Local Ducks Research Articles

The effect of supplementation perilla seeds (Perilla frutescens) in the diets on feed consumption and digestibility nutrients on ducks

This study aims to determine the digestibility of perilla seeds (Perilla frutescens) in 3 levels (0, 2.5, and 5%) in rations given to local ducks. The research material used was male Mojosari ducks (Day Old Duck) with as many as 90 tails, with an average initial body weight of 35.36 grams. The ration consists of ground corn, pollard, fine bran, soybean meal (SBM), vitamin premix, and perilla seed supplementation. Livestock was separated by three treatments, P0: 100% basal ration without supplementation of Perilla frutescens L seeds; P1: 97.5% basal ration + 2.5% supplementation of Perilla frutescens L. seeds; P2: 95% basal ration + 5% supplementation of Perilla frutescens L. seeds. Duck ducks are kept for two months. The variables observed were crude protein digestibility, crude fat, crude fiber, and organic matter. The results showed a very significant effect (P <0.05) on the digestibility of crude protein, crude fat, and crude fiber and an insignificant effect (P> 0.05) on the digestibility of organic matter and feed consumption. Supplementation of perilla seeds can increase the digestibility of fat and fiber but decreases protein digestibility.

Lead and Cadmium Residues in Commercial Poultry Eggs in West Java Indonesia

Anthropogenic contamination of heavy metals in both soil and water threatens human health through the consumption of livestock products. Important heavy metal toxins, namely lead (Pb) and cadmium (Cd) are present in livestock feed and drinking water and detected in poultry meat and eggs. This study aimed to detect Pb and Cd in poultry eggs (local farms, commercial farms, quail, and ducks) that are consumed by humans almost every day and considered a source of pollution in the environment farm. This research was exploratory research using the survey method and the samples were drawn randomly. The data were analyzed descriptively by calculating the mean of the heavy metal content of Pb and Cd in the samples studied and then compared with the Maximum Residue Limit of Pb and Cd recommended by the Food and Drug Supervisory Agency of the Republic of Indonesia No. 5/2018. The results showed that Pb content in poultry eggs exceeded the Maximum Residue Limit, which was 0.2500 mg/kg except for Pb content in duck eggs and Cd content in poultry eggs in which the samples were below the Maximum Residue Limit.

Reviu: Itik Magelang sebagai itik lokal potensial dan salah satu alternatif sumber protein hewani

The need for food will increase along with the inscrease in population. Livestock is one of the contributors to food needs in the form of protein of animal origin, including meat, eggs, and milk. Animal protein is important because of its more complete amino acid content than protein of vegetable origin. Magelang duck is one of the local ducks that has advantages over other local ducks and has the potential to be developed as laying duck, broiler duck, or dual-purpose ducks. Seeing the potential that exists, this paper aims to review the potential of Magelang ducks from various research results in order to develop the potential of local ducks. Utilization of Magelang ducks needs to be done because local ducks have an important role as a provider of animal protein for the community, especially rural areas.

Meat Fatty Acid Composition and Malondialdehyde Concentration of Dried Star Gooseberry Leaf Extract for Duck Feed

Local ducks have good potential to be developed as a producer of meat and eggs as a source of animal protein. However, compared to other poultry, duck meat has relatively high fat and cholesterol contents, which are not preferred as they may have harmful effects on health. Additionally, excessive meat fat content can also cause a rotten smell to the meat. Containing carotene, flavonoids, tannins, and antioxidants, star gooseberry (Sauropus androgynus) leaves are potential to be used a feed additive in poultry ration. This study aimed to assess the effects of the inclusion of dried star gooseberry leaf extract (DSGLE) meal in rations on the composition of fatty acids, malondialdehyde (MDA), and cholesterol of local duck meat. One-hundred local ducks were randomly allocated into 5 treatments and 5 replicates in a completely randomized experimental design. Treatments consisted of rations containing 0, 0.5, 1.0, 1.5, and 2.0% DSGLE. Measurements were taken on meat fat content, MDA contents, cholesterol level, and fatty acid composition. Results showed that treatments significantly affected meat fat content, fatty acid composition, cholesterol level, and MDA content. It was concluded that feeding ducks with DSGLE meal reduced meat fat and cholesterol levels, improved meat fatty acid composition and protected the meat from oxidative damage. This study reinforced the benefits of using phytochemicals in diets in improving the production performance and product quality of poultry animals. Results of this study uncovered another way to produce healthier duck meat containing less fat and having less off-odor.

