Hairpin Folding Research Articles

Measuring the Folding Landscape of a Harmonically Constrained Biopolymer

Pioneering studies have shown that the probability distribution of opening length for a DNA hairpin, recorded under constant force using an optical trap, can be used to reconstruct the energy landscape of the transition. However, measurements made under constant force are subject to some limitations. Under constant force a system with a sufficiently high energy barrier spends most of its time in the closed or open conformation, with relatively few statistics collected in the transition state region. We describe a measurement scheme in which the system is driven progressively through the transition by an optical trap and an algorithm is used to extract the energy landscape of the transition from the fluctuations recorded during this process. We illustrate this technique in simulations and demonstrate its effectiveness in experiments on a DNA hairpin. We find that the combination of this technique with the use of short DNA handles facilitates a high-resolution measurement of the hairpin's folding landscape with a very short measurement time.

Hairpin Folding Behavior of Mixed α/β-Peptides in Aqueous Solution

The invention of new strategies for the design of protein-mimetic oligomers that manifest the folding encoded in natural amino acid sequences is a significant challenge. In contrast to the α-helix, mimicry of protein β-sheets is less understood. We report here the aqueous folding behavior of a prototype α-peptide hairpin model sequence varied at cross-strand positions by incorporation of 16 different β-amino acid monomers. Our results provide a folding propensity scale for β-residues in a protein β-sheet context as well as high-resolution structures of several mixed-backbone α/β-peptide hairpins in water.

Separation of Preferential Interaction and Crowding Effects on DNA Hairpin and Duplex Formation

Solutes affect protein and nucleic acid processes as a consequence of their competition with water for biopolymer surfaces that become exposed (or buried) in the process (“preferential interactions”) and through their ability to occupy space and reduce the available volume of the solution (“crowding”). Here we develop a quantitative analysis of the molecular weight dependence both preferential interaction and crowding effects of flexible coil polymers, with the capability of interpreting or predicting effects of any flexible coil polymer on any biopolymer process. We report dependences of free energies of DNA hairpin helix unfolding and duplex dissociation on PEG concentration (PEG m-values) for EG and a wide range of PEG chain lengths. EG and small PEG oligomers are destabilizing to hairpin and duplex; with increasing PEG size this destabilization decreases so that large PEGs are only slightly destabilizing to the hairpin and stabilizing to the duplex. We conclude that contributions of preferential interactions to PEG m-values increase in proportion to the product of the amount of DNA surface exposed on melting and the amount of surface of PEG accessible to, and therefore able to interact with, this DNA surface. We further conclude that the large stabilizing effect of crowding on the duplex is due to the assembly of two reactants into product while the crowding effect on the hairpin is much weaker because hairpin folding involves only a small change in shape and not assembly of multiple reactants. Finally, we examine the concentrated PEG solution regime where PEG chains interpenetrate. NIH GM47022 and Biophysics training grant.

Loop and stem dynamics during RNA hairpin folding and unfolding

2-Aminopurine (2AP) is a fluorescent adenine analog that probes mainly base stacking in nucleic acids. We labeled the loop or the stem of the RNA hairpin gacUACGguc with 2AP to study folding thermodynamics and kinetics at both loci. Thermal melts and fast laser temperature jumps detected by 2AP fluorescence monitored the stability and folding/unfolding kinetics. The observed thermodynamic and kinetic traces of the stem and loop mutants, though strikingly different at a first glance, can be fitted to the same free-energy landscape. The differences between the two probe locations arise because base stacking decreases upon unfolding in the stem, whereas it increases in the loop. We conclude that 2AP is a conservative adenine substitution for mapping out the contributions of different RNA structural elements to the overall folding process. Molecular dynamics (MD) totaling 0.6 μsec were performed to look at the conformations populated by the RNA at different temperatures. The combined experimental data, and MD simulations lead us to propose a minimal four-state free-energy landscape for the RNA hairpin. Analysis of this landscape shows that a sequential folding model is a good approximation for the full folding dynamics. The frayed state formed initially from the native state is a heterogeneous ensemble of structures whose stem is frayed either from the end or from the loop.

