LHX3 Research Articles

Genetic analysis of adult Slovenian patients with combined pituitary hormone deficiency.

Among genetic causes of combined pituitary hormone deficiency (CPHD), mutations of genes coding for transcription factors involved in pituitary development have been implicated. Congenital CPHD is a rare disease; therefore, it is important to expand the knowledge about incidence and regional distribution of specific mutations. The aim of this paper is to report results of genetic analyses of adult Slovenian patients with CPHD. Twenty-three adult Slovenian patients with early childhood onset CPHD were included in the study. Blood samples were collected through the GENHYPOPIT network to assess possible mutations of six genes (PROP1/HESX1/LHX4/LHX3/POU1F1) involved in the pituitary development following an established algorithm. In seven out of 23 patients (30%) a specific mutation in genes encoding pituitary transcription factors was discovered. In five patients, two different mutations of the PROP1 gene (c.150delA and c.301-302delAG) were identified. One patient was heterozygous for a missense variant in the LHX4 gene. Additionally, one patient was positive for a mutation in the gene coding for prokineticin receptor-2. Our study confirms that the two most common mutations of the PROP1 gene globally are also the most frequent mutations in the cohort of adult Slovenian patients with CHPD. Other mutations of pituitary transcription factor genes are extremely rare.

Epigenetic inactivation of LHX6 mediated microcystin-LR induced hepatocarcinogenesis via the Wnt/β-catenin and P53 signaling pathways

Microcystins (MCs) have been shown to be carcinogenic by animal and cellular experiments and found to be associated with the development of human hepatocellular carcinoma (HCC) through epidemiological studies. However, the molecular mechanism of microcystin-LR (MC-LR) induced HCC is still unclear. This study is determined to clarify the role and mechanism of LHX6 in MC-LR-induced hepatocarcinogenesis. Using the previously established MC-LR-induced malignant transformation model in L02 cells, we screened out LHX6, homeobox gene that was significantly changed. We found that LHX6 was significantly down-regulated in MC-LR treated L02 cells and the liver tissue of rats treated for 35 weeks with 10 μg/kg body weight of MC-LR. Expression of LHX6 in human tumor tissue was significantly down-regulated in high MC-LR-exposure group. LHX6 was hypermethylated in MC-LR treated L02 cells and up-regulated after treatment with 10 μM of 5-aza-2′-deoxycytidine. Furthermore, overexpression of LHX6 inhibited proliferation, invasion and migration of malignantly transformed L02 cells in vitro and in vivo, while knockdown of LHX6 resulted in an opposite phenotype. In addition, we found that up-regulation of P53 and Bax resulted in apoptosis, and that down-regulation of CTNNB1 and MMP7 led to migration of MC-LR treated L02 cells. Blockade of P53 and CTNNB1 by its inhibitor significantly diminished the effect of LHX6. These genes were working together during the process of MC-LR-induced hepatocarcinogenesis. Our study demonstrated for the first time that LHX6 gene expression is regulated by DNA methylation and can inhibit the proliferation, invasion and migration through Wnt/β-catenin and P53 signaling pathways during the MC-LR-induced hepatocarcinogenesis. This result may suggest that LHX6 gene can be used as a potential target gene and a biomarker for liver cancer treatment.

Clinical and genetic aspects of Mayer-Rokitansky-Küster-Hauser syndrome.

The Mayer–Rokitansky–Küster–Hauser (MRKH) syndrome [MIM 277000] is characterised by the absence of a uterus and vagina in otherwise phenotypically normal women with karyotype 46,XX. Clinically, the MRKH can be subdivided into two subtypes: an isolated or type I form can be delineated from a type II form, which is characterised by extragenital malformations. The so-called Müllerian hypoplasia, renal agenesis, cervicothoracic somite dysplasia (MURCS) association can be seen as the most severe phenotypic outcome.The MRKH syndrome affects at least 1 in 4000 to 5000 female new-borns. Although most of the cases are sporadic, familial clustering has also been described, indicating a genetic cause of the disease. However, the mode of inheritance is autosomal-dominant inheritance with reduced penetrance. High-resolution array-CGH and MLPA analysis revealed recurrent aberrations in different chromosomal regions such as TAR susceptibility locus in 1q21.1, chromosomal regions 16p11.2, and 17q12 and 22q11.21 microduplication and -deletion regions in patients with MRKH. Sequential analysis of the genes LHX1, TBX6 and RBM8A, which are located in chromosomal regions 17q12, 16p11.2 and 1q21.1, yielded in the detection of MRKH-associated mutations. In a subgroup of patients with signs of hyperandrogenaemia mutations of WNT4 have been found to be causative. Analysis of another member of the WNT family, WNT9B, resulted in the detection of some causative mutations in MRKH patients.

