Independent Risk Factor For Hyperuricemia Research Articles

Prevalence and Risk Factors of Hyperuricemia in Patients with Chronic Kidney Disease and Non-Alcoholic Fatty Liver.

Background/AimsThe number of patients with nonalcoholic fatty liver disease (NAFLD) and chronic kidney disease (CKD) is on the rise. Epidemiological studies have shown the role of hyperuricemia in the development of NAFLD and CKD through oxidative stress and inflammatory mediators. Therefore, this study was conducted to investigate the prevalence and risk factors of hyperuricemia in patients with CKD and NAFLD in Iran.Patients and MethodsThis study was conducted in 450 CKD patients. NAFLD was diagnosed by ultrasonography. According to the serum uric acid level, all CKD+ NAFLD+ patients were divided into non-hyperuricemia and hyperuricemia groups. The patients’ demographic and clinical data such as age, sex, abdominal obesity, metabolic syndrome, diabetes, hypertension, CRP, hepatic steatosis, blood pressure, serum uric acid (UA), lipid and creatinine were collected for analysis.ResultsA total of 279 cases (62%) were diagnosed with NAFLD. The prevalence rate of NFALD in CKD patients was significantly lower in normal UA level than hyperuricemia (42.7% vs 57.3%) (P=0.039). The prevalence of hyperuricemia was about 57.3% in patients with CKD and NAFLD. Accordingly, 279 CKD patients with NAFLD were enrolled and divided into hyperuricemia (n =160) and non-hyperuricemia groups (n =119). Patients with hyperuricemia showed higher creatinine and lipid levels, and a lower GFR compared to patients with normal uric acid levels (P< 0.05). However, no significant difference was observed in age, sex, abdominal obesity, metabolic syndrome, hypertension, type 2 diabetes, CRP, and steatosis between hyperuricemia and non-hyperuricemia groups (P>0.05). Three factors, including type 2 diabetes, hyperlipidemia, and a low GFR, serve as independent risk factors for hyperuricemia (P<0.05).ConclusionThe results showed a high prevalence of hyperuricemia in patients with CKD and NAFLD. A more comprehensive strategic management is necessary to address the potential harmful effects of hyperuricemia on the health of CKD+ NAFLD+ cases.

Neck circumference is an independent risk factor for hyperuricemia within 3years in women: a longitudinal study.

Our previous cross-sectional study revealed the association between neck circumference (NC) and hyperuricemia. This study aimed to further investigate the longitudinal association between NC and hyperuricemia and to compare the strengths of longitudinal association of NC and waist circumference (WC) with hyperuricemia. A total of 4383 subjects without hyperuricemia at baseline were included. Multivariable linear regression was used to assess the association between baseline anthropometric indices and uric acid level at follow-up. Cox regression was used to assess the relationship between baseline anthropometric indices and the risk of future hyperuricemia. A receiver-operating characteristic curve was used to compare the predictive ability of baseline anthropometric indices for future hyperuricemia. Among women, only baseline NC was positively, linearly associated with uric acid level at follow-up (β= 1.75) and risk of future hyperuricemia (ptrend < 0.05); risk of hyperuricemia in the third and fourth quartile groups of baseline NC significantly increased, compared with the first quartile group of baseline NC (HR = 1.48 and 1.81, respectively). Among men, neither NC nor WC was associated with hyperuricemia after adjusting for confounder factors. The area under the curve of baseline NC and WC for hyperuricemia was comparable in both genders (0.606 for NC and 0.599 for WC in women, 0.578 for NC and 0.602 for WC in men). For women, only baseline NC is an independent risk factor of hyperuricemia within 3years. NC and WC have a similar 3-year predictive ability for hyperuricemia in both genders. Key Points • This is the first study to assess the longitudinal association between neck circumference and hyperuricemia. • According to the results of this study, we propose for the first time that neck circumference is an independent risk factor for hyperuricemia in women in the future, rather than waist circumference. • We found for the first time that neck circumference and waist circumference have similar predictive ability for future hyperuricemia in both genders.

