotic waves display an inverse time-relationship through development, with apoptotic peaks coinciding with low proliferation phases. In a comparative perspective, amphibians follow a developmental pattern similar to other vertebrates, although with different timing.

Proanthocyanidin and fish oil potent activity against cisplatin-induced renal cell cycle arrest and apoptosis in rats

Cisplatin is an effective chemotherapeutic agent that displays dose-limiting nephrotoxicity. In the present study, the efficacy of grape seed proanthocyanidin extract (GSPE: 100 mg/kg/day) and fish oil (FO: 5 mL/kg/day) against cisplatin-induced nephrotoxicity was evaluated in terms of DNA damage, histopathological changes and expression levels of molecular markers of apoptosis. The administration of cisplatin (CP) (7 mg/kg) results in an increasing percentage of S-phase, G2/M and apoptosis. Furthermore, CP induces apoptosis as indicated by an elevation of renal caspase-3 and reduction in the expression of BCL-2. In addition to occurred renal histopathological changes as manifested by tubular degeneration, degenerative glomerulus, necrotic tubular cells, and cell debris. On the other hand, the administration of GSPE or FO pre-cisplatin treatment can be ameliorated the current DNA cell cycle alterations by the restoration of expression of proteins related to apoptosis and reduced the undesirable renal histopathological changes. So, it can be concluded that the consumption of GSPE or FO might be useful for minimizing nephrotoxicity caused by cisplatin chemotherapy through their anti-apoptotic and antioxidant properties.

Sweet taste of cell death: role of carbohydrate recognition systems

T he number of cellular and molecular markers of apoptosis described in cytoplasm, nucleus and mitochondria, is increasing yearly. Howe ver, up to recent time, plasma membrane (PM) markers stayed to be less studied [1], and only phosphatidylserine (PS) externalization has been well characterized in that compartment, and already proposed for application in biolo gy studies and medical diagnostics [2]. It should be stressed that PM markers of apoptosis possess some important advantages compared to all other markers of this phenomenon, since they are better accessible to extra-cellular interactions without disturbing cell integrity. Since PM markers of apoptotic cells can be recognized by the phagocytic and neighboring epithelial cells, they are very important for efficient elimination of apoptotic cells from tissues and organs. Cell death was shown to be accompanied by time-dependent sequence of intracellular events, starting with a trigger signal and ending with a complete removal of dying cells by their neighbors and macrophages. It is discussed since when one can consider the cell “dead” or “apoptotic”. The organism senses the dying cells by a change of their surface markers and by a release of particular intercellular molecules [3] also related to changes in plasma membrane. Thus, the PM-derived apoptosis markers seem to be the most “physiological” measure of whether the cell is alive, dying, or already dead (necrotic). Recently, glycoproteins (GPs) integrated in the PM of apoptotic cells, were addressed by the investigators searching for novel cell surface markers of apoptosis. The carbohydrate moiety of plasma membrane GPs, unlike the DNA or proteins, does not need a specific matrix for its synthesis. Besides, unlike 3′→5′ phospodiester bonds in DNA, or peptide bonds in proteins, two carbohydrate molecules can be joined together by eleven different bond combinations providing a huge number of possible oligosaccharides and much higher information potential that is perfectly described by H.-J. Gabius [4]. Carbohydrate binding proteins, the lectins, have demonstrated to be a powerful tool for recognizing different carbohydrate moieties. They were discovered over 100 years ago, and hundreds of lectins with various carbohydrate specificity and different functions were described in plants and animals [5, 6]. A principal function of lectin-carbohydrate interaction is well expressed at the immune response [7, 8], including autoimmunity [9], and cell elimination from the organism [10]. It was hypothesized [11], that such interaction could be an evolutionary ancestor of the antibody-antigen interaction.