Advance in genetic study of pituitary stalk interruption syndrome

Pituitary stalk interruption syndrome (PSIS) is a developmental defect, characterized by a thin or absent pituitary stalk. PSIS is a rare disease with combined pituitary hormone deficiencies, the pathogenesis of which is related to genetic mutations and environmental factors. It is also a genetically and clinically heterogeneous disease. Nine genes were found to be related to PSIS, including HESX1, LHX4, OTX2, SOX3, CDON, GPR161, PROKR2, TGIF and Wnt, Notch, SHH signalling pathways. In recent years, the intensive genetic studies show that four novel genes(CDON, GPR161, PROKR2, TGIF) and SHH pathway are related to PSIS, which provides a brand-new etiopathogenesis of PSIS. (Chin J Endocrinol Metab, 2017, 33: 885-889) Key words: Pituitary stalk interruption syndrome; Phenotype; Genetic heterogeneity; SHH signaling pathway

Expression of regulatory genes in the embryonic brain of a lizard and implications for understanding pallial organization and evolution.

The comparison of gene expression patterns in the embryonic brain of mouse and chicken is being essential for understanding pallial organization. However, the scarcity of gene expression data in reptiles, crucial for understanding evolution, makes it difficult to identify homologues of pallial divisions in different amniotes. We cloned and analyzed the expression of the genes Emx1, Lhx2, Lhx9, and Tbr1 in the embryonic telencephalon of the lacertid lizard Psammodromus algirus. The comparative expression patterns of these genes, critical for pallial development, are better understood when using a recently proposed six‐part model of pallial divisions. The lizard medial pallium, expressing all genes, includes the medial and dorsomedial cortices, and the majority of the dorsal cortex, except the region of the lateral cortical superposition. The latter is rich in Lhx9 expression, being excluded as a candidate of dorsal or lateral pallia, and may belong to a distinct dorsolateral pallium, which extends from rostral to caudal levels. Thus, the neocortex homolog cannot be found in the classical reptilian dorsal cortex, but perhaps in a small Emx1‐expressing/Lhx9‐negative area at the front of the telencephalon, resembling the avian hyperpallium. The ventral pallium, expressing Lhx9, but not Emx1, gives rise to the dorsal ventricular ridge and appears comparable to the avian nidopallium. We also identified a distinct ventrocaudal pallial sector comparable to the avian arcopallium and to part of the mammalian pallial amygdala. These data open new venues for understanding the organization and evolution of the pallium.

Xenopus pitx3 target genes lhx1 and xnr5 are identified using a novel three-fluor flow cytometry-based analysis of promoter activation and repression.

Pitx3 plays a well understood role in directing development of lens, muscle fiber, and dopaminergic neurons; however, in Xenopus laevis, it may also play a role in early gastrulation and somitogenesis. Potential downstream targets of pitx3 possess multiple binding motifs that would not be readily accessible by conventional promoter analysis. We isolated and characterized pitx3 target genes lhx1 and xnr5 using a novel three-fluor flow cytometry tool that was designed to dissect promoters with multiple binding sites for the same transcription factor. This approach was calibrated using a known pitx3 target gene, Tyrosine hydroxylase. We demonstrate how flow cytometry can be used to detect gene regulatory changes with exquisite precision on a cell-by-cell basis, and establish that in HEK293 cells, pitx3 directly activates lhx1 and represses xnr5. Developmental Dynamics 246:657-669, 2017. © 2017 Wiley Periodicals, Inc.

