Lateral Field Research Articles

Orienting role of the putative human posterior infero-temporal area in visual attention

The dorsal attention network (DAN) is a network of brain regions essential for attentional orienting, which includes the lateral intraparietal area (LIP) and frontal eye field (FEF). Recently, the putative human dorsal posterior infero-temporal area (phPITd) has been identified as a new node of the DAN. However, its functional relationship with other areas of the DAN and its specific role in visual attention remained unclear. In this study, we analyzed a large publicly available neuroimaging dataset to investigate the intrinsic functional connectivities (FCs) of the phPITd with other brain areas. The results showed that the intrinsic FCs of the phPITd with the areas of the visual network and the DAN were significantly stronger than those with the ventral attention network (VAN) areas and areas of other networks. We further conducted individual difference analyses with a sample size of 295 participants and a series of attentional tasks to investigate which attentional components each phPITd-based DAN edge predicts. Our findings revealed that the intrinsic FC of the left phPITd with the LIPv could predict individual ability in attentional orienting, but not in alerting, executive control, and distractor suppression. Our results not only provide direct evidence of the phPITd's functional relationship with the LIPv, but also offer a comprehensive understanding of its specific role in visual attention.

Pseudaphelenchus taedae n. sp. (Tylenchina: Aphelenchoididae) found in loblolly pine logs from the USA and peat from Lithuania

Summary Pseudaphelenchus taedae n. sp., isolated from loblolly pine logs (Pinus taeda L.) from the USA and peat from Lithuania, is described and figured. It is characterised by the male 355 (305-401) μm and female 427 (318-520) μm body lengths and by the presence of three equal incisures in the lateral field. The slender stylet has small but conspicuous basal knobs. Valve is located at posterior part of metacorpus. The excretory pore is located at the same level as valve plates or anterior. Spicules are paired, thorn-like, separate, condylus broadly rounded, rostrum conical or triangular with a bluntly pointed tip, calomus smoothly tapering together with lamina, thin and strongly arcuate in middle then tapering towards bluntly pointed distal tip, cucullus absent. A narrow bursa surrounds three quarters of tail but is inconspicuous in most cases. The conical male tail is bluntly rounded but mostly with a short pointed or blunt mucron. The female tail is conical in various shapes, smoothly tapering, slightly ventrally bent or curved, with broadly rounded or pointed terminus. Detailed phylogenetic analysis based on the 18S and D2-D3 region of 28S sequences confirmed the status of this nematode as a new species.

Enabling of CMOS Circuit using Dual Material Gate Germanium Pocket Induced FDSOI MOSFET

This research presents a comparison of the electrical performance of a double-side induced germanium-pocket (IGP) FD-SOI MOSFET and a dual material gate IGPFDSOI (DIGPFDSOI). The electrical performance is reviewed by comparing the device parameters like drain current, band diagram, lateral electric field, surface potential, and work function of the gate material. The proposed structure exhibits excellent characteristics compared to the IGPFDSOI MOSFET. The proposed structure has a greater Ion/Ioff ratio, a lower subthreshold slope, reduced capacitance, and an elevated cut-off frequency. The implementation of a dual metal gate is considered a superior method in comparison to FD-SOI technology because it effectively reduces the negative effects of scaling. A study is being done to analyze the differences in the work functions of metal gates to evaluate the effectiveness of the proposed construction. The comparison evaluation shows that the suggested design can be used for both digital and analog tasks because it has a higher switching frequency and a better cut-off frequency. Apart from this, the proposed structure can also be implemented without making substantial changes to the conventional FD-SOI MOSFET fabrication process flow. Here, we are using n-type and p-type DIGPFDSOI MOSFETs to make a CMOS converter circuit. Sentaurus TCAD is used to simulate and analyze the performance of the proposed structure.