Performance Production Based on the Type of Mating in Local Ducks

This study aims to determine the effects of the local duck mating patterns (Tegal and Magelang) on production performance based on feed consumption, feed conversion (FCR), and egg production (DDP). The research used 80 Magelang and Tegal ducks. The research is an experimental study with a completely randomized design (CRD). The research used 4 treatments and 5 replications. The number of ducks in each cross consisted of 5 (five) males and 15 (fifteen) females. P1 crossed Magelang and Magelang ducks (MM), P2 Magelang Tegal (MT), P3 Tegal Magelang (TM), and P4 Tegal and Tegal (TT) which were given the same feed in the form of concentrate feed. Ducks were kept for 3 months to observe their production performance. The results showed that there was no significant difference between the feed consumption of P1 and P3, but significantly different (P> 0.05) between P2 and P4. The highest egg production was produced by P3 followed by P1, P2, and P4, while the lowest FCR is P2 followed by P4, P3 and the highest was P1 (MM). From the research, it was concluded that the Tegal-Magelang (P3) duck crossbred had the best productivity and the most efficient use of feed compared to other cross treatments.
 Keywords: Duck cross breeding, Local Ducks, Egg production, Feed Consumption, FCR.

Egg Production, Egg Quality, and Fatty Acid Profile of Indonesian Local Ducks Fed with Turmeric, Curcuma, and Probiotic Supplementation

Indonesian local ducks are commonly raised for egg production purposes. However, the performances of these ducks are still variable and must be improved. This study investigated the effects of turmeric, curcuma, and probiotic supplementations on the egg production and quality of Indonesian local ducks, emphasizing the eggs’ fatty acid profile. Two hundred female local ducks aged 16 weeks were randomly allotted to four dietary treatments with five replicates of 10 birds. The ducks were fed a corn and rice bran-based diet containing different supplements, i.e., a diet without supplementation as the control diet, a diet supplemented with turmeric at the level of 4%, a diet supplemented with curcuma at the level of 4%, and a diet supplemented with starbio probiotics at the level of 2%. The measured data were analyzed using analysis of variance using the 13 Systat program and continued with Duncan’s Multiple Range Test. Turmeric supplementation increased egg production compared with the control, and the duck fed probiotics consumed more feed than the control. Curcuma supplementation generated the lowest feed consumption, egg production, and physical egg quality than the other treatments (p<0.05). The probiotics supplementation enhanced the blood high-density lipoprotein concentration (p<0.05). Turmeric, curcuma, and probiotics supplementations generate variable responses in egg production and egg quality, including the fatty acid profile in the eggs. Turmeric and probiotics supplementations positively impact egg production, egg quality, or unsaturated fatty acid profile in the egg. However, curcuma supplementation decreased egg production and egg quality of local ducks. Furthermore, the fatty acid profile was not influenced by these supplements. It is concluded that supplementation of turmeric at the level of 4% and probiotics at the level of 2% in the diet can increase egg production and egg quality of local duck.