A novel 29 bp insertion/deletion (indel) variant of the <i>LHX3</i> gene and its influence on growth traits in four sheep breeds of various fecundity

Abstract. Belonging to the same LIM homeobox (LHX) family, LHX3 and LHX4 are key transcription factors in animal growth and reproduction. Insertion/deletion (indel) is a relatively simple and effective DNA marker. Therefore, four sheep breeds of various fecundity were used to explore the novel indel variants within the sheep LHX3 and LHX4 gene, as well as to evaluate their effects on growth traits. Herein, only one novel 29 bp indel (NC_019460.2:g.3107494-3107522delGGCCTGGACTGTGATGGGCACCCTCCGGG) within the sheep LHX3 gene was found, and three genotypes were detected. Interestingly, the increasing trends of II (insertion/insertion) genotype frequency and I allelic frequency were the same as the growth of the fertility character. Genotypic frequency and allelic frequency distributions were significantly different between the high-fecundity breeds (HS, STHS and LFTS) and low-fecundity breed (TS) based on a χ2 test (P < 0.05). Association analyses showed that body length was significantly different in female TS and STHS and that chest width was significantly different for the female TS and male STHS (P < 0.05). These findings suggested that the 29 bp indel could extend the spectrum of genetic variations of the LHX3 gene in sheep and provide a valuable theoretical basis for the marker-assisted selection (MAS) in sheep breeding and genetics.

Two novel LHX3 mutations in patients with combined pituitary hormone deficiency including cervical rigidity and sensorineural hearing loss

BackgroundCongenital combined pituitary hormone deficiency (CPHD) is a rare heterogeneous group of conditions. CPHD-type 3 (CPHD3; MIM# 221750) is caused by recessive mutations in LHX3, a LIM-homeodomain transcription factor gene. The isoforms of LHX3 are critical for pituitary gland formation and specification of the anterior pituitary hormone-secreting cell types. They also play distinct roles in the development of neuroendocrine and auditory systems.Case presentationHere, we summarize the clinical, endocrinological, radiological and molecular features of three patients from two unrelated families. Clinical evaluation revealed severe CPHD coupled with cervical vertebral malformations (rigid neck, scoliosis), mild developmental delay and moderate sensorineural hearing loss (SNHL). The patients were diagnosed with CPHD3 based on the array of hormone deficiencies and other associated syndromic symptoms, suggestive of targeted LHX3 gene sequencing. A novel missense mutation c.437G > T (p. Cys146Phe) and a novel nonsense mutation c.466C > T (p. Arg156Ter), both in homozygous forms, were found. The altered Cys146 resides in the LIM2 domain of the encoded protein and is a phylogenetically conserved residue, which mediates LHX3 transcription factor binding with a zinc cation. The p. Arg156Ter is predicted to result in a severely truncated protein, lacking the DNA binding homeodomain.ConclusionsConsidering genotype/phenotype correlation, we suggest that the presence of SNHL and limited neck rotation should be considered in the differential diagnosis of CPHD3 to facilitate molecular diagnosis. This report describes the first LHX3 mutations from Saudi patients and highlights the importance of combining molecular diagnosis with the clinical findings. In addition, it also expands the knowledge of LHX3-related CPHD3 phenotype and the allelic spectrum for this gene.

Differential Gene Expression Pattern in Osteoclast Precursor Cells of Indian Postmenopausal Women with and Without Osteoporosis: A Microarray Based Study

Background: Osteoporosis is a multifactorial disease with strong genetic and epigenetic component. In spite of enormous candidate gene association studies, the etiology and molecular mechanism of disease is not fully known. For identification of new markers of osteoporosis which could be vital in diagnosis and prognosis of disease, genome-wide microarray expression approach was employed.Methods: Osteoclast precursor cells were sorted from circulating monocytes of osteoporotic and nonosteoporotic post menopausal females with similar life-style and year after menopause. Following microarray experimentation, gene enrichment analysis was performed on significant DEGs using Database for Annotation, Visualization and Integrated Discovery (DAVID) tool. Top 10 novel genes were further used for construction of protein-protein interaction network using Search Tool for the Retrieval of Interacting Genes/Proteins (STRING) database. To validate microarray gene expression pattern, Real time-PCR was performed.Results: A total of 269 genes were found to be differentially expressed between disease and normal groups, of which 138 were observed to be up regulated and 131 down regulated. Furthermore, novel LHX1 gene was observed to be up regulated and its interaction with BMP4 protein was observed. Three known genes for osteoclastogenesis (viz., CX3CL1, ACP5 and CSF1) were found to be up- regulated. Similar pattern of gene expression have been obtained using RT-PCR.Conclusion: Significant enrichment of PI3K-Akt and TGF-s signaling pathways involving DEGs was found in postmenopausal Asian Indian women. Moreover, up regulated LHX1 gene was discovered as novel gene which may have a role in pathogenesis of osteoporosis and can be used for diagnosis and prognosis along with known osteoporotic markers.