Higher Levels of High-Sensitivity C-Reactive Protein Is Positively Associated with the Incidence of Hyperuricemia in Chinese Population: A Report from the China Health and Retirement Longitudinal Study.

Purpose The aim of the present cohort study was to explore the longitudinal association between high-sensitivity C-reactive protein (CRP) and hyperuricemia in Chinese population. Furthermore, we conducted subgroup analyses to explore this association according to age, sex, and body mass index. Methods A total of 5,419 healthy participants were enrolled in the final cohort analysis. The high-sensitivity CRP level was measured by immunoturbidimetric assay. Hyperuricemia was defined as serum uric acid ≥7.0 mg/dL (416 μmol/L) in men and ≥6.0 mg/dL (357 μmol/L) in women. Multivariate logistic regression was used to analyze the association. Results During the 4 years follow-up, 474 participants developed hyperuricemia. Compared with participants in the lowest tertile of high-sensitivity CRP, the multivariate-adjusted odds ratio (OR) (95% confidence interval [CI]) for incident hyperuricemia in the highest tertile was 1.36 (1.02, 1.82). In the subgroup analyses, high-sensitivity CRP was positively associated with the incidence of hyperuricemia after multivariate adjustments (P for trend = 0.04) in women. Compared with the women in the lowest tertile of high-sensitivity CRP, the multivariate-adjusted OR (95% CI) in the highest tertile was 1.69 (1.10, 2.66). No statistically significant association was found in other subgroups. Conclusions The findings of this prospective cohort study suggest that higher level of high-sensitivity CRP is an independent risk factor for hyperuricemia in Chinese, especially in women.

Risk Factors For Hyperuricemia In Chinese Centenarians And Near-Centenarians.

PurposeHyperuricemia is an important potential pathogenic factor for hypertension, cardiovascular disease and stroke. The current study aimed to investigate the prevalence of hyperuricemia and its relationship to lifestyle characteristics and dietary habits in centenarians and near-centenarians.Patients and methodsIn total, 966 centenarians and 788 near-centenarians were included. Community-based surveys were conducted to collect information about lifestyle. Blood examinations were performed using enzymatic assays. T-tests and χ2 tests were used to investigate significant indicators of hyperuricemia, and multivariate logistic regression was used to analyze the related risk factors. A comprehensive analysis of nineteen modifiable factors, including lifestyle characteristics, dietary habits, general characteristics and blood test indexes, was conducted.ResultsThe prevalence of hyperuricemia was 29.02%. The percentage of men, waist circumference (WC), waist-hip ratio, estimated glomerular filtration rate (eGFR), levels of total protein (TP), alanine aminotransferase, aspartate aminotransferase, triglycerides, high-density lipoprotein cholesterol, serum homocysteine, serum uric acid, serum urea and serum creatinine, passive smoking, alcohol consumption, snoring, preference for fried flavors, and meat, seafood and vegetable consumption were significantly different between the hyperuricemia group and the normouricemia group (p<0.05). Multivariate logistic regression analysis showed that WC (OR=1.020), eGFR (OR=0.960), TP level (OR=1.038), serum urea level (OR=1.154), passive smoking (OR=2.589), snoring (OR=2.003), meat consumption (OR=2.506), seafood consumption (OR=1.422) and vegetable consumption (OR=0.521) were significantly associated with the risk of hyperuricemia (p<0.05).ConclusionLow eGFR and vegetable consumption, high WC, TP, and serum urea levels, passive smoking, snoring, and high meat and seafood consumption were independent risk factors for hyperuricemia. It is recommended that people at high risk for hyperuricemia should actively limit their intake of fried food, alcohol and purine-rich food, increase their intake of fresh vegetables, actively treat sleep apnea syndrome, avoid passive smoking, maintain a healthy WC and seek to improve their kidney and liver function.