AXL Mediates TRAIL Resistance in Esophageal Adenocarcinoma

The overexpression of AXL receptor tyrosine kinase is a frequent finding that has been associated with poor prognosis in esophageal adenocarcinoma (EAC). As the majority of EAC are intrinsically resistant to DNA-damaging therapies, an alternative therapeutic approach based on the activation of death receptors may be warranted. Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) has been evaluated in clinical trials and found promising as anticancer agent with mild side effects; unfortunately, resistance to TRAIL remains a major clinical problem. Herein, we explored the role of AXL in TRAIL resistance and elucidated the underlying mechanism. Overexpression of AXL in OE33 and OE19 cells promoted cell survival and attenuated TRAIL-induced cellular and molecular markers of apoptosis. In contrast, knockdown of endogenous AXL sensitized FLO-1 cells to TRAIL. The mechanism by which AXL regulates TRAIL resistance was examined. Protein and mRNA expression of DR4 and DR5 death receptors was not downregulated by AXL. In addition, the possible involvement of FLICE-inhibitory protein (FLIP) in regulating the interaction of caspase-8 with Fas-associated death domain protein (FADD) was excluded, as AXL did not enhance FLIP expression or FLIP/FADD association. Alternatively, protein association of AXL with DR5, independent of TRAIL, was confirmed, suggesting that AXL could regulate DR5 receptor activity. The AXL/DR5 association had no negative effect on TRAIL-induced interaction with FADD. However, the AXL/DR5 interaction blocked the recruitment of caspase-8 to the death-inducing signal complex (DISC). Collectively, our findings uncover a novel mechanism of TRAIL resistance mediated by AXL through regulation of the DISC and provide strong evidence that AXL could be exploited as a therapeutic target to circumvent TRAIL resistance.

ABL Regulation by AXL Promotes Cisplatin Resistance in Esophageal Cancer

Esophageal adenocarcinoma (EAC) is characterized by resistance to chemotherapy and poor outcome. Although cisplatin (CDDP) has been used as a first-line therapy in patients with EAC, resistance remains a major clinical problem. The AXL receptor tyrosine kinase, originally isolated as a transforming gene from leukemia, is overexpressed in several solid tumors. Herein, we assessed AXL protein expression in human EACs and examined its role in CDDP resistance in human EAC cells. AXL overexpression was detected in more than 50% of tumors examined. Elevating AXL in nonoverexpressing cells doubled the CDDP IC(50) and increased cell survival three-fold, while attenuating AXL in overexpressing cells reduced survival two-fold. The effects of AXL modulation on cell survival were associated with changes in cellular and molecular markers of apoptosis. Mechanistic investigations revealed that AXL blocked CDDP-induced activation of endogenous p73β (TP73), reducing its protein half-life, and inhibited CDDP-induced levels of p-c-ABL(Y412) and p-p73β(Y99). These changes were associated with a disruption of c-ABL/p73β protein interactions due to association with c-ABL in the cytoplasm, thereby blocking nuclear accumulation of c-ABL and phosphorylation of p73β in response to DNA damage. Together, our results establish that AXL promotes CDDP resistance in esophageal adenocarcinoma and argue that therapeutic targeting of AXL may sensitize these cancers to DNA-damaging drugs.

Suppression of Endogenous Hydrogen Sulfide Contributes to the Radiation-Induced Bystander Effects on Hypoxic HepG2 Cells

Radiation-induced bystander effects may have important implications in radiotherapy, but it is still not well known if radiation-induced bystander effects can be triggered in hypoxic tumor cells and what are the related bystander signals. Using human hepatoma cells of HepG2, the present study found that micronuclei (MN) could be induced in the nonirradiated cells after treatment with conditioned medium (CM) harvested from irradiated cells under hypoxic conditions. Bystander effects were diminished when the irradiated cells were pretreated with sodium hydrosulfide (NaHS, an exogenous H(2)S donor) (≤100 μM). However, the bystander effects were increased when the irradiated cells were pretreated with an inhibitor of cystathionine β-synthase (CBS) and cystathionine γ-lyase (CSE), the synthases of endogenous hydrogen sulfide (H(2)S). Western blotting showed that the expressions of CSE and CBS were increased in the irradiated hypoxic cells, but were reduced in the CM treated bystander cells. The ratio of Bcl-2/Bax, a molecular marker of apoptosis, decreased with CM treatment time. However, the activity of caspase-3 increased in the hypoxic bystander cells, and this could be regulated by both NaHS and the inhibitor of endogenous H(2)S. These results demonstrate that under hypoxic conditions irradiated hepatoma cells induce bystander responses by depressing the generation of endogenous H(2)S and altering Bcl-2/Bax ratios as well as caspase-3 dependent damage in the bystander cells.