Rare Frequency of Mutations in Pituitary Transcription Factor Genes in Combined Pituitary Hormone or Isolated Growth Hormone Deficiencies in Korea.

PurposeCongenital hypopituitarism is caused by mutations in pituitary transcription factors involved in the development of the hypothalamic-pituitary axis. Mutation frequencies of genes involved in congenital hypopituitarism are extremely low and vary substantially between ethnicities. This study was undertaken to compare the clinical, endocrinological, and radiological features of patients with an isolated growth hormone deficiency (IGHD) or combined pituitary hormone deficiency (CPHD).Materials and MethodsThis study included 27 patients with sporadic IGHD and CPHD. A mutation analysis of the POU1F1, PROP1, LHX3, LHX4, and HESX1 genes was performed using genomic DNA from peripheral blood leukocytes.ResultsIGHD and CPHD were observed in 4 and 23 patients, respectively. Mean age at diagnosis was 8.28±7.25 years for IGHD and 13.48±10.46 years for CPHD (p=0.37). Serum insulin-like growth factor-1 and peak growth hormone (GH) levels following GH stimulation tests were significantly lower in patients with CPHD than in those with IGHD (p<0.05). Sellar MRI findings revealed structural abnormalities in 3 patients with IGHD (75%) and 21 patients with CPHD (91.3%) (p=0.62). A mutation analysis identified homozygous p.R109Q mutations in HESX1 in a patient with CPHD. Patients with CPHD had more severe GHD than those with IGHD.ConclusionThe frequency of defects in the genes encoding pituitary transcription factors was extremely low in Korean patients with congenital hypopituitarism. Environmental factors and the impact of other causative genes may contribute to this clinical phenotype.

BMP4 acts as a dorsal telencephalic morphogen in a mouse embryonic stem cell culture system.

ABSTRACTThe concept of a morphogen – a molecule that specifies two or more cell fates in a concentration-dependent manner – is paradigmatic in developmental biology. Much remains unknown, however, about the existence of morphogens in the developing vertebrate central nervous system (CNS), including the mouse dorsal telencephalic midline (DTM). Bone morphogenetic proteins (BMPs) are candidate DTM morphogens, and our previous work demonstrated BMP4 sufficiency to induce one DTM cell fate – that of choroid plexus epithelial cells (CPECs) – in a mouse embryonic stem cell (mESC) culture system. Here we used BMP4 in a modified mESC culture system to derive a second DTM fate, the cortical hem (CH). CH and CPEC markers were induced by BMP4 in a concentration-dependent manner consistent with in vivo development. BMP4 concentrations that led to CH fate also promoted markers for Cajal–Retzius neurons, which are known CH derivatives. Interestingly, single BMP4 administrations also sufficed for appropriate temporal regulation of CH, CPEC, and cortical genes, with initially broad and overlapping dose-response profiles that sharpened over time. BMP4 concentrations that yielded CH- or CPEC-enriched populations also had different steady-state levels of phospho-SMAD1/5/8, suggesting that differences in BMP signaling intensity underlie DTM fate choice. Surprisingly, inactivation of the cortical selector gene Lhx2 did not affect DTM expression levels, dose-response profiles, or timing in response to BMP4, although neural progenitor genes were downregulated. These data indicate that BMP4 can act as a classic morphogen to orchestrate both spatial and temporal aspects of DTM fate acquisition, and can do so in the absence of Lhx2.

Multiple intrinsic factors act in concert with Lhx2 to direct retinal gliogenesis.