Hypertriglyceridemia and hyperuricemia: a retrospective study of urban residents

BackgroundThe aim of this study was to determine the association between hypertriglyceridemia and hyperuricemia (HUA).MethodsThe study was conducted in 3884 subjects who had not received medication enrolled as a baseline. Each participant received at least three annual health check-ups between 2011 and 2017. The risk of hyperuricemia was assessed in four Quartiles (Q1 to Q4) according to TG levels using multivariate-adjusted logistic regression models.ResultsThe total incidence rate of HUA was 62.3/1000 person-years. In the univariate analysis, the risk of hyperuricemia in people with hypertriglyceridemia was 2.353 times that of normal triglycerides, with a 95% confidence interval of (2.011, 2.754), and the risk of hyperuricemia in men was 1.86 times of female, and the 95% confidence interval is (1.634, 2.177). After adjusting the potential confounders, the relative risk RR of TG at Q2 Q3 Q4 was 1.445 (95%CI:1.114, 1.901), 2.075 (1.611, 2.674), 2.972 (2.322, 3.804).ConclusionsTG is an independent risk factor for hyperuricemia. As the level of TG increases, the risk of HUA increases.

Serum Bisphenol A is an independent risk factor of hyperuricemia: A 6-year prospective study

ObjectiveThis study aims to evaluate whether serum Bisphenol A (BPA) is a risk factor for hyperuricemia. MethodsIn this prospective study, a total of 482 participants without hyperuricemia were enrolled at baseline and followed up for 6 years. Clinical characteristics were recorded, and serum levels of uric acid and BPA were measured. Participants were stratified into tertiles according to low, median, and high baseline serum BPA levels. Regression models were used to analyze associations of serum BPA with the change in uric acid and the risk of developing hyperuricemia. ResultsAt baseline, serum concentrations of BPA was 0.51 (0.24–2.37) ng/mL. After 6 years of follow-up, the change in serum uric acid concentration from baseline to the 6-year mark was significantly higher in subjects with higher baseline BPA concentration (0.03 ± 0.19, 0.07 ± 0.21, and 0.11 ± 0.25mg/dL for low, median, and high tertiles, respectively, P = 0.006). When adjusted for potential confounders, such as age, renal function, and history of diabetes and hypertension, multivariable logistic analyses showed that subjects in the median or high baseline BPA tertiles exhibited a twofold higher risk of 6-year hyperuricemia incidence compared to subjects in the low baseline BPA tertile [odds ratio (OR) = 2.28 (95% CI: 1.05–4.95) for the median tertile; 2.42 (1.07–5.48) for the high tertile, Pfor Trend = 0.043]. ConclusionIn conclusion, serum BPA is an independent risk factor for hyperuricemia.

Higher triglyceride level predicts hyperuricemia: A prospective study of 6-year follow-up

Despite abundant evidence indicating that higher triglyceride (TG) levels are associated with increased risks of hyperuricemia (HUA), it is unclear whether TG levels can independently predict the incidence of HUA. The aim of the study was to investigate whether TG is an independent risk factor of HUA in a cohort study. We explored the relationship between TG levels and HUA in a dynamic cohort established in 2009. During the 6years of follow-up, 5442 subjects without HUA were studied. We divided subjects into 4 groups based on baseline TG levels and used the Cox hazard regression model to estimate HUA risk by TG quartile, after adjustment for potential confounding factors. Kaplan-Meier survival analysis compared the risk of HUA incidence among individuals in each TG quartile. The incidence of HUA in this cohort was 25.9%. The hazard ratios (95% confidence intervals) for HUA in the second, third, and fourth TG quartiles, compared with the first quartile, were 1.19 (1.01-1.40), 1.33 (1.13-1.57), and 1.62 (1.37-1.92), respectively. The Kaplan-Meier survival analysis suggested that higher TG levels predicted higher incidences of HUA in a dose-dependent relationship. Stratification analyses showed that the association between TG levels and the presence of HUA was more pronounced in individuals aged <50years, of obese, with normal estimated glomerular filtration rate, and with hypertension. Our findings suggest that TG level is a significant and independent risk factor for HUA.