Abstract 256: Involvement of ERK and ROS in CLEFMA-induced apoptosis in lung cancer cells

Abstract CLEFMA (4-[3,5-bis(2-chlorobenzylidene-4-oxo-piperidine-1-yl)-4-oxo-2-butenoic acid) is novel synthetic molecule with potent growth inhibitory activity in human cancer cells. Our microarray gene expression analysis suggested that it induces oxidative stress in lung adenocarcinoma H441 cells but not in normal lung fibroblasts. That oxidative stress is a triggering mechanism for both apoptotic and autophagic cell death has been supported by several recent reports. Compared to normal cells, the cancer cells are more vulnerable to oxidative stress-induced cell death because of their high metabolic activity, increased likelihood of electron escape during oxidative phosphorylation and overburdened antioxidant system. In this study, we tested our hypothesis that CLEFMA-induced apoptotic cell death was dependent on the accompanying increase in oxidative stress in H441cells. Methods: Inhibition of cell growth by CLEFMA (10 µM) was estimated by MTT or hexosaminidase assay. ROS production, cell cycle and apoptotic cell population were assessed by flow cytometry. The phosphorylation levels of extracellular signal-regulated kinase (ERK1/2), p38 and JNK1/2 were examined by Western blotting. N-acetylcysteine (NAC, 5 mM) and PD98059 (5 mM) were used as ROS scavenger and ERK1/2 inhibitors, respectively. The molecular markers of apoptosis were analyzed by RT-PCR and immunobloting. Results: NCI-DTP program confirmed anticancer activity of CLEFMA in 60 human cancer cell lines. CLEFMA-treated H441 cells showed typical molecular signatures of apoptosis- upregulated pro-apoptotic and downregulated anti-apoptotic genes. There was time-dependent activation of caspases 3/7, PARP cleavage and BAX; the expression of anti-apoptotic XIAP1 and BCL-xL was reduced, whereas pro-apoptotic p53 was increased. Since BID was not activated, it appears that CLEFMA works through intrinsic apoptosis pathway. CLEFMA also induced sustained activation of ERK, p38 and JNK. The pharmacologic inhibition of ERK, but not that of p38 and JNK, resulted in decreased anti-proliferative activity of CLEFMA. ERK inhibition with PD98059 abrogated CLEFMA-induced apoptosis. The sustained ERK activation was found to be associated with the inhibition of dual specificity phosphatase, DUSP6, expression. Treatment with ROS scavenger NAC abrogated CLEFMA-induced cell death, ERK activation and pro-apoptotic biomarkers, and reinstated DUSP6 expression. Conclusion: From the results of this study, we conclude that CLEFMA-induces apoptosis by enhancing oxidative stress in the cancer cells, and that the accompanying prolonged ERK activation is required for CLEFMA-induced H441 cell death. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 103rd Annual Meeting of the American Association for Cancer Research; 2012 Mar 31-Apr 4; Chicago, IL. Philadelphia (PA): AACR; Cancer Res 2012;72(8 Suppl):Abstract nr 256. doi:1538-7445.AM2012-256

The effect of 1-benzyl-1,2,3,4-tetrahydroisoquinoline on the metabolism of dopamine and molecular markers of apoptosis in rodent brain structures

The effect of 1-benzyl-1,2,3,4-tetrahydroisoquinoline on the metabolism of dopamine and molecular markers of apoptosis in rodent brain structures

Gene expression in osteoblast cells treated with submicron to nanometer hydroxyapatite-mullite eluate particles