Morphometrical and Histochemical study of glandular stomach (Proventriculus) in local domestic male ducks (Anase Platyrhchos)

The present work explores morphometric and histochemical foundations of the wall of proventriculus in adult domestic male ducks. To achieve this study, six healthy adult ducks were purchased from local vendors in Mosul province. All birds were sedated. Their stomachs were removed after being dissected to achieve the gross description and measurements of the proventriculus, including the length and diameter of cranial, middle, and caudal regions of the proventriculus. Small tissue pieces 6-8 mm in length from three regions of proventriculus were processed for histomorphological studies using hematoxylin and Eosin stain, combined PAS-AB pH 2.5, toluidine blue, and Masson's trichrome stains. The finding showed that the proventriculus connects with the esophagus from the cranial side and the muscular stomach from the caudal side. It was a thin elongated oval tubular organ. Histologically, the mucosa of the proventriculus revealed the presence of folds and sulci-like structures covered by simple columnar epithelium. The tunica submucosa consisted of many signs of profound and straightforward sub-mucosal glands supported by connective tissue septa and extended from the basal part of the diverged gland through the lamina propria, which was organized in a conical manner (adenomere). Tunica Muscularis appeared as a double-layer coordinated in the form of inner longitudinal and outer circular ones. Finally, serosa consists of fibrous tissue, vessels, fatty tissue, and nerve plexuses studded by the mesothelial cells. The highest thickness of the four layers of mucosal, submucosal, muscular, and serosal layers in the distal part of ‎the proventriculus. Histochemical PAS staining positively reacted with epithelial tunica mucosa and wall of proventricular glands.

Genetic Diversity and Identification of MC1R SNPs Association with Colors in Iraqi Local Ducks

The aim of the study was to reveal the variation in the polymorphisms of Melancortin 1 receptor (MC1R) gene and relationship of SNP with colors in Iraqi local duck, in addition to identifying some of molecular characteristics of this gene and identifying the differences in the amino acids of MC1R gene and their differences between the white and gray local duck lines, two local duck lines were selected with 14 white and 14 gray birds, was chosen a region with size 515 bp MC1R gene, where designed the primer of; (Forward primer 5’-, GCTCTTCATGCTGCTGATGG -3, and Reverse primer 5’-, GGCAGGTGACGATGAGGATG -3) by relying on the reference copy under the accession number KU234624.1, the results with PCR technique and electrophoresis proved success of amplification process and fragment was 515 bp. After analyzing sequence of nitrogenous bases for the studied fragment for MC1R gene, two changes were observed in nitrogenous bases, which is known as single nucleotide formation (SNP). The two sites for studied fragment recorded with accession numbers for our study are LC480442.55G> A and LC480443.328C> T. It was observed that the first change site did not lead to any change in the amino acid (valine) at the 126th site of peptide chain of MC1R gene, while the second site resulted in an occurrence change in the amino acid arginine to cysteine at position 217 of peptide chain of the gene. The results showed, it was found that sites of changes in nitrogenous bases were found in both white and gray lines of local ducks, while the study did not show any correlation between these sites with the color of ducks. The results of some molecular tests of the MC1R gene showed that rate of change of nitrogenous bases and the genetic variation for studied frgament is very small when comparing the haplotypes and phylogenetic tree of the animals in this study, and the animals from other countries such as China, it was observed that local ducks possess same nucleotide sequence, which means possibility of dependence origin of local duck of Chinese ducks. The fragments obtained in this study for MC1R gene were recorded at global gene bank sites in NCBI, EMBL and DDBJ under independent accession numbers for our Iraqi local animals which LC480442, LC480443, LC480444, and LC480445.

A survey of Muscovy duck production in rural areas of Tra Vinh Province, Vietnam

In case of livestock development in the rural areas of Tra Vinh province of Vietnam, Muscovy duck breeds are diversified by importing and breeding, which is more valuable for social and economic benefits. A total of 7,921 Muscovy ducks were observed to collect data for this survey to identify the current status of its production, feeding, and performance. Farmers, who owned at least 30 ducks, were interviewed to analyze data ownership, feeding, and growth performance of three breeds relating to the Muscovy including local Muscovy ducks (LMDs), France Muscovy duck (FMDs), and Crossbred Muscovy ducks (CMDs). The findings indicated that most farmers kept a small duck herd of fewer than 100 heads per householder, and the majority of Muscovy duck was LMDs. Farmers fed them local feed resources, with low nutritive diets (CP: 7.35 – 12.0 % and ME: 11.44 - 11.83 MJ/kg DM). A small number of farmers used a concentrate feed (CP: 16.5-19.3; ME: 11.96-12.69 MJ/kg DM) for supple-mentation with the daily weight gain was 16.7 g for LMDs and 22.7 g for CMDs, whilw the FMDs was fed a better quality of concentrate and gave the daily gain of 25.7 g.