Enabling low-power analog and RFIC design through advanced semiconductor FDSOI MOSFETs

This study investigates the electrical performance of advanced semiconductor Ge-pocket-doped fully depleted silicon-on-insulator MOSFETs in comparison to conventional fully depleted silicon-on-insulator (FDSOI) MOSFETs. In this study vital electrical parameters such as the drain current, band diagram, lateral electric field, surface potential, and work function of the gate material were investigated. The advanced Ge pocket-doped FDSOI MOSFET structure demonstrates superior characteristics, such as a higher Ion/Ioff ratio, smaller subthreshold slope, lower capacitance, and higher cut-off frequency, when compared to conventional FDSOI MOSFETs. The structure of the Ge pocket-doped FDSOI MOSFET in the source and drain regions is designed to overcome the scaling effects of the transistor. In addition, this paper delves into the fabrication of the proposed device structure, outlining the key steps and intricacies involved. This study shows that the proposed device can be used for both digital and analog applications because it has good switching performance and a low cut-off frequency. In addition, the fabrication steps of the proposed structure were compatible with the existing fabrication process steps for conventional FDSOI MOSFETs. The simulation and analysis of the advanced semiconductor structure were performed using the Sentaurus TCAD simulator.

No difference in prior representations of what to attend and what to ignore

ABSTRACT Adaptive behaviour requires the selection of relevant, and the ignoring of irrelevant visual information. Previous work has shown that prior information about target (i.e., relevant) and non-target (i.e., irrelevant) objects facilitates such selection, presumably by enabling observers to create a working memory template for or against such objects. Using a cued visual search task, here we aimed to investigate whether, and how, target and non-target templates differ in terms of neural representation, as measured through fMRI activity patterns. Two hypotheses were tested: (1) while target representations are activated, non-target representations are suppressed prior to search, and thus these representations differ, and (2) target and non-target templates share similar initial representations but involve different control signals in anticipation of, or upon encountering the search display. Behaviourally, both target and non-target cues facilitated search compared to baseline. Using multivariate pattern and representational similarity analyses, the findings revealed little support for the suppression hypothesis. Posterior brain regions primarily coded for the category content of the template and did so similarly for target and non-target information. Frontal cortical areas, particularly the lateral prefrontal cortex and frontal eye fields, instead showed sensitivity to the status of the template, regardless of the object category it belonged to. These results are most consistent with the hypothesis that prior to selection, target and non-target information are represented similarly in terms of content, but differ in terms of the associated control signals.

Improvement of C-shaped pocket TFET with sandwiched drain for ambipolar performance and analog/RF performance

A novel structure of tunneling field effect transistor device (CSP-SD-TFET) is proposed, which adds a sandwiched drain to the C-shaped pocket TFET (CSP-TFET). This structure can increase the resistance of the drain, share the lateral electric field at the tunneling junction between the channel and the drain, reduce the lateral electric field at the tunneling junction, and suppress the generation of ambipolar current. The DC and analog/RF characteristics of CSP-SD-TFET are simulated and analyzed by Sentaurus TCAD, and the sandwiched structure parameters of the drain are optimized. The results show that the sandwiched drain structure suppresses the ambipolar current and on-state current, so the parameters of the sandwiched drain structure need to be a compromise between low ambipolar current and high on-state current. The optimized CSP-SD-TFET device has good DC characteristics, such as low average subthreshold swing SSavg (12.2mV/dec), high on/off current ratio Ion/Ioff (2.5 × 1011), high on-state current Ion (9.02 × 10−4 A/μm) and low ambipolar current Iamb (5.41 × 10−17A/μm). The RF performance of the CSP-SD-TFET, such as the cut-off frequency fT (1 × 1011 Hz) and gain-bandwidth product GBP (5.66 × 1010 Hz), are improved. It can be seen that the CSP-SD-TFET device not only has good DC characteristics but also improves analog/RF characteristics.

Magnetic Field Sensing via Acoustic Sensing Fiber with Metglas® 2605SC Cladding Wires

Magnetic field sensing has the potential to become necessary as a critical tool for long-term subsurface geophysical monitoring. The success of distributed fiber optic sensing for geophysical characterization provides a template for the development of next generation downhole magnetic sensors. In this study, Sentek Instrument’s picoDAS is coupled with a multi-material single mode optical fiber with Metglas® 2605SC cladding wire inclusions for magnetic field detection. The response of acoustic sensing fibers with one and two Metglas® 2605SC cladding wires was evaluated upon exposure to lateral AC magnetic fields. An improved response was demonstrated for a sensing fiber with in-cladding wire following thermal magnetic annealing (~400 °C) under a constant static transverse magnetic field (~200 μT). A minimal detectable magnetic field of ~500 nT was confirmed for a sensing fiber with two 10 μm cladding wires. The successful demonstration of a magnetic field sensing fiber with Metglas® cladding wires fabricated via traditional draw processes sets the stage for distributed measurements and joint inversion as a compliment to distributed fiber optic acoustic sensors.