Müller glia (MG) are the principal glial cell type in the vertebrate retina. Recent work has identified the LIM homeodomain factor encoding gene Lhx2 as necessary for both Notch signaling and MG differentiation in late-stage retinal progenitor cells (RPCs). However, the extent to which Lhx2 interacts with other intrinsic regulators of MG differentiation is unclear. We investigated this question by investigating the effects of overexpression of multiple transcriptional regulators that are either known or hypothesized to control MG formation, in both wildtype and Lhx2-deficient RPCs. We observe that constitutively elevated Notch signaling, induced by N1ICD electroporation, inhibited gliogenesis in wildtype animals, but rescued MG development in Lhx2-deficient retinas. Electroporation of Nfia promoted the formation of cells with MG-like radial morphology, but did not drive expression of MG molecular markers. Plagl1 and Sox9 did not induce gliogenesis in wildtype animals, but nonetheless activated expression of the Müller marker P27Kip1 in Lhx2-deficient cells. Finally, Sox2, Sox8, and Sox9 promoted amacrine cell formation in Lhx2-deficient cells, but not in wildtype retinas. These findings demonstrate that overexpression of individual gliogenic factors typically regulates only a subset of characteristic MG markers, and that these effects are differentially modulated by Lhx2.

Two coexisting heterozygous frameshift mutations in PROP1 are responsible for a different phenotype of combined pituitary hormone deficiency.

The role of genetic background in childhood-onset combined pituitary hormone deficiency (CPHD) has been extensively studied. The major contributors are the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes coding transcription factors implicated in pituitary organogenesis. The clinical consequences of mutations encompass impaired synthesis of a growth hormone (GH) and one or more concurrent pituitary hormones (i.e. LH, FSH, TSH, PRL). Manifestation of the disorder may vary due to various mutation impacts on the final gene products or an influence of environmental factors during pituitary organogenesis. We describe the clinical and molecular characteristics of two brothers aged 47 and 39 years presenting an uncommon manifestation of congenital hypopituitarism. Sequencing of the PROP1, POU1F1, LHX3, LHX4 and HESX1 genes was performed to confirm the genetic origin of the disorder. A compound heterozygosity in the PROP1 gene has been identified for both probands. The first change represents a mutational hot spot (c.150delA, p.R53fsX164), whereas the second is a novel alteration (p.R112X) that leads to protein disruption. Based on precise genetic diagnosis, an in silico prediction of a p.R112X mutation on protein architecture was performed. The resulting clinical phenotype was surprisingly distinct compared to most patients with genetic alterations in PROP1 reported in the current literature. This may be caused by a residual activity of a newly identified p.R112X protein that preserves over 70 % of the homeodomain structure. This examination may confirm a key role of a DNA-binding homeodomain in maintaining PROP1 functionality and suggests a conceivable explanation of an unusual phenotype.

The Effect of Transient Local Anti-inflammatory Treatment on the Survival of Pig Retinal Progenitor Cell Allotransplants.

The development of photoreceptor replacement therapy for retinal degenerative disorders requires the identification of the optimal cell source and immunosuppressive regimen in a large animal model. Allotransplants are not acutely rejected in swine subretinal space, although it is not known if survival can be improved with immunosuppression. Here we investigated the survival and integration of expanded pig retinal progenitor cells (pRPCs) in normal recipients with and without transient anti-inflammatory suppression. pRPCs were derived from the neural retina of E60 GFP transgenic pigs, expanded for six passages, characterized, and transplanted into the subretinal space of 12 pigs. Six recipients received a single intravitreal injection of rapamycin and dexamethasone. pRPCs expressed the photoreceptor development genes Sox2, Pax6, Lhx2, Crx, Nrl, and Recoverin in vitro. Transplanted cells were identified in 9 out of 12 recipients 4 weeks after the injection. pRPCs integrated primarily into the photoreceptor inner segment layer and outer nuclear layer with single cells present in the inner nuclear layer. Donor cells remained recoverin-positive and acquired rhodopsin. We did not observe any signs of graft proliferation. The immunosuppression did not affect the survival or distribution of grafts. No macrophage infiltration or loss of retinal structure was observed in either group. Local immunosuppression with rapamycin and dexamethasone does not improve the outcome of pRPC allotransplantation into the subretinal space. Survival and integration of pRPC together with the lack of graft proliferation suggests that allogeneic RPC transplantation without transient immunosuppression is a favorable approach for photoreceptor cell replacement.