The Synthesis and Physicochemical Characterization of Hydroxyapatite (HAp) from Local Duck Egg Shells

&lt;p&gt;Hydroxyapatite (HAp) Biocheramics was the main component of remineralisation agent to the hard tissues; it is commonly synthesized from compounds rich with calcium. One of the compounds recommended as a HAp source was eggshells. This study aimed to synthesize the HAp from local duck eggshells containing Calcium 0,8631 ± 0,0015g/g and Phosphor 0,3118 ± 0,0016g/g. The synthesis process of HAp by Base Precipitation methods showed rendement 85,06 ± 1,0135%. The Physicochemical characterization to the HAp showed the Calcium contains 0,4760 ± 0,0027g/g; Phosphor 0,0897 ± 0,0023g/g; Porosity 82,0106 ± 0,4484%; Biodegradability 5,3506 ± 0,0295%; and Swelling ability 5,7678 ± 0,1897%. The results concluded that the local duck egg shells were recommended as HAp sources. Based on characterisation results, the HAp made from it was potentially applied as a remineralization agent.&lt;/p&gt;

Genetic diversity of Central Javanese duck (Indonesia) based on Inter Simple Sequence Repeat markers

Abstract. Susanti R, Kartikasari AD, Sasi FA, Arlinda DD. 2022. Genetic diversity of Central Javanese duck (Indonesia) based on Inter Simple Sequence Repeat markers. Biodiversitas 23: 1807-1813. Genetic resources of local livestock need to be documented and conserved to prevent genetic erosion of the germplasm. This study aimed to determine the genetic diversity of domestic ducks (Anas platyrhynchos domesticus) in Central Java, Indonesia, based on Inter Simple Sequence Repeat (ISSR) markers. There were seven types of Central Javanese ducks used in this research. DNA was extracted from feathers samples. To give rise to ISSR profile of duck DNA, 5 different ISSR markers were used. Annealing temperature used in PCR was the result of the optimization. The ISSR-PCR results showed that all primers (100%) were polymorphic. From a total of five ISSR primers, resulted in 44 obvious bands in all duck samples, with 41 (91.78%) bands being polymorphic. The quantity of alleles was numerous from 7-14 polymorphic loci, the mean quantity of alleles according to locus was 8.8, and the average PIC score for the Central Javanese duck was 0.777. The relationship investigation showed that the Central Javanese local duck was clustered into two primary offshoots, one heading to Pengging duck breeds and another one consisting of all other Central Javanese local duck. The genetic diversity among Central Javanese local duck based on ISSR primer was high. The ISSR loci were polymorphic for Central Javanese duck and may be useful for study of genetic diversity and genome evolution of Central Javanese ducks in the future.

Characterization of duck germplasm of eastern hill and plateau region of Jharkhand

Information about phenotypic characteristics is a basic need in animal genetic resource conservation and improvement. Phenotypic characteristics of Jharkhand ducks from six districts (Palamu, Gadhwa, Latehar, Lohardaga, Khuti, and Simdega) were studied. Data on morphological and morphometric traits were analyzed. The results revealed that the predominant plumage colours of the head, neck, breast, wings and tails were black (56.25%) in drake, and black and white mix (65.33%) in duck; white and black/brown mix (62.50%) in drake, and white (79.33%) in duck; brown (41.25%) in drake, and white and black/brown mix (52.67%) in duck; black/brown and white mix (43.75%) in drake and duck (74.67%); black in drake (75%) and duck (90%) respectively. The dominant bill colour in drake was greenish black (56.25%) followed by orange (25%) and duck bill colour was black (58.67%) followed by orange (22%), whereas dominant eye colour was brown in both the sexes. The predominant shank and web colour were orange (65.0%) in drake and duck (68.0%) respectively. The Jharkhand ducks are unique in their morphological features with attractive black and white plumage colour pattern. The ducks are well acclimatised to local agro-climatic conditions with less input from duck farmers. The hatching and brooding process are natural. The average egg production was 66.92±2.00 eggs. The average adult body weights of drake and ducks were 1.64±23.19 and 1.51±30.09 kg, respectively. Variations were observed in qualitative traits. The observed phenotypic diversity in Jharkhand local ducks could be useful in designing breeding programs and selection.