The associations between adenosine triphosphate binding cassette subfamily G member-2 single nucleotide polymorphism and hyperuricemia in a Chinese tertiary hospital faculty cohort

Objective: To investigate gender specific association between single nucleotide polymorphism rs2231142 and hyperuricemia. Method: A matched case-control study was conducted in a faculty cohort of a tertiary hospital in Beijing. The enrollment criteria were faculty member of the hospital with signed consent. The exclusion criteria were tumor, previous renal diseases, renal function damage, pregnancy, currently taking medicines that could increase or decrease serum uric acid level, and those who had gout. Males with serum uric acid>416.4 μmol/L and females with serum uric acid> 359.6 μmol/L were enrolled as hyperuricemia group. Subjects with normal serum uric acid were randomly enrolled at 1∶2 ratio after matching for gender, age, renal function and body mass index. Rs2231142(C>A) was assayed by amplification refractory mutation system polymerase chain reaction, with common forward primer: 5' GGCTTTGCAGACATCTATGG 3', C specific reverse primer: 5'CGAAGAGCTGCTGAGAAATG 3', and A specific reverse primer: 5' CGAAGAGCTGCTGAGAAATT 3'.Association between rs2231142 and hyperuricemia was analyzed in the general study group, as well as different gender and age groups. Results: A total of 198 subjects with hyperuricemia and 370 controls were enrolled. The A allele frequency of rs2231142 was significantly higher in the hyperuricemia group than control group (38.38% vs 26.62%, P<0.001), with an OR for hyperuricemia of 2.89 (95%CI 1.91-4.37, P<0.001). After adjustment for hypertension, hyperglycemia and dyslipidemia, the OR was 2.99 (95%CI 1.94 - 4.62, P<0.001). Subgroup analysis showed that the ORs were 3.83 (95%CI 2.03-7.24, P<0.001) in male and 2.30 (95%CI 1.32-4.00, P=0.003) in female. In those 55 years or older, the gender differences of ORs were decreased, with ORs of 3.23 (95%CI 1.02-10.29, P=0.047) in male and 3.06 (95%CI 1.37-6.84, P=0.006) in female. While in those less than 55 years, the gender differences of ORs were enlarged, with ORs of 4.11 (95%CI 1.92-8.79, P<0.001) in males and 1.73 (95%CI 0.80-3.76, P=0.165) in females. Interaction study between gender and rs2231142 did not reach significant level in both the gender group and two age groups. Conclusion: Single nucleotide polymorphism rs2231142 A allele is an independent risk factor for hyperuricemia in this tertiary hospital faculty cohort. The ORs are higher in male than those in female, especially in those less than 55 years old.

Analysis of correlation between hyperuricemia and blood lipids of the elderly in Hebei Renqiu

Objective To investigate the hyperuricemia(HUA)and the correlation of blood lipids of the 60-70years peple in Renqiu area, and to provide the basis for guiding prevention and treatment of the elderly disease the region. Methods According to the cluster random sampling method, Renqiu permanent residents with the age of 60 to 70 years were selected as a screening object. In the total 5 010 cases screened object, 2 163 were male(43.2%),2 847 were female(56.8%), with an average age of(64.29±3.05)years. The data of blood uric acid and total cholesterol(TC), triglyceride(TG), high-density lipoprotein(HDL-C), low-density lipoprotein(LDL-C)were collected. The rela-tionship between blood uric acid and blood lipids were analyzed. Logistic regression method was used to analysis the relationship between the hyperuricemia and lipids components. Results The overall prevalence of hyperuricemia in Renqiu was 6.1%(9.8% in male,3.2% in female). In men HUA group, the levels of blood uric acid, TG and LDL -L were 464.10(438.00-508.65)μmol／L,1.54(1.00-2.19)mmol／Land 2.66(2.25-3.22)mmol／L, which were higher than those of normal uric acid group of 294.00(249.90-338.08)μmol／L,1.13(0.84-1.65)mmol／L and 2.57(2.12-3.01)mmol／L(P＜0.05). In women HUA group, the levels of blood uric acid, TG and LDL-L were 454.15(434.15-480.78)μmol／L,2.14(1.47-3.18)mmol／L and 2.96(2.52-3.76)mmol／L, which were higher than those of normal uric acid group of 250.80(209.00-299.80)μmol／L,1.53(1.10-2.20)mmol／L and 2.87(2.40-3.33)mmol／L(P＜0.05). Logistic multi-factor regression analysis showed that TG was an independ-ent risk factor for hyperuricemia, and that HDL-L and gender were protective factors. Conclusion Hyperuricemia is closely associated with blood lipid, especially with TG and HDL-L, so we could screening HUA by blood lipid, which can reduce the occurrence of cardiovascular disease effectively. Key words: Uric acid; Hyperuricemia; Blood lipid

