Local Conformational Changes Research Articles

3D genome organization in the epithelial-mesenchymal transition spectrum

BackgroundThe plasticity along the epithelial-mesenchymal transition (EMT) spectrum has been shown to be regulated by various epigenetic repertoires. Emerging evidence of local chromatin conformation changes suggests that regulation of EMT may occur at a higher order of three-dimensional genome level.ResultsWe perform Hi-C analysis and combine ChIP-seq data across cancer cell lines representing different EMT states. We demonstrate that the epithelial and mesenchymal genes are regulated distinctively. We find that EMT genes are regulated within their topologically associated domains (TADs), with only a subset of mesenchymal genes being influenced by A/B compartment switches, indicating topological remodeling is required in the transcriptional regulation of these genes. At the TAD level, epithelial and mesenchymal genes are associated with different regulatory trajectories. The epithelial gene-residing TADs are enriched with H3K27me3 marks in the mesenchymal-like states. The mesenchymal gene-residing TADs, which do not show enrichment of H3K27me3 in epithelial-like states, exhibit increased interaction frequencies with regulatory elements in the mesenchymal-like states.ConclusionsWe propose a novel workflow coupling immunofluorescence and dielectrophoresis to unravel EMT heterogeneity at single-cell resolution. The predicted three-dimensional structures of chromosome 10, harboring Vimentin, identify cell clusters of different states. Our results pioneer a novel avenue to decipher the complexities underlying the regulation of EMT and may infer the barriers of plasticity in the 3D genome context.

The Second Class of Tetrahydrofolate (THF-II) Riboswitches Recognizes the Tetrahydrofolic Acid Ligand via Local Conformation Changes.

Riboswitches are regulatory noncoding RNAs found in bacteria, fungi and plants, that modulate gene expressions through structural changes in response to ligand binding. Understanding how ligands interact with riboswitches in solution can shed light on the molecular mechanisms of this ancient regulators. Previous studies showed that riboswitches undergo global conformation changes in response to ligand binding to relay information. Here, we report conformation switching models of the recently discovered tetrahydrofolic acid-responsive second class of tetrahydrofolate (THF-II) riboswitches in response to ligand binding. Using a combination of selective 2′-hydroxyl acylation, analyzed by primer extension (SHAPE) assay, 3D modeling and small-angle X-ray scattering (SAXS), we found that the ligand specifically recognizes and reshapes the THF-II riboswitch loop regions, but does not affect the stability of the P3 helix. Our results show that the THF-II riboswitch undergoes only local conformation changes in response to ligand binding, rearranging the Loop1-P3-Loop2 region and rotating Loop1 from a ~120° angle to a ~75° angle. This distinct conformation changes suggest a unique regulatory mechanism of the THF-II riboswitch, previously unseen in other riboswitches. Our findings may contribute to the fields of RNA sensors and drug design.

Doxorubicin impacts chromatin binding of HMGB1, Histone H1 and retinoic acid receptor

Doxorubicin (Dox), a widely used anticancer DNA-binding drug, affects chromatin in multiple ways, and these effects contribute to both its efficacy and its dose-limiting side effects, especially cardiotoxicity. Here, we studied the effects of Dox on the chromatin binding of the architectural proteins high mobility group B1 (HMGB1) and the linker histone H1, and the transcription factor retinoic acid receptor (RARα) by fluorescence recovery after photobleaching (FRAP) and fluorescence correlation spectroscopy (FCS) in live cells. At lower doses, Dox increased the binding of HMGB1 to DNA while decreasing the binding of the linker histone H1. At higher doses that correspond to the peak plasma concentrations achieved during chemotherapy, Dox reduced the binding of HMGB1 as well. This biphasic effect is interpreted in terms of a hierarchy of competition between the ligands involved and Dox-induced local conformational changes of nucleosome-free DNA. Combined, FRAP and FCS mobility data suggest that Dox decreases the overall binding of RARα to DNA, an effect that was only partially overcome by agonist binding. The intertwined interactions described are likely to contribute to both the effects and side effects of Dox.

Quinolinate Synthase: An Example of the Roles of the Second and Outer Coordination Spheres in Enzyme Catalysis.