The present research focused on determining the effect of hydroxyapatite-20 wt% mullite (H20M) particle eluates on apoptosis and differentiation of human fetal osteoblast (hFOB) cells. The H20M particles (257 ± 37 nm) were prepared, starting with the production of a nanocomposite using a unique route of spark plasma sintering, followed by a repeated grinding-cryo treatment and elution process. Tetrazolium based cytotoxicity assay results showed a time- and dose-dependent effect of H20M particle eluates on hFOB cytotoxicity. In particular, the results revealed statistically reduced cell viability after hFOB were exposed to the above 10% H20M (257 ± 37 nm) eluates for 48 h. The apoptotic cell death triggered by H20M treatment was proven by the analysis of molecular markers of apoptosis, that is, the Bcl-2 family of genes. hFOB expression of Bcl-xL and Bcl-xS significantly increased 25.6- and 25.2-fold for 50% of H20M concentrations, respectively. The ratio of Bcl-xL/Bax (4.01) decreased 2-fold for hFOB exposed to 100% of H20M eluates than that for 10% H20M eluate (7.94) treated hFOB cells. On the other hand, the Bcl-xS/Bax ratio for the 10% H20M eluate was 4.15-fold, whereas for 100% H20M eluates, it was 11.55-fold. Specifically, the anti-apoptotic effect of the H20M particle eluates was corroborated by the up-regulation of bone cell differentiation marker genes such as, collagen type I, cbfa, and osteocalcin. In summary, the present work clearly demonstrated that H20M submicron to nanometer composite particle eluates have a minimal effect on hFOB apoptosis and can even up-regulate the expression of bone cell markers at the molecular level.

Phosphatidylserine directly and positively regulates fusion of myoblasts into myotubes

Cell membrane consists of various lipids such as phosphatidylserine (PS), phosphatidylcholine (PC), and phosphatidylethanolamine (PE). Among them, PS is a molecular marker of apoptosis, because it is located to the inner leaflet of plasma membrane generally but it is moved to the outer leaflet during programmed cell death. The process of apoptosis has been implicated in the fusion of muscle progenitor cells, myoblasts, into myotubes. However, it remained unclear whether PS regulates muscle cell differentiation directly. In this paper, localization of PS to the outer leaflet of plasma membrane in proliferating primary myoblasts and during fusion of these myoblasts into myotubes is validated using Annexin V. Moreover, we show the presence of PS clusters at the cell–cell contact points, suggesting the importance of membrane ruffling and PS exposure for the myogenic cell fusion. Confirming this conclusion, experimentally constructed PS, but not PC liposomes dramatically enhance the formation of myotubes from myoblasts, thus demonstrating a direct positive effect of PS on the muscle cell fusion. In contrast, myoblasts exposed to PC liposomes produce long myotubes with low numbers of myonuclei. Moreover, pharmacological masking of PS on the myoblast surface inhibits fusion of these cells into myotubes in a dose-dependent manner.

Antioxidant defense and apoptotic effectors in ascorbic acid and β‐glycerophosphate‐induced osteoblastic differentiation

MC3T3-E1 cells grown in the presence of ascorbic acid and β-glycerophosphate (AA/β-GP) express alkaline phosphatase and produce an extensive collagenous extracellular matrix. Differentiated MC3T3-E1 cells are more sensitive to hydrogen peroxide-induced oxidative stress than undifferentiated cells. In this study, we compared the profile of antioxidant enzymes and molecular markers of apoptosis in undifferentiated and differentiated MC3T3-E1 cells (cell differentiation was induced by treatment with AA/β-GP). Differentiated osteoblasts showed lower expression and activity of catalase, glutathione S-transferase and glutathione peroxidase. The total superoxide dismutase activity and the expression of Cu/Zn superoxide dismutase were also lower, while the expression of Mn superoxide dismutase was higher in differentiated osteoblasts. The level of malondialdehyde, a widely used marker for oxidative stress, was lower in the AA/β-GP group compared with control cells, but this difference was not significant. Western blotting showed that treatment with AA/β-GP increased the Bax/Bcl-2 ratio used as an index of cellular vulnerability to apoptosis. In addition, the activities of caspases 3, 8 and 9 and cleaved poly (ADP) ribose polymerase were significantly higher in differentiated cells. These findings provide new insights into how changes in the activities of major antioxidant enzymes and in the signaling pathways associated with apoptosis may influence the susceptibility of bone cells to oxidative stress.