Frequency of genetic defects in combined pituitary hormone deficiency: a systematic review and analysis of a multicentre Italian cohort

Combined pituitary hormonal deficiency (CPHD) can result from mutations within genes that encode transcription factors. This study evaluated the frequency of mutations in these genes in a cohort of 144 unrelated Italian patients with CPHD and estimated the overall prevalence of mutations across different populations using a systematic literature review. A multicentre study of adult and paediatric patients with CPHD was performed. The PROP1, POU1F1, HESX1, LHX3 and LHX4 genes were analysed for the presence of mutations using direct sequencing. We systematically searched PubMed with no date restrictions for studies that reported genetic screening of CPHD cohorts. We only considered genetic screenings with at least 10 individuals. Data extraction was conducted in accordance with the guidelines set by the Preferred Reporting Items for Systematic Reviews and Meta-Analyses (PRISMA). Global mutation frequency in Italian patients with CPHD was 2·9% (4/136) in sporadic cases and 12·5% (1/8) in familial cases. The worldwide mutation frequency for the five genes calculated from 21 studies was 12·4%, which ranged from 11·2% in sporadic to 63% in familial cases. PROP1 was the most frequently mutated gene in sporadic (6·7%) and familial cases (48·5%). The frequency of defects in genes encoding pituitary transcription factors is quite low in Italian patients with CPHD and other western European countries, especially in sporadic patients. The decision of which genes should be tested and in which order should be guided by hormonal and imaging phenotype, the presence of extrapituitary abnormalities and the frequency of mutation for each gene in the patient-referring population.

Lhx4 deficiency: increased cyclin-dependent kinase inhibitor expression and pituitary hypoplasia.

Defects in the Lhx4, Lhx3, and Pitx2 genes can cause combined pituitary hormone deficiency and pituitary hypoplasia in both humans and mice. Not much is known about the mechanism underlying hypoplasia in these mutants beyond generally increased cell death and poorly maintained proliferation. We identified both common and unique abnormalities in developmental regulation of key cell cycle regulator gene expression in each of these three mutants. All three mutants exhibit reduced expression of the proliferative marker Ki67 and the transitional marker p57. We discovered that expression of the cyclin-dependent kinase inhibitor 1a (Cdkn1a or p21) is expanded dorsally in the pituitary primordium of both Lhx3 and Lhx4 mutants. Uniquely, Lhx4 mutants exhibit reduced cyclin D1 expression and have auxiliary pouch-like structures. We show evidence for indirect and direct effects of LHX4 on p21 expression in αT3-1 pituitary cells. In summary, Lhx4 is necessary for efficient pituitary progenitor cell proliferation and restriction of p21 expression.

Mutational Analysis of the LHX1 Gene in a French National Cohort of Patients with Mayer-Rokitansky-Küster-Hauser Syndrome

Mutational Analysis of the LHX1 Gene in a French National Cohort of Patients with Mayer-Rokitansky-Kuster-Hauser Syndrome Mayer-Rokitansky-Kuster-Hauser syndrome (MRKH syndrome) is characterized by congenital aplasia of the uterus and the upper part of the vagina in women showing normal secondary sexual characteristics development and a normal 46, XX karyotype. MRKH syndrome is a cause of primary amenorrhea with an incidence of approximately 1 in 5,000 newborn girls. Most cases of MRKH syndrome are sporadic, but some familial cases have been reported, suggesting a genetic cause. The genetic basis of MRKH syndrome remains largely unknown and seems heterogeneous. The LHX1 gene has been suggested to be a strong candidate, because (i) inactivation of the ortholog gene (Lim1) in the mouse model causes a Mullerian aplasia, and (ii) it is located in the chromosomal region 17q12, where deletions including this gene have been identified in approximately 5% of MRKH patients. Recently, three relevant heterozygous mutations of the LHX1 gene have been reported in association with the syndrome.

TRPP2-dependent Ca2+ signaling in dorso-lateral mesoderm is required for kidney field establishment in Xenopus.