Efektivitas Sari Belimbing Wuluh terhadap Daya Ikat Air dan Susut Masak Daging Paha Itik Magelang

Duck is a type of poultry that can be consumed as a new option other than chicken meat. Several types of local ducks can be utilized their potential for community consumption, one of which is Magelang duck. Duck meat is one of the foodstuffs of livestock origin that contains nutrients that are good for the human body. The weakness of meat with a high nutritional content that can cause meat susceptible to contamination by decaying microorganisms. Efforts to maintain meat quality are to prevent microbial contamination of Magelang duck meat by using bilimbi fruit liquid (Averrhoa bilimbi L.) to maintain the quality of duck meat. This study aims to determine the efficiency using bilimbi fruit liquid with different concentrations on the value of water holding capacity and cooking loss of Magelang duck thigh meat. The experiment plan used in this study was a Completely Randomized Experimental Design (CRD) with 4 treatments differences concentration of using bilimbi fruit liquid (0, 20, 40, 60%) and 5 replays with immersion for 30 minutes. The data obtained was analyzed with a variety analysis (ANOVA) and the apparent differences between treatments were analyzed with the Duncan Multiple Range Test (DMRT) advanced test. The results showed that soaking magelang duck thigh meat up to a concentration of 60% of using bilimbi fruit liquid for 30 minutes did not give a noticeable influence or has not been able to increase DIA and decrease cooking. The range of DIA values in this study is 40.67˗44.93% and cooked stacking 47.19–52.37%.&#x0D; Keywords: magelang duck, water holding capacity, starfruit juice, cooking loss.

EFFECTS OF THE INCLUSION OF STAR GOOSEBERRY DRIED LEAF EXTRACT IN RATION ON EGG ORGANOLEPTIC VALUES OF LOCAL DUCK

Duck egg is known to have an unpleasant fishy odor which often becomes a factor reducing its acceptance in public. This odor is resulted from lipid oxidation which can be avoided by using an antioxidant. This study was aimed at assessing the effects of the inclusion of star gooseberry (Sauropus androgynus) dried leaf extract in ration on egg organoleptic quality of local duck. The study was conducted in a completely randomized design with 4 treatments and 4 replicates. Sensory test by 60 semi-trained panelists and hedonic quality and hedonic tests were conducted. Data were subjected to a Kruskal-Wallis test. Results showed that treatments gave significant effects (P &lt;0.05) on aroma (hedonic), yolk color, and aroma (hedonic quality). It was concluded that the inclusion of star gooseberry dried leaf extract by 1,5% in ration improved the quality of egg yolk color, egg aroma, and consumers’ preference. A further study on the effects of DSGLE on meat quality and protein digestibility in ducks was recommended.

Comparison of carcass and non-carcass characteristics of Local and Pekin ducks

The purpose of this study was to evaluate carcass and non-carcass characteristics of local ducks. The research material was carcasses of five local male ducks aged 24 weeks (relative weight of about 1220 g) and five male Pekin ducks of 9 weeks of age (relative weight of about 1440 g) which were kept in the duck cage at the laboratory of Breeding and Genetics, Faculty of Animal Science, Hasanuddin University, Indonesia using intensive housing systems and commercial feed. The research method was all ducks were fasted and rested for 8 hours, slaughtered, carcasses, and parameters analyzed. Parameters measured were weight and percentage of carcass traits (wings, dorsal, thighs, breast, and neck), weight and percentage of non-carcass traits (head, shank, kidney, heart, trachea, esophagus, gizzard, liver, intestine, feathers), three types of weight (live weight, slaughter weight, and carcass weight), percentage of the total carcass, and meat bone ratio (thigh and breast). The results showed that there were no significant differences in all carcass and non-carcass parameters between local ducks and Pekin ducks except for non-carcass parameters, namely head, gizzard, shank, intestine, heart, and trachea. At different ages, Pekin ducks and local ducks showed similar carcass characteristics. These results show that the growth rate of Pekin ducks is faster than that of local ducks. These results become one of the bases and references that local ducks still need a breeding program for improving carcass growth to reach optimum carcass characteristics.