Ektaphelenchoides factum n. sp. in Pinus taeda from the USA and E. pini in Pinus koraiensis from China

Summary The genus Ektaphelenchoides is a diverse group of nematodes; they are either inhabitants of trees or present in the rhizosphere of economical plants. Members of the genus have ecological relevance in terms of being associated with insects and predators of other nematodes. In the present study, a new Ektaphelenchoides species, E. factum n. sp., is described and illustrated. The new species was isolated from a log sample of Pinus taeda imported from the USA. It is characterised by the lateral field with three incisures, stylet distinctly tripartite. Females having a vulval flap, the anus and rectum indistinct, and the tail (posterior part of body) filiform. Males having arcuate and 21.5 (19.4-22.9) μm long spicules, the lamina of the spicule is smoothly curved to distal end, condylus well developed with a broadly rounded tip, rostrum triangular with finely rounded tip and cucullus absent, tail arcuate and conical with terminus bearing a sharply pointed mucron. The new species is different from other Ektaphelenchoides species in having a vulval flap. Molecular characterisation and phylogenetic studies also supported its unique status. In addition, a Chinese native population of E. pini, detected in Pinus koraiensis branches from Liaoning province, P.R. China, is described.

Thermophysical dynamics of magnetohydrodynamic electroosmotic two phase mixed convective flow in vertical annulus: neuro computation

ABSTRACT The thermophysical dynamics of electro – magnetohydrodynamic mixed convective electrically conducting fluid flow in the vertical cylindrical annulus are explored with electric and magnetic fields. The flow and heat transfer properties are explicitly examined in viscous fluid and electroosmotic flow regions. The coupling between an external pressure gradient, electroosmosis, and an extended electromagnetic field can control fluid flow and heat transfer. The governing equations associated with the physical phenomenon are addressed with the Galerkin finite element method. Eloquently, the analysis revealed that, in the absence of a lateral electric field, the flow velocity decelerates as the Hartmann number increases, which in turn ultimately, causes the Nusselt number to rise. Since a lateral electric field is involved, the flow field, temperature field, and Nusselt number profiles are presented in two regions. The artificial neural network model discusses the thermal transport phenomenon in both regions. The artificial neural network models regression, performance plots, weights, and bias are presented. The research outcome can be utilized to design exquisite and efficacious electromagnetic devices, particularly within a particular range of thermal physical properties.

Bias-dependent electron velocity and short-channel effect in scaling sub-100 nm InAlN/GaN HFETs

This work reports on the extraction and simulation of the electron velocity–gate voltages relationship for sub-100 nm InAlN/GaN heterojunction field-effect transistors (HFETs). A peak electron velocity (ve) at an electron density (ns) of 0.41 × 1013 cm−2 was observed at 1.06 × 107 cm/s in an InAlN/GaN HFET with 60 nm gate length (Lg) by delay time analysis. The ve at a high ns of 1.5 × 1013 cm−2 was observed at 0.6 × 107 cm/s. This peak ve behavior is explained by polarization Coulomb field (PCF) scattering and optical phonon scattering based on a Monte Carlo method. As Lg scaled from 350 to 60 nm, the current gain cutoff frequency (fT) and transconductance (gm) were improved. However, the thermal performance was degraded with a bad figure of merit P150 °C. Although a weakening of the control capability of Vgs on ns (Δns/ΔVgs) was observed in the shorter Lg device, which leads to a decrease in device gm, the larger electron velocity by the increased lateral electric field (E) and the larger Δve/ΔVgs by the increased PCF scattering still enhance the peak gm. Results indicate that the enhancement of Δve/ΔVgs is a vital method to strengthen the modulation of the gate on current and to suppress the short channel effect in GaN HFET. Our work supports a deeper understanding and analysis of sub-100 nm InAlN/GaN HFET device performance and physical mechanisms.

