Analysis of RNA Hairpin Folding by Dual Beam Fluorescence Fluctuation Spectroscopy

Abstract

Hairpin formation is one of the central problems of nucleic acid folding. Experimental and theoretical results from several laboratories indicate that in many cases formation of RNA hairpin cannot be treated as a simple two-state process. We use fluorescence fluctuation spectroscopy (FFS) to characterize folding kinetics of two RNA hairpins (CGGUUUCCCUCCCACCUUUGCCG and CGGUUUUUUUUUUUUUUUUGCCG) each labeled with a fluorophore and a quencher (TAMRA and dabcyl) on the 3′ and 5′ end respectively. FFS is unique in its ability to measure relaxation rates at equilibrium, and coupling this technique to flow allows for simultaneous detection of the end-to-end contact and diffusion coefficient of the molecules. The two hairpins studied here have same stem but different loop sequences, and display different folding kinetics as a function of K+ and Mg2+ ions. The results are interpreted in light of the calculated free energy landscapes.