The activation energy barrier of biochemical reactions is normally lowered by an enzyme catalyst, which directly helps the weakening of the bond(s) to be broken. In many metalloenzymes, this is a first coordination sphere effect. Besides having a direct catalytic action, enzymes can fix their reactive groups and substrates so that they are optimally positioned and also modify the water activity in the system. They can either activate substrates prior to their reaction or bind preactivated substrates, thereby drastically reducing local entropic effects. The latter type is well represented by some bisubstrate reactions, where they have been defined as "entropic traps". These can be described as "second coordination sphere" processes, but enzymes can also control the reactivity beyond this point through local conformational changes belonging to an "outer coordinate sphere" that can be modulated by substrate binding. We have chosen the [4Fe-4S] cluster-dependent enzyme quinolinate synthase to illustrate each one of these processes. In addition, this very old metalloenzyme shows low in vitro substrate binding specificity, atypical reactivity that produces dead-end products, and a unique modulation of its active site volume.

Thienoguanosine brightness in DNA duplexes is governed by the localization of its ππ* excitation in the lowest energy absorption band

Thienoguanosine (thG) is an isomorphic fluorescent guanosine (G) surrogate, which almost perfectly mimics the natural G in DNA duplexes and may therefore be used to sensitively investigate for example protein-induced local conformational changes. To fully exploit the information given by the probe, we carefully re-investigated the thG spectroscopic properties in 12-bp duplexes, when the Set and Ring Associated (SRA) domain of UHRF1 flips its 5′ flanking methylcytosine (mC). The SRA-induced flipping of mC was found to strongly increase the fluorescence intensity of thG, but this increase was much larger when thG was flanked in 3′ by a C residue as compared to an A residue. Surprisingly, the quantum yield and fluorescence lifetime values of thG were nearly constant, regardless of the presence of SRA and the nature of the 3′ flanking residue, suggesting that the differences in fluorescence intensities might be related to changes in absorption properties. We evidenced that thG lowest energy absorption band in the duplexes can be deconvoluted into two bands peaking at ∼350 nm and ∼310 nm, respectively red-shifted and blue-shifted, compared to the spectrum of thG monomer. Using quantum mechanical calculations, we attributed the former to a nearly pure ππ* excitation localized on thG and the latter to excited states with charge transfer character. The amplitude of thG red-shifted band strongly increased when its 3′ flanking C residue was replaced by an A residue in the free duplex, or when its 5′ flanking mC residue was flipped by SRA. As only the species associated with the red-shifted band were found to be emissive, the highly unusual finding of this work is that the brightness of thG in free duplexes as well as its changes on SRA-induced mC flipping almost entirely depend on the relative population and/or absorption coefficient of the red-shifted absorbing species.

A Biophysical Analysis on the Effect of Ligands on Fluorescently Active G‐quadruplex Structures

The formation of G‐quadruplex (GQ), a non‐canonical nucleic acid secondary structure, can inhibit the elevated telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most of the biochemical processes involving GQs involve local conformational changes of GQs at the guanine tetrad (G4) level. Previously we developed a method to study the local conformations of individual G4 layers in GQs that uses 6‐methylisoxanthopterine (6MI), a Circular Dichroism (CD)‐active fluorescent base analogue of guanine. Using this method here we explore the local conformational changes of individual G4 layers in GQ‐drug interactions. Experiments were performed with human telomeric 22AG sequence (5′‐AGGGTTAGGGTTAGGGTTAGGG‐3′) where guanines at the positions 3,9,15 and 21 were site‐specifically replaced by 6MI monomers. The CD and fluorescence properties of the GQ structures with and without the ligands were characterized under various conditions. Thermal denaturation studies showed that properly positioned 6MI monomers and dimers in a GQ forming sequence can form stable GQs with CD‐active fluorescent G4 layers. The local conformation of individual fluorescent G4 layers in the GQ structure was then monitored by following the fluorescence intensity and circular dichroism changes of the incorporated probes. The results showed the interaction of ligands with the fluorescent G4 layer varied depending on the functional groups as well as the bulkiness of the ligand suggesting that there are multiple ways of G4‐ligand interaction.

Impact of protein conformational diversity on AlphaFold predictions.