Morphological and Molecular Characterization of a New Root-Knot Nematode, Meloidogyne limonae n. sp. (Nematoda: Meloidogynidae), Parasitizing Lemon in China.

Root-knot nematodes of the genus Meloidogyne parasitize the roots of thousands of plants and can cause severe damage and yield losses. Here, we report a new root-knot nematode, Meloidogyne limonae n. sp., parasitizing "lemon" (Citrus limon) in Hainan Province, South China. Lemon trees infected by the root-knot nematode showed poor-quality lemons, chlorosis of foliage, weak growth, and numerous root galls with white females and egg masses protruding outside. Phylogenetic trees of sequences within the ribosomal and mitochondrial DNA demonstrated that this species differs clearly from other previously described root-knot nematodes. Morphologically, the new species is characterized by an oval-shaped perineal pattern and the lateral field marked by a ridge of cuticle on one or both sides; the dorsal arch is low, with fine to coarse, smooth cuticle striae; the vulva slit is centrally located at the unstriated area; the spicules of males are arcuate and curved ventrally; the gubernaculum is distinct and curved; the labial disc of second-stage juveniles is prominent and dumbbell shaped; stylet knobs are oval and sloping backwardly; pharyngeal glands are not filling the body cavity and overlapping the intestine ventrally; and the conical tail is gradually tapering. Phylogenetic trees based on the ITS1-5.8S-ITS2, D2-D3 of the 28S rDNA, and COI and COII-16S rRNA genes of the mtDNA showed that M. limonae n. sp. belongs to an undescribed root-knot nematode lineage that is separated from other species with the resemblance in morphology, such as M. floridensis, M. hispanica, M. acronea, and M. paranaensis.

Description of a new species of entomopathogenic nematode, Steinernema ramanai sp. n. from Kerala, India

Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy

Modeling of inner-outer gates and temperature dependent gate-induced drain leakage current of junctionless double-gate-all-around FET

In this paper, the temperature-dependent gate-induced drain leakage (GIDL) current model is proposed with the help of a lateral electric field (EL) across the inner and outer gate interfaces of the junctionless double-gate-all-around (JL-DGAA) field-effect transistor (FET). The EL at the interface is obtained from the surface potential equation after solving the 3D Poisson equation with appropriate boundary conditions. The derived model is validated using the well-calibrated TCAD simulator platform with experimental data. A higher GIDL current at the outer gate-channel interface is observed compared to the inner gate-channel interface in the OFF-state conditions due to the high EL between the channel and drain, which is reported for the first time here. The effect of temperature (from 200 K to 500 K) on the GIDL current is also observed, which increases linearly with increasing temperature. Further, the impact of induced mechanical stress (MS) is investigated on the GIDL current, where the GIDL current increases exponentially with increasing induced MS due to effective mass and band gap reduction. Finally, the dynamic performance is investigated in terms of the gate delay time as a function of channel length and temperature. The gate delay diminishes with decreasing channel length and increasing temperature, which shows the switching speed and ability of the device.

A compact low-loss 2-to-4 plasmonic decoder based on suspended graphene for surface plasmon polariton transmission

This work introduces a novel design for a high-performance plasmonic 2-to-4 decoder. The proposed structure utilizes suspended graphene and a silicon dioxide ridge to create a low-loss channel with 60 nm in width and 10 nm in height. By achieving a high concentration field in the channel, the lateral field leakage is minimized, resulting in a transmission loss of only 0.268 dB/μm. Leveraging this designed channel, a subwavelength structure is proposed to decode optical information from two inputs into four output ports. The device exhibits a contrast ratio of 37.11 dB and a cross talk of −37.13 dB, all within a compact area of 1.08 μm2. A comparison with other studies confirms that this research presents a significant improvement in the characteristics of the plasmonic decoder.

Description of Nothotylenchus savadkoohensis n. sp. (Rhabditida, Anguinidae) from Iran based on morphological and molecular data.