Thermodynamics of RNA melting, one base pair at a time: FIGURE 1.

The melting of base pairs is a ubiquitous feature of RNA structural transitions, which are widely used to sense and respond to cellular stimuli. A recent study employing solution nuclear magnetic resonance (NMR) imino proton exchange spectroscopy provides a rare base-pair-specific view of duplex melting in the Salmonella FourU RNA thermosensor, which regulates gene expression in response to changes in temperature at the translational level by undergoing a melting transition. The authors observe "microscopic" enthalpy-entropy compensation--often seen "macroscopically" across a series of related molecular species--across base pairs within the same RNA. This yields variations in base-pair stabilities that are an order of magnitude smaller than corresponding variations in enthalpy and entropy. A surprising yet convincing link is established between the slopes of enthalpy-entropy correlations and RNA melting points determined by circular dichroism (CD), which argues that unfolding occurs when base-pair stabilities are equalized. A single AG-to-CG mutation, which enhances the macroscopic hairpin thermostability and folding cooperativity and renders the RNA thermometer inactive in vivo, spreads its effect microscopically throughout all base pairs in the RNA, including ones far removed from the site of mutation. The authors suggest that an extended network of hydration underlies this long-range communication. This study suggests that the deconstruction of macroscopic RNA unfolding in terms of microscopic unfolding events will require careful consideration of water interactions.

Free Energy Profile of RNA Hairpins: A Molecular Dynamics Simulation Study

RNA hairpin loops are one of the most abundant secondary structure elements and participate in RNA folding and protein-RNA recognition. To characterize the free energy surface of RNA hairpin folding at an atomic level, we calculated the potential of mean force (PMF) as a function of the end-to-end distance, by using umbrella sampling simulations in explicit solvent. Two RNA hairpins containing tetraloop cUUCGg and cUUUUg are studied with AMBER ff99 and CHARMM27 force fields. Experimentally, the UUCG hairpin is known to be significantly more stable than UUUU. In this study, the calculations using AMBER force field give a qualitatively correct description for the folding of two RNA hairpins, as the calculated PMF confirms the global stability of the folded structures and the resulting relative folding free energy is in quantitative agreement with the experimental result. The hairpin stabilities are also correctly differentiated by the more rapid molecular mechanics-Poisson Boltzmann-surface area approach, but the relative free energy estimated from this method is overestimated. The free energy profile shows that the native state basin and the unfolded state plateau are separated by a wide shoulder region, which samples a variety of native-like structures with frayed terminal basepair. The calculated PMF lacks major barriers that are expected near the transition regions, and this is attributed to the limitation of the 1-D reaction coordinate. The PMF results are compared with other studies of small RNA hairpins using kinetics method and coarse grained models. The two RNA hairpins described by CHARMM27 are significantly more deformable than those represented by AMBER. Compared with the AMBER results, the CHARMM27 calculated ΔG fold for the UUUU tetraloop is in better agreement with the experimental results. However, the CHARMM27 calculation does not confirm the global stability of the experimental UUCG structure; instead, the extended conformations are predicted to be thermodynamically stable in solution. This finding is further supported by separate unrestrained CHARMM27 simulations, in which the UUCG hairpin unfolds spontaneously within 10 ns. The instability of the UUCG hairpin originates from the loop region, and propagates to the stem. The results of this study provide a molecular picture of RNA hairpin unfolding and reveal problems in the force field descriptions for the conformational energy of certain RNA hairpin.

Mechanical Folding Kinetics of RNA Hairpins: a New Computational Approach

From the distribution of the low-lying states on the energy landscape, we recently developed a new computational method for the prediction of RNA folding kinetics [1]. The method can treat long sequences because it is based on a small ensemble of seed states. Additionally, the method is based on an analytic formalism and thus enables predictions for long-time folding kinetics. Applications of the new kinetic model to mechanical folding of RNA hairpins reveal distinct kinetic behaviors for a wide range of different force regimes, from zero force to forces much stronger than the critical force for the folding-unfolding transition.