In Xenopus laevis embryos, kidney field specification is dependent on retinoic acid (RA) and coincides with a dramatic increase of Ca(2+) transients, but the role of Ca(2+) signaling in the kidney field is unknown. Here, we identify TRPP2, a member of the transient receptor potential (TRP) superfamily of channel proteins encoded by the pkd2 gene, as a central component of Ca(2+) signaling in the kidney field. TRPP2 is strongly expressed at the plasma membrane where it might regulate extracellular Ca(2+) entry. Knockdown of pkd2 in the kidney field results in the downregulation of pax8, but not of other kidney field genes (lhx1, osr1 and osr2). We further show that inhibition of Ca(2+) signaling with an inducible Ca(2+) chelator also causes downregulation of pax8, and that pkd2 knockdown results in a severe inhibition of Ca(2+) transients in kidney field explants. Finally, we show that disruption of RA results both in an inhibition of intracellular Ca(2+) signaling and of TRPP2 incorporation into the plasma membrane of kidney field cells. We propose that TRPP2-dependent Ca(2+) signaling is a key component of pax8 regulation in the kidney field downstream of RA-mediated non-transcriptional control of TRPP2.

Molecular analysis of PROP1, POU1F1, LHX3, and HESX1 in Turkish patients with combined pituitary hormone deficiency: a multicenter study.

To investigate the specific mutations in PROP1, POU1F1, LHX3, and HESX1 genes in patients with combined pituitary hormone deficiency (CPHD) in Turkey. Seventy-six patients with CPHD were included in this study. Based on clinical, hormonal, and neuro-radiological data, relevant transcription factor genes were evaluated by Sanger sequencing and multiplex ligation-dependent probe amplification. Total frequency of mutations was 30.9 % in patients with CPHD. Frequency was significantly higher in familial patients (p = 0.001). Three different types of mutations in PROP1 gene (complete gene deletion, c.301-302delAG, a novel mutation; IVS1+2T>G) were found in 12 unrelated patients (21.8 %). Mutations in PROP1 gene were markedly higher in familial than in sporadic cases (58.8 vs. 5.3 %, p < 0.001). Homozygous complete gene deletion was the most common mutation in PROP1 gene (8/12) and was identified in six familial patients. Four different homozygous mutations [p.Q4X, novel mutations; exons 1-2 deletion, p.V153F, p.I244S] were detected in POU1F1 gene. Central precocious puberty was firstly observed in a sporadic-male patient with homozygous POU1F1 (p.I244S) mutation. A homozygous mutation in HESX1 gene (p.R160H) was detected in one patient. This study is the first to investigate specific mutations in CPHD patients in Turkey. Complete deletion in PROP1 gene was the most common mutation encountered in patients with CPHD. We believe that the results of this study will contribute to the establishment of genetic screening strategies in Turkey, as well as to the studies on phenotype-genotype correlations and early diagnosis of CPHD patients.

Cyclic expression of Lhx2 is involved in secondary hair follicle development in cashmere goat

Lhx2, a member of LIM homeobox transcription factors, plays a key role in normal tissue development. However, the molecular mechanism of Lhx2 gene in the regulation of the secondary hair follicle cycling in cashmere goat remains largely unknown. In the present study, the Lhx2 gene was cloned and characterized in cashmere goat. The cloned cDNA of Lhx2 was 1233 bp in length, encoding for proteins of 406 amino acids which contained all functionally important domains conserved among vertebrate Lhx2 gene. Tissue distribution analysis showed that Lhx2 mRNA was highly expressed in the skin and low expressed in all other tissues. Immunohistochemical localization revealed that Lhx2 was expressed in secondary hair follicles. Analysis of expression profiles of Lhx2 mRNA during different development stages in secondary hair follicles showed that the highest expression was observed at the anagen stage, while the lowest expression was detected at the telogen stage. The expression tendency during the development stages was that it increased from telogen to anagen, decreased from anagen to catagen, and decreased from catagen to telogen. The expression pattern of Lhx2 protein and mRNA was similar. The mRNA and protein expression of Lhx2 were consistent throughout the development cycle in secondary hair follicles. These findings provided a better understanding of the function of Lhx2 and suggested that the cyclic expression of Lhx2 might play important roles during secondary hair follicle development in cashmere goat.