Nothotylenchus savadkoohensis n. sp. was recovered from rotten wood samples of an unidentified forest tree in the Mazandaran province and described herein. It is mainly characterized by an elongated conoid tail ending in a sharply pointed tip and four lines in the lateral field. Females of the new species have 379-662 μm long bodies with 5.8-6.9 μm long stylets ending in fine posteriorly sloping knobs, the metacorpus not valvate, the pharyngeal bulb slightly overlapping the intestine, and the vulva at 76.5-84.0% of body length. Males are also common and have 13.0-14.5 μm long spicules and bursa cloacal. By having an elongated conoid tail and four lines in the lateral field, the new species comes close to four known species, namely N. acris, N. acutus, N. antricolus, and N. truncatus. The morphological differences between the new species and the abovementioned species are discussed. The new species was sequenced for its D2-D3 segment of LSU and ITS rDNA regions. In the LSU phylogenetic tree, the currently available LSU sequences of the genus Nothotylenchus occupied distant placements from each other and the LSU sequence of the new species formed clade with a sequence assigned to Neotylenchus sp. In ITS phylogeny, the newly generated sequence of the new species formed a clade with a clade that includes sequences of Ditylenchus sp. and Neomisticius platypi and N. variabilis.

Description of Panagrolaimus namibiensis n. sp. (Rhabditida: Panagrolaimidae), an Anhydrobiotic Nematode from the Namib Desert of Namibia.

Panagrolaimus namibiensis n. sp. was recovered and cultured from soils collected under Arthraerua leubnitziae (pencil-bush) in the Namib Desert of Namibia, one of the driest terrestrial habitats on Earth. It is described here based on morphometrics, scanning electron micrographs, light images, line drawings, and molecular data. The new species is distinguished by having a conspicuous posterior deirid, a hook-shaped stegostomal dorsal tooth, and anterior deirids and excretory pore aligned at mid-bulb. It was morphologically compared to eleven well-described species in the genus with which it shared similar labial structure (six distinct rounded lips, and low lip segments separated in pairs), conoid tail, and/or a lateral field with three incisures, including P. labiatus, P. kolymaensis, P. davidi, P. rigidus, and P. superbus. Bayesian phylogenetic analyses using SSU and LSU rDNA each placed P. namibiensis n. sp. within clades of Panagrolaimus species, although the two trees resolved its relationship to previously described species differently. Furthermore, our analyses showed the genus is not monophyletic. In a laboratory experiment, P. namibiensis n. sp. survived exposure to 0% relative humidity for 24 h, demonstrating the anhydrobiotic ability of this species that contributes to its survival in the Namib Desert.

Enhanced Rectification Performance in Bipolar Janus Graphene Oxide Channels by Lateral Electric Fields.

Improving the ionic rectification in nanochannels enables versatile applications such as biosensors, energy harvesting, and fluidic diodes. While previous work mostly focused on the effect of channel geometry and surface charge, in this work via a series of molecular dynamics simulations, we find a striking phenomenon that the ionic current rectification (ICR) ratio in Janus graphene oxide (GO) channels can be tremendously promoted by lateral electric fields. First, under a given axial electric field, an additional lateral electric field can improve the ICR ratio by several times to an order, depending on the channel symmetry. The symmetric channel has an obviously greater ICR ratio because it maintains a more pronounced ion transport disparity at opposite axial fields. The underlying mechanism for the function of the lateral electric field is that it promotes the lateral migration of ions and thus amplifies the ion-residue electrostatic interaction at opposite axial fields, enlarging the ion dynamical difference. Furthermore, for different axial electric fields, the ICR ratio can always be improved by lateral electric fields (up to two orders), suggesting that the ICR improvement is universal. Our results demonstrate that applying a lateral electric field could be a new method to improve the rectification performance of nanochannels, providing valuable guidance for the design of efficient ionic diode devices.