Analysis of RNA Hairpin Folding by Dual Beam Fluorescence Fluctuation Spectroscopy

Hairpin formation is one of the central problems of nucleic acid folding. Experimental and theoretical results from several laboratories indicate that in many cases formation of RNA hairpin cannot be treated as a simple two-state process. We use fluorescence fluctuation spectroscopy (FFS) to characterize folding kinetics of two RNA hairpins (CGGUUUCCCUCCCACCUUUGCCG and CGGUUUUUUUUUUUUUUUUGCCG) each labeled with a fluorophore and a quencher (TAMRA and dabcyl) on the 3′ and 5′ end respectively. FFS is unique in its ability to measure relaxation rates at equilibrium, and coupling this technique to flow allows for simultaneous detection of the end-to-end contact and diffusion coefficient of the molecules. The two hairpins studied here have same stem but different loop sequences, and display different folding kinetics as a function of K+ and Mg2+ ions. The results are interpreted in light of the calculated free energy landscapes.

Hairpin Folding of HIV gp41 Abrogates Lipid Mixing Function at Physiologic pH and Inhibits Lipid Mixing by Exposed gp41 Constructs

Conformational changes in the HIV gp41 protein are directly correlated with fusion between the HIV and target cell plasma membranes, which is the initial step of infection. Key gp41 fusion conformations include an early extended conformation termed prehairpin which contains exposed regions and a final low-energy conformation termed hairpin which has a compact six-helix bundle structure. Current fusion models debate the roles of hairpin and prehairpin conformations in the process of membrane merger. In the present work, gp41 constructs have been engineered which correspond to fusion relevant parts of both prehairpin and hairpin conformations and have been analyzed for their ability to induce lipid mixing between membrane vesicles. The data correlate membrane fusion function with the prehairpin conformation and suggest that one of the roles of the final hairpin conformation is sequestration of membrane-perturbing gp41 regions with consequent loss of the membrane disruption induced earlier by the prehairpin structure. To our knowledge, this is the first biophysical study to delineate the membrane fusion potential of gp41 constructs modeling key fusion conformations.

A thermodynamic study of ferrocene modified hairpin oligonucleotides upon duplex formation: applications to the electrochemical detection of DNA

New electrochemical probes are being developed for nucleic acid detection. A ferrocenyl phosphoramidite synthon (Fc) is synthesized and then incorporated into stem-loop structured oligodeoxyribonucleotides (ODNs) by automated solid-phase DNA synthesis. The thermodynamic study shows slight destabilization of the structures obtained due to the presence of ferrocene moieties (ΔG°298 = −1.28 to −1.82 kcal mol−1 for hairpin folding and ΔG°298 = −14.66 to −17.16 kcal mol−1 for duplex) compared to the unmodified sequence (ΔG°298 = −2.04 kcal mol−1 for hairpin folding and ΔG°298 = −18.97 kcal mol−1 for duplex). When spotting these ferrocenyl stem-loop structured ODNs on a gold electrode microarray, a self-structuring of the probes occurs on the electrode surface. The hairpin opening, generated by the hybridization with the complementary nucleic acid target, induces variations in both current intensity and potential of the ferrocenyl electrochemical signal by cyclic voltammetry (CV). The effects of the number of ferrocenes in the hairpin sequences on thermodynamic stability and the electrochemical response of the probes upon DNA target hybridization are studied. These ferrocene modified stem-loop ODNs allow complementary target detection by cyclic voltammetry.

Structural Insight into RNA Hairpin Folding Intermediates

Hairpins are a ubiquitous secondary structure motif in RNA molecules. Despite their simple structure, there is some debate over whether they fold in a two-state or multi-state manner. We have studied the folding of a small tetraloop hairpin using a serial version of replica exchange molecular dynamics on a distributed computing environment. On the basis of these simulations, we have identified a number of intermediates that are consistent with experimental results. We also find that folding is not simply the reverse of high-temperature unfolding and suggest that this may be a general feature of biomolecular folding.