After the outstanding breakthrough of AlphaFold in predicting protein 3D models, new questions appeared and remain unanswered. The ensemble nature of proteins, for example, challenges the structural prediction methods because the models should represent a set of conformers instead of single structures. The evolutionary and structural features captured by effective deep learning techniques may unveil the information to generate several diverse conformations from a single sequence. Here, we address the performance of AlphaFold2 predictions obtained through ColabFold under this ensemble paradigm. Using a curated collection of apo-holo pairs of conformers, we found that AlphaFold2 predicts the holo form of a protein in ∼70% of the cases, being unable to reproduce the observed conformational diversity with the same error for both conformers. More importantly, we found that AlphaFold2's performance worsens with the increasing conformational diversity of the studied protein. This impairment is related to the heterogeneity in the degree of conformational diversity found between different members of the homologous family of the protein under study. Finally, we found that main-chain flexibility associated with apo-holo pairs of conformers negatively correlates with the predicted local model quality score plDDT, indicating that plDDT values in a single 3D model could be used to infer local conformational changes linked to ligand binding transitions. Data and code used in this manuscript are publicly available at https://gitlab.com/sbgunq/publications/af2confdiv-oct2021. Supplementary data are available at Bioinformatics online.

Atomic and Specificity Details of Mucin 1 O-Glycosylation Process by Multiple Polypeptide GalNAc-Transferase Isoforms Unveiled by NMR and Molecular Modeling.

The large family of polypeptide GalNAc-transferases (GalNAc-Ts) controls with precision how GalNAc O-glycans are added in the tandem repeat regions of mucins (e.g., MUC1). However, the structural features behind the creation of well-defined and clustered patterns of O-glycans in mucins are poorly understood. In this context, herein, we disclose the full process of MUC1 O-glycosylation by GalNAc-T2/T3/T4 isoforms by NMR spectroscopy assisted by molecular modeling protocols. By using MUC1, with four tandem repeat domains as a substrate, we confirmed the glycosylation preferences of different GalNAc-Ts isoforms and highlighted the importance of the lectin domain in the glycosylation site selection after the addition of the first GalNAc residue. In a glycosylated substrate, with yet multiple acceptor sites, the lectin domain contributes to orientate acceptor sites to the catalytic domain. Our experiments suggest that during this process, neighboring tandem repeats are critical for further glycosylation of acceptor sites by GalNAc-T2/T4 in a lectin-assisted manner. Our studies also show local conformational changes in the peptide backbone during incorporation of GalNAc residues, which might explain GalNAc-T2/T3/T4 fine specificities toward the MUC1 substrate. Interestingly, we postulate that a specific salt-bridge and the inverse γ-turn conformation of the PDTRP sequence in MUC1 are the main structural motifs behind the GalNAc-T4 specificity toward this region. In addition, in-cell analysis shows that the GalNAc-T4 isoform is the only isoform glycosylating the Thr of the immunogenic epitope PDTRP in vivo, which highlights the relevance of GalNAc-T4 in the glycosylation of this epitope. Finally, the NMR methodology established herein can be extended to other glycosyltransferases, such as C1GalT1 and ST6GalNAc-I, to determine the specificity toward complex mucin acceptor substrates.

Biomimetic ion nanochannels for sensing umami substances

Umami is one of the basic taste sensing, and represents the recognition of N-containing compounds capable of evaluating the nutritious contents of food. Although several sensors have been developed, the assessment of umami intensity remains challenging due to the limitations of sensor specificity, sensitivity, and performance stability. Here we present a biomimetic conical nanochannels system integrated with Venus flytrap (VFT) domain from human umami receptor T1R1 subunit to meet the concern. By taking advantage of sensitive transmembrane ionic flux change, the functional nanochannels could precisely distinguish umami substances from other tastants. Detailed mechanism analysis reveals that specific binding between T1R1 and umami substances triggers local conformation change and surface charge redistribution of the protein, which modulates the ionic current. This study initiates the application of nanochannel device in taste perception, which could help to disclose umami perception mechanism and screen new umami substances.

