Abstract
Aim: A novel species of entomopathogenic nematode (EPN) belonging to genus Steinernema was discovered in the rhizosphere of ginger grown at Kozhikode, Kerala, India. Methodology: Morphological and molecular characterization of new species of Steinernema and its phylogenetic relationships with other Steinernema species were investigated using DNA extracted and amplified rDNA of the ITS region using primers 18S (FORWARD) 5' TTGATTACGTCCCTGCCCTTT 3' and 26S (REVERSE) 5' TTTCACTCGCCG TTACTAAGG 3'. Results: New species described based on the length of infective juvenile, which was the smallest species among the described Steinernema species. S. ramanai sp. n. has five incisures in the lateral field, an elongate conoid tail that gradually tapered at the tip in infective juveniles; vulva with double flapped epipytigma and tail without post anal swelling in females; body 'J' shaped upon fixation, ten genital papillae, and a mucron on the tail terminus in males. This new species is distinguished genetically by its unique rDNA ITS region nucleotide sequence. The ITS sections of ribosomal DNA were sequenced to confirm this new species. Interpretation: Native EPNs may yield species and/or strains that are better suited for inundative release against local pests. This logic has prompted coordination of several surveys in the search for novel species and strains, particularly in areas where EPNs had previously remained undetected. Key words: Biocontrol, Morphology, Molecular characterization, Steinernema, Taxonomy
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have