Folding mechanisms of individual β-hairpins in a Gō model of Pin1 WW domain by all-atom molecular dynamics simulations

This paper examines the folding mechanism of an individual beta-hairpin in the presence of other hairpins by using an off-lattice model of a small triple-stranded antiparallel beta-sheet protein, Pin1 WW domain. The turn zipper model and the hydrophobic collapse model originally developed for a single beta-hairpin in literature is confirmed to be useful in describing beta-hairpins in model Pin1 WW domain. We find that the mechanism for folding a specific hairpin is independent of whether it folds first or second, but the formation process are significantly dependent on temperature. More specifically, beta1-beta2 hairpin folds via the turn zipper model at a low temperature and the hydrophobic collapse model at a high temperature, while the folding of beta2-beta3 hairpin follows the turn zipper model at both temperatures. The change in folding mechanisms is interpreted by the interplay between contact stability (enthalpy) and loop lengths (entropy), the effect of which is temperature dependent.

Structures, Kinetics, Thermodynamics, and Biological Functions of RNA Hairpins

Most RNA comprises one strand and therefore can fold back on itself to form complex structures. At the heart of these structures is the hairpin, which is composed of a stem having Watson-Crick base pairing and a loop wherein the backbone changes directionality. First, we review the structure of hairpins including diversity in the stem, loop, and closing base pair. The function of RNA hairpins in biology is discussed next, including roles for isolated hairpins, as well as hairpins in the context of complex tertiary structures. We describe the kinetics and thermodynamics of hairpin folding including models for hairpin folding, folding transition states, and the cooperativity of folding. Lastly, we discuss some ways in which hairpins can influence the folding and function of tertiary structures, both directly and indirectly. RNA hairpins provide a simple means of controlling gene expression that can be understood in the language of physical chemistry.

Understanding β-Hairpin Formation: Computational Studies for Three Different Hairpins

We have studied the folding mechanism of <TEX>$\beta$</TEX> -hairpins in the proteins 1GB1, 3AIT and 1A2P by conducting unfolding simulations at moderately high temperatures. The analysis of trajectories obtained from molecular dynamics simulations in explicit aqueous solution suggests that the positions of the hydrophobic core residues lead to subtle differences in the details of folding dynamics. However, the folding of three different hairpins can be explained by a unified mechanism that is a blend of the hydrogen-bond-centric and the hydrophobiccentric models. The initial stage of <TEX>$\beta$</TEX>-hairpin folding involves various partially folded intermediate structures which are stabilized by both the van der Waals interactions of hydrophobic core residues and the electrostatic interactions of non-native hydrogen bonds. The native structure is obtained by forming native contacts in the final tune-up process. Depending on the relative positions of the hydrophobic residues, the actual mechanism of hairpi n folding may or may not exhibit well-defined intermediates.

Site-Specific Relaxation Kinetics of a Tryptophan Zipper Hairpin Peptide Using Temperature-Jump IR Spectroscopy and Isotopic Labeling