Understanding the conformational polymorphism of nucleic acids using fluorescent base analogues

The formation of G-quadruplex (GQ), a non-canonical nucleic acid secondary structure, can inhibit the elevated telomerase activity that is common in most cancers. The global structure and the thermal stability of the GQs are usually evaluated by spectroscopic methods and thermal denaturation properties. However, most of the biochemical processes involving GQs involve local conformational changes of GQs at the guanine tetrad (G4) level. These local conformational changes of individual G4 layers during protein and drug interactions have not yet been explored in detail because the spectroscopic signals of these layers are concealed in the total signal of GQ.

Noncoding genetic variation in GATA3 increases acute lymphoblastic leukemia risk through local and global changes in chromatin conformation.

Inherited noncoding genetic variants confer significant disease susceptibility to childhood acute lymphoblastic leukemia (ALL) but the molecular processes linking germline polymorphisms with somatic lesions in this cancer are poorly understood. Through targeted sequencing in 5,008 patients, we identified a key regulatory germline variant in GATA3 associated with Philadelphia chromosome-like ALL (Ph-like ALL). Using CRISPR-Cas9 editing and samples from patients with Ph-like ALL, we showed that this variant activated a strong enhancer that upregulated GATA3 transcription. This, in turn, reshaped global chromatin accessibility and three-dimensional genome organization, including regions proximal to the ALL oncogene CRLF2. Finally, we showed that GATA3 directly regulated CRLF2 and potentiated the JAK-STAT oncogenic effects during leukemogenesis. Taken together, we provide evidence for a distinct mechanism by which a germline noncoding variant contributes to oncogene activation, epigenetic regulation and three-dimensional genome reprogramming.

Increased selectivity of sodium deoxycholate to around Tryptophan213 in bovine serum albumin upon micellization as revealed by singular value decomposition for excitation emission matrix

In the present study, we investigated the effect of bile salts (sodium deoxycholate, NaDC) on the conformation of a globular protein (bovine serum albumin, BSA). The two Tryptophan (Trp) residues of BSA and the fluorescence energy of NaDC are in a three-way relationship, and singular value decomposition (SVD) was used to separate each element in the fluorescence spectra. SVD was used to separate the elements in the fluorescence spectra. SVD showed that NaDC had a particularly large effect on the microenvironment around Trp213 and that micellar NaDC enhanced the selectivity for Trp213. In addition, the Stern-Volmer plots of the warfarin (WAR) specific domain (domain I) and ketoprofen (KP) specific domain (domain II) in the presence and absence of NaDC showed that the effect of NaDC was selective for domain II, where Trp213 is located. These results indicate that NaDC induces a localized and selective conformational change in BSA, and that the selectivity varies depending on the aggregation state of NaDC.

Change in local conformation of polymer chains at film surface attached to solid surface.

Adhesion is a molecular event where polymer chains contact with a material surface to form an interfacial layer. To obtain a better understanding of the adhesion on a molecular scale, we herein examined the conformational change of polystyrene (PS) chains at the film surface after contacting with hydrophobic or hydrophilic surfaces using sum-frequency generation (SFG) spectroscopy. Chains altered their local conformations with a quartz surface more quickly than a hydrophobic alkyl-functionalized one. A full-atomistic molecular dynamics simulation showed that these results, which were coupled with the contact process of PS chains with the solid surface, could be explained in terms of the Coulomb interaction between them.

Prediction of protein pK a with representation learning.

The behavior of proteins is closely related to the protonation states of the residues. Therefore, prediction and measurement of pKa are essential to understand the basic functions of proteins. In this work, we develop a new empirical scheme for protein pKa prediction that is based on deep representation learning. It combines machine learning with atomic environment vector (AEV) and learned quantum mechanical representation from ANI-2x neural network potential (J. Chem. Theory Comput. 2020, 16, 4192). The scheme requires only the coordinate information of a protein as the input and separately estimates the pKa for all five titratable amino acid types. The accuracy of the approach was analyzed with both cross-validation and an external test set of proteins. Obtained results were compared with the widely used empirical approach PROPKA. The new empirical model provides accuracy with MAEs below 0.5 for all amino acid types. It surpasses the accuracy of PROPKA and performs significantly better than the null model. Our model is also sensitive to the local conformational changes and molecular interactions.

Use of Site-Directed Spin Labeling EPR Spectroscopy to Study Protein-LPS Interactions.