Brazilian Propolis Suppresses Angiogenesis by Inducing Apoptosis in Tube‐Forming Endothelial Cells through Inactivation of Survival Signal ERK1/2

We recently reported that propolis suppresses tumor-induced angiogenesis through tube formation inhibition and apoptosis induction in endothelial cells. However, molecular mechanisms underlying such angiogenesis suppression by propolis have not been fully elucidated. The aim of this study was to investigate the effects of ethanol extract of Brazilian propolis (EEBP) on two major survival signals, extracellular signal-regulated kinase 1/2 (ERK1/2) and Akt, and to elucidate whether changes in these signals were actually involved in antiangiogenic effects of the propolis. Detection by western blotting revealed that EEBP suppressed phosphorylation of ERK1/2, but not that of Akt. Pharmacological inhibition by U0126 demonstrated that ERK1/2 inactivation alone was enough to inhibit tube formation and induce apoptosis. It was also shown that EEBP and U0126 similarly induced activation of caspase-3 and cleavage of poly ADP-ribose polymerase (PARP) and lamin A/C, all of which are molecular markers of apoptosis. These results indicate that inhibition of survival signal ERK1/2, and subsequent induction of apoptosis, is a critical mechanism of angiogenesis suppression by EEBP.

The role of RACK1 as an independent prognostic indicator in human breast cancer

We have read with great interest the recent article by Cao et al. [1] in which the authors looked at the protein expression of RACK1 in human breast cancer and showed that high levels were predictive of a poor clinical outcome in vitro and in vivo. We have analyzed RACK1 mRNA expression RACK1 (primers: aaaaccatcaagctatggaa, RACK1F1actgaacctgaccg tacaacaggagacgatgataggg, RACK1Zr1) in 127 human breast cancer and in 33 non-cancerous breast tissue specimens using RT–PCR technology following RNA extraction from frozen samples. We then normalized the mRNA copy numbers for RACK1 against the epithelial marker CK19 to adjust for epithelial cellularity in the examined breast specimens. We have observed that RACK1 expression levels were higher in the normal breast tissue compared with the cancer specimens (mean levels were 136 vs. 32 in paired samples, P = 0.44) and that RACK1 mRNA levels were significantly lower in TNM3 tumours compared with TNM1 tumours (0.08 vs. 33, P = 0.04). After a median follow-up of 10 years, high levels of RACK1 mRNA expression were associated with a good clinical outcome. The mean level of expression in patients who remained disease-free was 36 compared with 2.4 in those who had systemic relapse (P = 0.042) or those who had local recurrence (mean = 3.86, P = 0.05). Furthermore, we observed significant correlations with other molecular markers of apoptosis. RACK1 is significantly correlated with DEATH-ASSOCIATED PROTEIN 3: DAP3 (r = 0.4, P \ 0.01). DAP3, is also known as MITOCHONDRIAL RIBOSOMAL PROTEIN S29; MRP S29 (Gene mapped to locus 1q21) and is known to be involved in mediating interferon-gamma (147570)-induced cell death and is a positive mediator of cell death. Dap3 may be a tumour suppressor gene subject to loss or inactivation in tumors [2]. These results have been consistent with a recent published research in which the authors showed that RACK1induced apoptosis of human colon cells by inhibiting the expression of anti-apoptotic pathways and Src activity thus leading to death of colon cancer cells [3]. Therefore, the role of RACK1 as an independent prognostic indicator in human breast cancer is still a subject of further research until new data emerge.