Two antiparallel beta-strands connected by a turn make beta-hairpins an ideal model system to analyze the interactions and dynamics of beta-sheets. Site-specific conformational dynamics were studied by temperature-jump IR spectroscopy and isotopic labeling in a model based on the tryptophan zipper peptide, Trpzip2, developed by Cochran et al. (Proc. Natl. Acad. Sci. U.S.A. 2001, 98, 5578). The modified Trpzip2C peptides have nearly identical equilibrium spectral behavior as Trpzip2 showing that they also form well-characterized beta-hairpin conformations in aqueous solution. Selective introduction of 13C=O groups on opposite strands lead to distinguishable cross-strand coupling of the labeled residues as monitored in the amide I' band. These frequency patterns reflect theoretical predictions, and the coupled 13C=O band loses intensity with increase in temperature and unfolding of the hairpin. Thermal relaxation kinetics were analyzed for unlabeled and cross-strand isotopically labeled variants. T-jumps of approximately 10 degrees C induce relaxation times of a few microseconds that decrease with increase of the peptide temperature. Differences in kinetic behavior for the loss of beta-strand and gain of disordered structure can be used to distinguish localized structure dynamics by comparison of nonlabeled and labeled amide I' components. Analysis of the data supports multistate dynamic and equilibrium behavior, but because of this process it is not possible to clearly define a folding and unfolding rate. Nonetheless, site-specific relaxation kinetics could be seen to be consistent with a hydrophobic collapse hypothesis for hairpin folding.

Probing the Complete Folding Trajectory of a DNA Hairpin Using Dual Beam Fluorescence Fluctuation Spectroscopy

The conformational fluctuations of dye-quencher labeled DNA hairpin molecules in aqueous solution were investigated using dual probe beam fluorescence fluctuation spectroscopy. The measurements revealed the flow and diffusion times of the DNA molecules through two spatially offset optical probe regions, the absolute and relative concentrations of each conformational substate of the DNA, and the kinetics of the DNA hairpin folding and unfolding reactions in the 1 micros to 10 ms time range. A DNA hairpin containing a 21-nucleotide polythymine loop and a 4-base pair stem exhibited double exponential relaxation kinetics, with time constants of 84 and 393 micros. This confirms that folding and melting of the DNA hairpin structure is not a two state process but proceeds by way of metastable intermediate states. The fast time constant corresponds to formation and unfolding of an intermediate, and the slow time constant is due to formation and disruption of the fully base-paired stem. This is consistent with a previous study of a similar DNA hairpin with a 5-base pair stem, in which the fast reaction was attributed to the fluctuations of an intermediate DNA conformation [J. Am. Chem. Soc. 2006, 128, 1240-1249]. In that case, reactions involving the native conformation could not be observed directly due to the limited observation time range of the fluorescence correlation spectroscopy experiment. The intermediate states of the DNA hairpins are suggested to be due to a collapsed ensemble of folded hairpins containing various partially folded or misfolded conformations.

An Allosteric Path to Transcription Termination

Transcription termination signals in bacteria occur in RNA as a strong hairpin followed by a stretch of U residues at the 3' terminus. To release the transcript, RNA polymerase (RNAP) is thought to translocate forward without RNA synthesis. Here we provide genetic and biochemical evidence supporting an alternative model in which extensive conformational changes across the enzyme lead to termination without forward translocation. In this model, flexible parts of the RNA exit channel (zipper, flap, and zinc finger) assist the initial step of hairpin folding (nucleation). The hairpin then invades the RNAP main channel, causing RNA:DNA hybrid melting, structural changes of the catalytic site, and DNA-clamp opening induced by interaction with the G(trigger)-loop. Our results envision the elongation complex as a flexible structure, not a rigid body, and establish basic principles of the termination pathway that are likely to be universal in prokaryotic and eukaryotic systems.

Folding of a DNA Hairpin Loop Structure in Explicit Solvent Using Replica-Exchange Molecular Dynamics Simulations