Site-directed spin labeling EPR (electron paramagnetic resonance) spectroscopy is a technique used to identify the local conformational changes at a specific residue of interest within a purified protein in response to a ligand. Here, we describe the site-directed spin labeling EPR spectroscopy methodology to monitor changes in the side-chain motion in soluble lipopolysaccharide transport proteins upon the addition of lipopolysaccharide (LPS). A comparison of the spectral overlays of the spin-labeled protein in the absence and presence of LPS provides a qualitative visualization of how LPS binding affects the motion of each spin-labeled site tested within the protein. No change in the spectral lineshapes of a spin-labeled protein in the absence and presence of LPS indicates that the site is not affected by LPS binding, while differences in the spectral lineshapes indicate that LPS does affect the mobility of the spin label side chain within the protein structure. This is a powerful readout of conformational changes at specific residues of interest that can be used to identify a specific site as a reporter of changes induced by ligand binding and to map out the effects of ligand binding through an array of reporter sites within a protein. With the use of AquaStar tubing, protein concentrations as low as 2μM allow for up to a 100-fold excess of LPS. This methodology may also be applied to other protein-ligand or protein-protein interactions with minor adaptations.

Molecular insights on the conformational dynamics of a P76C mutant of human cytochrome c and the enhancement on its peroxidase activity

In apoptotic pathway, the interaction of Cytochrome c (Cytc) with cardiolipin in vivo is a key process to induce peroxidase activity of Cytc and trigger the release of Cytc in the inner mitochondria into cytosol. The peroxidase active form of Cytc occurs due to local conformational changes that support the opening of the heme crevice and the loss of an axial ligand between Met80 and heme Fe. Structural adjustments at the Ω-loop segments of Cytc are required for such process. To study the role of the distal Ω-loop segments comprising residues 71–85 in human Cytc (hCytc), we investigated a cysteine mutation at Pro76, one of the highly conserved residues in this loop. The effect of P76C mutant was explored by the combination of experimental characterizations and molecular dynamics (MD) simulations. The peroxidase activity of the P76C mutant was found to be significantly increased by ∼13 folds relative to the wild type. Experimental data on global denaturation, alkaline transition, heme bleaching, and spin-labeling Electron Spin Resonance were in good agreement with the enhancement of peroxidase activity. The MD results of hCytc in the hexacoordinate form suggest the important changes in P76C mutant occurred due to the unfolding at the central Ω-loop (residues 40–57), and the weakening of H-bond between Tyr67 and Met80. Whereas the experimental data implied that the P76C mutant tend to be in equilibrium between the pentacoordinate and hexacoordinate forms, the MD and experimental information are complementary and were used to support the mechanisms of peroxidase active form of hCytc.

Communication pathways bridge local and global conformations in an IgG4 antibody

The affinity of an antibody for its antigen is primarily determined by the specific sequence and structural arrangement of the complementarity-determining regions (CDRs). Recent evidence, however, points toward a nontrivial relation between the CDR and distal sites: variations in the binding strengths have been observed upon mutating residues separated from the paratope by several nanometers, thus suggesting the existence of a communication network within antibodies, whose extension and relevance might be deeper than insofar expected. In this work, we test this hypothesis by means of molecular dynamics (MD) simulations of the IgG4 monoclonal antibody pembrolizumab, an approved drug that targets the programmed cell death protein 1 (PD-1). The molecule is simulated in both the apo and holo states, totalling 4 μs of MD trajectory. The analysis of these simulations shows that the bound antibody explores a restricted range of conformations with respect to the apo one, and that the global conformation of the molecule correlates with that of the CDR. These results support the hypothesis that pembrolizumab featues a multi-scale hierarchy of intertwined global and local conformational changes. The analysis pipeline developed in this work is general, and it can help shed further light on the mechanistic aspects of antibody function.

A Free-Energy Landscape Analysis of Calmodulin Obtained from an NMR Data-Utilized Multi-Scale Divide-and-Conquer Molecular Dynamics Simulation.