Effects of rations containing leubiem fish (Chanthidermis maculatus) waste and phytogenic suplementation on local ducks performance in the starter phase

This study aims to examine the potential use of leubiem fish (Chanthidermis maculatus) waste and phytogenic supplementation on ration, in order to increase the performance of local ducks in the starter phase. This study used 100 local ducks aged 1 week old, and maintained them until 8 weeks old. The ducks were placed in 5 treatments and 4 replications groups (5 ducks / repetition). The study was conducted experimentally, using a Completely Randomized Design (CRD), consisting of 5 ration treatments, including: R1 (control); R2 (basal ration containing leubiem fish skin flour 10% + phytogenic 0.5%); R3 (basal ration containing leubiem fish head flour 10% + phytogenic 0.5%); R4 (basal ration containing leubiem fish bone flour 10% + phytogenic 0.5%) and R5 (basal ration containing leubiem fish gill flour + phytogenic 0.5%). Observed variables were feed consumption, body weight gain, final weight, feed conversion, and local duck mortality in the starter phase. The data obtained were both analyzed using Analysis of Variance (ANOVA) and Duncan’s multiple range test. The results showed that the use of leubiem fish waste and phytogenic supplementation in the ration both increased the performance of local ducks in the starter phase and had a significant effect (p <0.05) on ration consumption, weight gain, and final weight. However, they had no significant effect on feed conversion and local duck mortality in the starter phase. It was concluded that the use of leubiem fish (10% bone meal) and phytogenic supplementation 0.5% in the ration was able to increase body weight gain, and the final weight of the starter phase local ducks (aged 1-8 weeks).

Breeding Strategy of Local Muscovy to Support the Development of Meat Type Duck Industry

&lt;p&gt;Muscovy duck is one of the genetic resources of waterfowl that spreads almost all over Indonesia. Muscovy duck is classified as meat-producer waterfowl, because of its relatively large body weight and better meat quality compared to other waterfowl. Therefore, cross breeding between Muscovy and ducks were often conducted by farmers to produce offspring with large body weight in order to anticipate the higher demand for duck meat. If this crossing pattern has been widely adopted by breeders, it will require a larger number of Muscovy duck. Whereas, currently the population of Muscovy is relatively low and no breeding system exists both at the community farm level or industrial level. Therefore, a development program of local Muscovy duck, especially its breeding program needs to be done immediately. As an information material to facilitate the preparation of the program, this paper describes factors that affect the breeding program including production performance and reproduction, as well as the breeding strategy of Muscovy duck as candidates of male line to form special type of meat type ducks through 3 groups of livestock breeds in the shape of a conical triangle at the top. The top position was the pure stock (nucleus), the middle was the parent stock (multiplier) and the bottom was the commercial stock. The genetic quality of livestock flows from the top position to the bottom and cannot be the other way around, because the breeding system is closed in the pure stock (nucleus).&lt;/p&gt;

Production performance and meat quality of local ducks fed rations containing extract of torch ginger (Etlingera elatior) flowers and betel (Piper Betle linn) leaves