The prevalence of hyperuricemia and its relationship to blood lipids in a population for routine check-up in Nanning, Guangxi province

In 4 602 subjects for routine check-up,blood uric acid,total cholesterol,triglyceride,high density lipoprotein-cholesterol,and low density lipoprotein-cholesterol were determined.Results showed that the overall prevalence of hyperuricemia in Nanning,Guangxi was 19.8％ (28.8％ in male,9.4％ in female).Blood uric acid and lipids in hyperuricemia group were higher than those in normal uric acid group(all P＜0.01).Serum uric acid had a positive correlation with total cholesterol,triglyceride,low density lipoprotein-cholesterol,but it was negatively correlated with serum high density lipoprotein-cholesterol.The prevalence of hypercholesterolemia was 30.8％,and that of hypertriglyceridemia was 22.2％.Logistic multi-factor regression analysis showed that men,high total cholesterol,triglyceride,and low density lipoprotein-cholesterol could be independent risk factors for hyperuricemia,and that high density lipoprotein-cholesterol was a protective factor.The prevalence of hyperuricemia in population of Nanning,Guangxi during health examination is high.Hyperuricemia is closely associated with dyslipidemia.Timely intervention of hyperuricemia can reduce the related diseases effectively. Key words: Uric acid ; Hyperuricemia; Blood lipid

Trp64Arg (rs4994) polymorphism of β3-adrenergic receptor gene is associated with hyperuricemia in a Chinese male population

β3-Adrenergic receptor (β3-AR) gene is associated with insulin resistance and may affect serum uric acid levels. Our aim was to determine the possible association between β3-AR gene Trp64Arg polymorphism (rs4994) and hyperuricemia in a Chinese male population. A total of 410 hyperuricemic and 420 normouricemic male subjects were genotyped in this study. The genotypic and allelic frequencies were compared between the two groups. Body mass index (BMI), waist to hip ratio (WHR), systolic blood pressure (SBP), diastolic blood pressure (DBP), serum uric acid, urea nitrogen, creatinine, triglyceride, total cholesterol, low-density lipoprotein-cholesterol (LDL-C), high-density lipoprotein-cholesterol (HDL-C) and fasting plasma glucose (FPG) were determined. The frequencies of CC genotype and C allele for Trp64Arg polymorphism were higher in hyperuricemic group than in normouricemic group (p<0.01 and p<0.05, respectively). In both hyperuricemic and normouricemic groups, subjects with mutated C allele of Trp64Arg polymorphism showed significantly higher average uric acid levels than TT genotype carriers (p<0.01 and p<0.01, respectively). Univariate and multivariate logistic regression showed that carrier of mutated C allele of Trp64Arg polymorphism was significantly associated with hyperuricemia occurrence (p=0.003, OR=1.587, 95% CI 1.175-2.145 and p=0.003, OR=1.676, 95% CI 1.051-3.617). Trp64Arg polymorphism was associated with hyperuricemia in a Chinese male population and should be an independent risk factor for hyperuricemia.