Calmodulin (CaM) is a multifunctional calcium-binding protein, which regulates a variety of biochemical processes. CaM acts through its conformational changes and complex formation with its target enzymes. CaM consists of two globular domains (N-lobe and C-lobe) linked by an extended linker region. Upon calcium binding, the N-lobe and C-lobe undergo local conformational changes, followed by a major conformational change of the entire CaM to wrap the target enzyme. However, the regulation mechanisms, such as allosteric interactions, which regulate the large structural changes, are still unclear. In order to investigate the series of structural changes, the free-energy landscape of CaM was obtained by multi-scale divide-and-conquer molecular dynamics (MSDC-MD). The resultant free-energy landscape (FEL) shows that the Ca2+ bound CaM (holo-CaM) would take an experimentally famous elongated structure, which can be formed in the early stage of structural change, by breaking the inter-domain interactions. The FEL also shows that important interactions complete the structural change from the elongated structure to the ring-like structure. In addition, the FEL might give a guiding principle to predict mutational sites in CaM. In this study, it was demonstrated that the movement process of macroscopic variables on the FEL may be diffusive to some extent, and then, the MSDC-MD is suitable to the parallel computation.

Cosolvent and Dynamic Effects in Binding Pocket Search by Docking Simulations.

The lack of conformational sampling in virtual screening projects can lead to inefficient results because many of the potential drugs may not be able to bind to the target protein during the static docking simulations. Here, we performed ensemble docking for around 2000 United States Food and Drug Administration (FDA)-approved drugs with the RNA-dependent RNA polymerase (RdRp) protein of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) as a target. The representative protein structures were generated by clustering classical molecular dynamics trajectories, which were evolved using three solvent scenarios, namely, pure water, benzene/water and phenol/water mixtures. The introduction of dynamic effects in the theoretical model showed improvement in docking results in terms of the number of strong binders and binding sites in the protein. Some of the discovered pockets were found only for the cosolvent simulations, where the nonpolar probes induced local conformational changes in the protein that lead to the opening of transient pockets. In addition, the selection of the ligands based on a combination of the binding free energy and binding free energy gap between the best two poses for each ligand provided more suitable binders than the selection of ligands based solely on one of the criteria. The application of cosolvent molecular dynamics to enhance the sampling of the configurational space is expected to improve the efficacy of virtual screening campaigns of future drug discovery projects.

Deciphering the AChE-binding mechanism with multifunctional tricyclic coumarin anti-Alzheimer's agents using biophysical and bioinformatics approaches and evaluation of their modulating effect on Amyloidogenic peptide assembly

Investigating the drug-AChE binding mechanism is vital in understanding its cogent use in medical practice against Alzheimer's disease (AD). The production and accumulation of oligomers of β-amyloid is a central event in the neuropathology of AD. Beside the inhibition of assembly process, modulation of the aggregation process of these proteins towards minimally toxic pathways may be a possible therapeutic strategy for AD. Hence, the present study aims to examine the effect of multifunctional fused tricyclic 7-hydroxy 4-methyl coumarin analogs (HMC1–5) on the self-induced aggregation of β-amyloid using Thioflavin T (ThT) assay, scanning electron microscopic study, AlamarBlue and immune blotting assays and also the binding mechanism with AChE by fluorescence emission, conformational, molecular docking and molecular dynamic simulation studies under physiological pH 7.4. The ThT assay, FE-SEM study, cell line and western blots establish that the HMC1–5 molecules could irreversibly disrupt preformed Aβ42 fibrils, accelerate the aggregates into micro size co-assembled structures, and effectively eliminate the cytotoxicity of Aβ1–42. Fluorescence emission studies indicating a strong binding affinity between HMC1–5 and AChE with the binding constants of 1.04 × 105, 3.57 × 104, 1.97 × 104, 3.07 × 104 and 2.95 × 104 M−1, respectively and binding sites number found to be 1. CD studies disclosed a partial unfolding in the secondary structure of AChE upon binding with HMC1–5. Docking analysis inferred that the HMC1–5 were bound through hydrophobic and hydrophilic interactions to the AChE active site. Molecular dynamics simulations emphasized the stability of AChE-HMC1–5 complexes throughout the 100 ns simulations, and the local conformational changes of the residues of AChE validate the stability of complexes. These results provide new and unique complementary approach for modulating the biological effects of the Aβ aggregates by coumarin analogs and new insights for further in vivo investigations as novel anti AD agents.