Abstract 3639: Cell death mechanisms associated with the carbamoylating activity of the anticancer prodrug Laromustine

Abstract The preclinical anticancer prodrug Laromustine (VNP40101M; Cloretazine) yields 2-chloroethylating and methyl carbamoylating activities upon activation in cells. While the induction of DNA damage from its chloroethylating activity is widely considered to be the primary cause of its therapeutic cytotoxicity, Laromustine's carbamoylating activity has proven critical to the drug's mechanistic profile. Methyl isocyanate, the carbamoylating species derived from Laromustine in situ, can enhance the effectiveness of DNA damaging agents, including the cogenerated chloroethylating agent. This consequence is thought to be a result of a diminishment of cellular DNA damage response. However, carbamoylating agents themselves cause acute cell death in cultured mammalian neoplastic cells, principally via apoptosis. Several overlapping cell death pathways can be induced upon exposure to Laromustine's carbamoylating activity. Using Laromustine and its analogs, the chloroethylating-only 90CE and the carbamoylating-only 101MDCE, we identified molecular markers of apoptosis via Western blot analysis and flow cytometry. Poly(ADP-ribose) polymerase (PARP) is often proteolyzed by caspase-3 in the course of an apoptotic death. We report here that Laromustine, with its carbamoylating activity, induced PARP cleavage similarly to the cytotoxic agent etoposide in HL-60 human leukemia cells. In addition, flow cytometry analyses using FITC-annexin V / propidium iodide staining revealed that the carbamoylating activity of Laromustine is responsible for substantial apoptosis in HL-60 cells at clinically relevant doses within three hours of drug treatment. However, the DNA damaging, 2-chloroethylating activity did not induce appreciable apoptosis in similar experiments. Levels of poly(ADP-ribosyl)ation and expression levels of the Bax and Bcl-2 proteins are also being investigated. Given its effects on DNA repair systems and its provocation of apoptosis, methyl isocyanate continues to demonstrate its utility to the cytotoxic action of Laromustine. Citation Format: {Authors}. {Abstract title} [abstract]. In: Proceedings of the 101st Annual Meeting of the American Association for Cancer Research; 2010 Apr 17-21; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2010;70(8 Suppl):Abstract nr 3639.

Granuloma Formation Induced by Low-Dose Chronic Silica Inhalation is Associated with an Anti-Apoptotic Response in Lewis Rats

Chronic human silicosis results primarily from continued occupational exposure to silica and exhibits a long asymptomatic latency. Similarly, continued exposure of Lewis rats to low doses of silica is known to cause delayed granuloma formation with limited lung inflammation and injury. On the other hand, intratracheal exposure to large doses of silica induces acute silicosis characterized by granuloma-like formations in the lung associated with apoptosis, severe alveolitis, and alveolar lipoproteinosis. To ascertain similarities/differences between acute and chronic silicosis, in this communication, we compared cellular and molecular changes in established rat models of acute and chronic silicosis. In Lewis rats, acute silicosis was induced by intratracheal instillation of 35 mg silica, and chronic silicosis through inhalation of aerosolized silica (6.2 mg/m3, 5 d/wk for 6 wk). Animals exposed to acute high-dose silica were sacrificed at 14 d after silica instillation while chronically silica-treated animals were sacrificed between 4 d and 28 wk after silica exposure. The lung granulomas formation in acute silicosis was associated with strong inflammation, presence of TUNEL-positive cells, and increases in caspase-3 activity and other molecular markers of apoptosis. On the other hand, lungs from chronically silica-exposed animals exhibited limited inflammation and increased expression of anti-apoptotic markers, including dramatic increases in Bcl-2 and procaspase-3, and lower caspase-3 activity. Moreover, chronic silicotic lungs were TUNEL-negative and overexpressed Bcl-3 and NF-κB-p50 but not NF-κB-p65 subunits. These results suggest that, unlike acute silicosis, chronic exposures to occupationally relevant doses of silica cause significantly lower lung inflammation and elevated expression of anti-apoptotic rather than proapoptotic markers in the lung that might result from interaction between NF-κB-p50 and Bcl-3.