Compared to chickens, ducks still have low productivity and other limitations. One of the causes of these problems might be attributed to the off-odor found in duck meat. Therefore, production performance and meat quality of ducks need to be improved. The inclusion of extracts of betel (Piper betle Linn) leaves and torch ginger (Etlingera elatior) flowers wereas done to improve production performance and meat quality of local ducks. This study was aimed at assessing the effects of the inclusion of betel leaves and torch ginger flowers in the basal rations on production performance and meat quality of local ducks in the growing phase. A completely randomized factorial design in 4 x 4 with three replicates was used. The first factor consisted of four levels of torch ginger flower solution, namely 0, 2.5, 5, and 7.5%. The second factor consisted of four levels of betel leaf solution, namely 0, 2.5, 5, and 7.5%. Results showed that no significant differences (P&gt;0.05) were found in body weight gain, feed intake, feed conversion, mortality rate and meat quality (pH, water holding capacity, tenderness and cooking loss). It was concluded that the inclusion of extract of betel leaves and torch ginger flowers did not improve production performance and meat quality of male local ducks.

Sarcocystis rileyi (Apicomplexa) in Anas platyrhynchos in Europe with a potential for spread.

Four specimens of mallard (Anas platyrhynchos) shot by local hunters (December 2020 to January 2021 along the eastern coastline of the island of Bornholm in the Baltic Sea) were diagnosed with a heavy load of sarcocysts in the musculature. Morphometric and molecular diagnosis based on rDNA (18 S, ITS1, 28 S) of parasites recovered from two of the birds revealed the causative pathogen to be Sarcocystis rileyi. We further present novel sequences for the entire 5.8 S and ITS2 for this species. Elongate cysts (mean length 5.25 (SD 0.6) mm, width 1.37 (SD 0.2) mm) were recorded in all parts of the striated skeletal musculature of the birds. The main part (72%) of the 2585 cysts in one female mallard was located in the outer superficial pectoral musculature, with 11% in the inner pectoral musculature. Minor but significant parts were found in the dorsal, ventral abdominal, neck and head, legs, hand and arm (wing) musculature. No cysts were found in the smooth musculature. Each cyst contained a median of 3.2 mio bradyzoites indicating that more than 8 billion bradyzoites are available for infection of one or more predators/scavengers ingesting the bird. Bradyzoites (median length 13.5 μm (range 12.1–14.5) and median width 2.66 μm (range 2.1–3.3)) were highly resistant to proteinase treatment, which secures the passage through the stomach of the predator to its intestine where wall penetration takes place. One of the birds was ringed (tagged) in Sweden Island Øland in the Baltic Sea two years before being shot. This is documenting immigration of mallards from northern locations. The parasite species was originally described in North America in 1893 and was commonly reported in this region during the 20th century but not in Europe. Recent cases from Norway, Finland, Lithuania, Poland, UK and Hungary suggest that the species may be spreading geographically. Experienced duck hunters with a 40 years record of hunting on the island reported that this type of infection unprecedented. The final host is reported to be canines (fox, raccoon dog), skunk and mustelids, including ermines and American mink. Presence of these hosts in Europe may allow establishment of the life cycle and further colonization of the local duck populations which calls for implementation of a survey program in Europe.

The effect of various vegetable oils in diets on the percentage of internal organ weights in local male ducks

This study aims to determine the effect of vegetable oils varieties in diets on the percentage of internal organ weights in 9 weeks old local male ducks. It was conducted using a completely randomized design (CRD) in a unidirectional pattern with 4 treatments and 6 replications, consisting of 6 ducks each. The treatments used include; P1: (96% basal ration + 4% palm oil); P2: (96% basal ration + 4% canola oil); P3: (96% basal ration + 4% coconut oil) and P4: (96% basal ration + 4% soybean oil). Furthermore, the data were analyzed using the one way analysis of variance (ANOVA) while the, Duncan’s multiple range test (DMRT) was used to examine significant differences among treatments. The results showed that the percentage of intestinal weights indicated significant results (P < 0.05), while the percentage of heart weights, gizzard weight, intestine length, and percentage of caecum weight were not significant (P > 0.05). Based on the results, the addition of vegetable oils up to level 4% in the ration affect the percentage of intestinal weight. However, it had no effect on the percentage of internal organ weight and intestinal length.