Numerical study of mixing vane spacer grid effect on subchannel mixing in a 5 × 5 rod bundle

Turbulent flow in rod bundle with spacer grid without mixing vanes and with mixing vanes of inclination angles from 10° to 30° was investigated by Reynolds Stress Transportation (RST) model under Reynolds numbers (Re) from 3.96 × 103 to 3.96 × 105. The predicted results were validated by experimental data of lateral velocity field in 5 × 5 rod bundle. The cross-flow velocity was relatively well predicted against experimental data, while lateral Reynolds normal stress was underpredicted near spacer grid and overpredicted far from spacer grid. The mixing vanes in one sub-channel generate high pressure region at the upstream side of mixing vane and low-pressure region at the downstream side of mixing vane, forming secondary flow structures. The lateral velocity increases with inclination angle and Re increasing. The lateral Reynolds stress increases with inclination angle increasing and decreases with Re increasing. The anisotropic turbulent states were studied by Lumley triangle method. The mixing vanes are the main factor dominating the turbulent states in rod bundle. The space grid resistance follows decreasing power function of Re and increases with inclination angle increasing. The secondary flow intensity follows an exponentially decaying function of distance from spacer grid and increases with inclination angle and Re increasing. The turbulent mixing coefficient model is an exponentially decreasing function of the distance from spacer grid, and it increases with inclination angle increasing and decreases with Re increasing. This paper studied the inclination angle and Re effect on the sub-channel mixing in a relatively large range of inclination angle and Re, improving the understandings of the sub-channel mixing phenomena.

Post Stroke, Is Perimetry Necessary? A Case Report

Abstract
 Introduction : Stroke are generally associated with peripheral visual field loss. Three out of four stroke patients report some form of disability, one of which is visual impairment. Approximately 16% of these patients have a homonymous visual field defect poststroke. These vision problems can lead to difficulty carrying out a lot of daily tasks and activities, such as driving. This report tries to define the diagnostic flow to determine the exact type and lesion.
 Case Illustration : Male, 61 years old, came to Universitas Sumatera Utara Hospital with visual field loss in both eyes. Two months ago, he was diagnosed with ischemic stroke and treated with Aspirin 80 mg, with no limbs disability right now. He also had hypertension and treated with Amlodipine 10 mg. VOD: 6/60 with BCVA S-2.00 6/7,5, VOS: 6/60 with BCVA S-2.00 6/7.5. With confrontation test and perimetry, defect was found in medial visual field OD and lateral visual field OS. Hess screen and Amsler Grid was normal. Head CT-Scan was performed with multiple infarcts, mainly in right occipital lobe. The patient was diagnosed with Incomplete Hemianopia, Left Congruous Homonymous Hemianopia with Macular Sparing, and treated with Citicholine 1000 mg once daily.
 Discussion
 Conclusion : In stroke patients with homonymous visual field loss, visual field testing with detailed evaluation of visual field defect can determine the lesion location, and neuro-radiological imaging was necessary to assess visual pathway. It’s important for educate the patients, diagnostic and prevent the stroke recurrent.

Investigation of SiGe/Si heterojunction inductive line tunneling TFET with source Schottky contact for prospect ultra-low power applications

In this paper, a SiGe/Si heterojunction inductive line tunneling tunnel field-effect transistor with source Schottky contact (SC HJLT-iTFET) is proposed and investigated by the Sentaurus Technology Computer Aided Design (TCAD) simulator. By utilizing an appropriate source Schottky metal, the need for multiple ion implantation and annealing steps required for traditional P–I–N TFETs can be avoided, and the problems of self-alignment and random dopant fluctuations (RDF) during ion implantation can be solved. A high ON-state current (I ON) is obtained as fully overlapping the source and gate by line tunneling mechanism dominated, the appropriate Si1−x Ge x mole fraction material in the source region and high-k gate dielectric employed can further improve I ON. The incorporation of the block layer effectively decreases the lateral electric field at the drain end to reduce the OFF-state current (I OFF). Furthermore, the proposed charge enhancement layer (CEL) on the SiGe channel can suppress the Fermi level pinning effect (FLP) and enhance the charge of the source region. Based on the feasibility of the practical fabrication process, and the rigorous simulations indicate that the device has an SSavg of 19.8 mV/dec and SSmin of 6.8 mV/dec at V D = 0.2 V, I ON of 2.27 × 10−6 A μ m−1, and an I ON/I OFF ratio of 1.02 × 1010, with extremely fast switching speed. These features make the device suitable for future ultra-low power applications on the internet of things, artificial intelligence, and related fields.