Hairpin loop structures are common motifs in folded nucleic acids. The 5′-GCGCAGC sequence in DNA forms a characteristic and stable trinucleotide hairpin loop flanked by a two basepair stem helix. To better understand the structure formation of this hairpin loop motif in atomic detail, we employed replica-exchange molecular dynamics (RexMD) simulations starting from a single-stranded DNA conformation. In two independent 36 ns RexMD simulations, conformations in very close agreement with the experimental hairpin structure were sampled as dominant conformations (lowest free energy state) during the final phase of the RexMDs (∼35% at the lowest temperature replica). Simultaneous compaction and accumulation of folded structures were observed. Comparison of the GCA trinucleotides from early stages of the simulations with the folded topology indicated a variety of central loop conformations, but arrangements close to experiment that are sampled before the fully folded structure also appeared. Most of these intermediates included a stacking of the C 2 and G 3 bases, which was further stabilized by hydrogen bonding to the A 5 base and a strongly bound water molecule bridging the C 2 and A 5 in the DNA minor groove. The simulations suggest a folding mechanism where these intermediates can rapidly proceed toward the fully folded hairpin and emphasize the importance of loop and stem nucleotide interactions for hairpin folding. In one simulation, a loop motif with G 3 in syn conformation (dihedral flip at N-glycosidic bond) accumulated, resulting in a misfolded hairpin. Such conformations may correspond to long-lived trapped states that have been postulated to account for the folding kinetics of nucleic acid hairpins that are slower than expected for a semiflexible polymer of the same size.

Impact of DNA Hairpin Folding Energetics on Antibody–ssDNA Association

Deposition of anti-DNA antibodies in the kidney contributes to the pathogenesis of the autoimmune disease, systemic lupus erythematosus. Antibodies that bind to hairpin-forming DNA ligands may be particularly prone to deposition. Here we report the first structure of a Fab complexed with hairpin-forming DNA. The ligand used for co-crystallization is 5′-d [CTG(CCTT)CAG]-3′, which has a predicted hairpin structure consisting of a four-nucleotide loop (CCTT) and a stem of three base-pairs. The 1.95 Å resolution crystal structure of Fab DNA-1 complexed with this ligand shows that the conformation of the bound ligand differs radically from the predicted hairpin conformation. The three base-pairs in the stem are absent in the bound form. The protein binds to the last six nucleotides at the 3′ end of the ligand. These nucleotides form a loop (TTCA) closed by a G:C base-pair in the bound state. Stacking of aromatic side-chains against DNA bases is the dominant interaction in the complex. Interactions with the DNA backbone are conspicuously absent. Thermodynamics of binding are examined using isothermal titration calorimetry. The apparent dissociation constant is 4 μM, and binding is enthalpically favorable and entropically unfavorable. Increasing the number of base-pairs in the DNA stem from three to six decreases binding affinity. These data suggest a conformational selection binding mechanism in which the Fab binds preferentially to the unstructured state of the ligand. In this interpretation, the ligand binding and ligand folding equilibria are coupled, with lower hairpin stability leading to greater effective binding affinity. Thus, pre-organization of the DNA loop into the preferred binding conformation does not play a major role in complexation. Rather, it is argued that the stem of the hairpin serves to reduce the degrees of freedom in the free DNA ligand, thereby limiting the entropic cost attendant to complexation with the Fab.

Coarse-Grained Protein Model Coupled with a Coarse-Grained Water Model: Molecular Dynamics Study of Polyalanine-Based Peptides.

The coupling of a coarse-grained (CG) protein model with the CG water model developed by Marrink et al. (J. Phys. Chem. B 2004, 108, 750) is presented. The model was used in the molecular dynamics studies of Ac-(Ala)6-Xaa-(Ala)7-NHMe, Xaa = Ala, Leu, Val, and Gly. A Gly mutation in the middle of polyalanine is found to destabilize the helix and stabilize the hairpin by favoring a type-II' turn and probably to speed up hairpin folding. The simulations allow us to derive thermodynamic parameters of, in particular, the helical propensities (s) of amino acids in these polyalanine-based peptides. The calculated s values are 1.18 (Ala), 0.84 (Leu), 0.30 (Val), and <0.02 (Gly) at 291 K, in excellent agreement with experimental values (R(2)=0.970). Analyses using a structural approach method show that the helical propensity difference of these amino acids mainly comes from solvation effect. Leu and Val have lower helical propensities than Ala mainly because the larger side chains shield the solvation of helical structures, while Gly has a much poorer helical propensity mainly due to the much better solvation for the coil structures than for the helical structures. Overall, the model is at least about 10(2) times faster than current all-atom MD methods with explicit solvent.