Meta-Analysis of the Association of the C677T Polymorphism of the Methylenetetrahydrofolate Reductase Gene with Hyperuricemia

Background: The association between the MTHFR C677T polymorphism and hyperuricemia has been investigated in several studies. Although these epidemiological studies have shown that genetic factors are determinants of serum uric acid levels, the power of the association is weak due to the small sample size. Methods: To study whether the MTHFR C677T polymorphism has an effect on hyperuricemia, we carried out a meta-analysis of case-control studies from PubMed, EMBASE and CNKI (China National Knowledge Infrastructure) databases mainly in English and Chinese. We used the odds ratio (OR) as main effect size; explored potential sources of heterogeneity; performed subgroup analyses by race and performed sensitivity analyses of studies meeting the Hardy-Weinberg equilibrium (HWE). Results: Six studies with 1,470 subjects were included in the meta-analysis. Tests for heterogeneity showed the difference in OR among studies was not statistically significant (p = 0.63, I² = 0). When excluding the study of Caucasians not in HWE, the association remained robust (OR = 1.82, 95% CI 1.52-2.17) in the East Asian subgroup and sensitivity analyses. Conclusions: Although the mechanism of the relationship between the C677T polymorphism and uric acid still remains unclear, these original articles showed that the MTHFR C677T polymorphism may be an independent risk factor for hyperuri-cemia.

Uric acid: A surrogate of insulin resistance in older women

Objectives The relationship between serum uric acid (UA) and cardiovascular disease has been debated extensively and no conclusion has been reached yet. The main purpose of this study was to explore the sex-different relationship among insulin resistance, metabolic syndrome (MS) and hyperuricemia. Methods A community-based prospective study was conducted among people aged over 40 years in I-Lan County, Taiwan. A complete history taking, physical examination and laboratory tests were performed for each subject by the well-trained research staff. Insulin resistance was determined by the homeostasis model assessment (HOMA-IR). Serial comparisons were performed to evaluate the associations between MS, insulin resistance and hyperuricemia in both sexes. Results A total of 852 subjects (mean age = 64.6 ± 11.3 years, 56.7% female) were enrolled. The prevalence of obesity, hyperuricemia, chronic kidney disease (CKD), insulin resistance and MS was 42.2, 31.2, 30.9, 36.0 and 47.5%, respectively. Subjects with MS were significantly older (63.4 ± 10.0 years versus 60.4 ± 12.4 years, P = 0.019), higher in body mass index (BMI) (26.3 ± 3.5 kg/m 2 versus 23.6 ± 3.0 kg/m 2, P < 0.001), serum UA (6.1 ± 2.1 mg/dl versus 5.5 ± 1.7 mg/dl, P = 0.003), HOMA-IR (2.7 ± 3.4 versus 1.0 ± 0.8, P < 0.001) and lower in glomerular filtration rate (GFR) (66.3 ± 17.7 ml/min/1.73 m 2 versus 72.0 ± 15.2 ml/min/1.73 m 2, P = 0.001). Male gender, CKD, BMI > 23 kg/m 2 and insulin resistance were all independent risk factor for hyperuricemia with the covariate of age. When age and BMI were controlled, females had significantly higher prevalence of CKD and insulin resistance, but less hyperuricemia than males ( P all < 0.05). Adjusted for age, BMI and GFR, hyperuricemia and MS were both independent risk factors for insulin resistance in females ( P = 0.006, <0.001, respectively). In males, MS remained significantly associated with insulin resistance ( P = 0.002) but not hyperuricemia ( P = 0.813). When age, BMI and GFR were controlled, serum UA was positively related to HOMA-IR in females ( γ = 0.117, P = 0.012), but not in males ( P = 0.93). Conclusion A positive association was identified between serum UA and insulin resistance in older women but not in men. Studies related to insulin resistance may be needed when hyperuricemia was identified in older women.