Gene Start Signal Research Articles

Non-gradient and genotype-dependent patterns of RSV gene expression.

Respiratory syncytial virus (RSV) is a nonsegmented negative-strand RNA virus (NSV) and a leading cause of severe lower respiratory tract illness in infants and the elderly. Transcription of the ten RSV genes proceeds sequentially from the 3' promoter and requires conserved gene start (GS) and gene end (GE) signals. Previous studies using the prototypical GA1 genotype Long and A2 strains have indicated a gradient of gene transcription extending across the genome, with the highest level of mRNA coming from the most promoter-proximal gene, the first nonstructural (NS1) gene, and mRNA levels from subsequent genes dropping until reaching a minimum at the most promoter-distal gene, the polymerase (L) gene. However, recent reports show non-gradient levels of mRNA, with higher than expected levels from the attachment (G) gene. It is unknown to what extent different transcript stabilities might shape measured mRNA levels. It is also unclear whether patterns of RSV gene expression vary, or show strain- or genotype-dependence. To address this, mRNA abundances from five RSV genes were measured by quantitative real-time PCR (qPCR) in three cell lines and in cotton rats infected with RSV isolates belonging to four genotypes (GA1, ON, GB1, BA). Relative mRNA levels reached steady-state between four and 24 hours post-infection. Steady-state patterns were non-gradient and genotype-specific, where mRNA levels from the G gene exceeded those from the more promoter-proximal nucleocapsid (N) gene across isolates. Transcript stabilities could not account for the non-gradient patterns observed, indicating that relative mRNA levels more strongly reflect transcription than decay. Our results indicate that gene expression from a small but diverse set of RSV genotypes is non-gradient and genotype-dependent. We propose novel models of RSV transcription that can account for non-gradient transcription.

In vitro trackable assembly of RNA-specific nucleocapsids of the respiratory syncytial virus

In vitro trackable assembly of RNA-specific nucleocapsids of the respiratory syncytial virus

Introduction of a conserved sequence into the 5′UTR of additional transcription down-regulation expression of foreign proteins of measles virus minigenome

The noncoding sequences in the UTR between the Gene Start signal (GS) and the initial codon AUG from 25 measles virus genomes were compared. The conserved sequences 5′-U(NNNNN)5-8-3′ and 5'-(CNNNNNC)-3′ were found in the genome and the UTR of phosphoprotein (P) and Fusion (F) mRNA. These sequences were named the U-Unit and the C-Unit, respectively. These two sequences are different in the P and F mRNAs.To investigate whether these conserved sequences can be used to regulate expression of foreign proteins in additional transcription units (ATU), a series of minigenomes with various 5′ UTRs were generated.From reporter gene assays and quantitation of gene copies by qPCR, we found that the introduction of the C-unit into the 5′UTR of mRNA can down-regulate the expression of foreign proteins in additional transcription units in vivo.

RNA elongation by respiratory syncytial virus polymerase is calibrated by conserved region V.

The large polymerase subunit (L) of non-segmented negative strand RNA viruses transcribes viral mRNAs and replicates the viral genome. Studies with VSV have shown that conserved region V (CRV) of the L protein is part of the capping domain. However, CRV folds over and protrudes into the polymerization domain, suggesting that it might also have a role in RNA synthesis. In this study, the role of respiratory syncytial virus (RSV) CRV was evaluated using single amino acid substitutions and a small molecule inhibitor called BI-D. Effects were analyzed using cell-based minigenome and in vitro biochemical assays. Several amino acid substitutions inhibited production of capped, full-length mRNA and instead resulted in accumulation of short transcripts of approximately 40 nucleotides in length, confirming that RSV CRV has a role in capping. In addition, all six variants tested were either partially or completely defective in RNA replication. This was due to an inability of the polymerase to efficiently elongate the RNA within the promoter region. BI-D also inhibited transcription and replication. In this case, polymerase elongation activity within the promoter region was enhanced, such that the small RNA transcribed from the promoter was not released and instead was elongated past the first gene start signal. This was accompanied by a decrease in mRNA initiation at the first gene start signal and accumulation of aberrant RNAs of varying length. Thus, in addition to its function in mRNA capping, conserved region V modulates the elongation properties of the polymerase to enable productive transcription and replication to occur.

Analysis on the complete genome of a novel caprine parainfluenza virus 3

Parainfluenza virus type 3 (PIV3) is one of the most important viral respiratory pathogens for humans and for many animals. One unique caprine PIV3 (CPIV3) strain named JS2013 was isolated in Chinese goat flocks with respiratory diseases in 2013. Now, the complete genome sequence of the strain JS2013 had been determined. A total of 15 overlapping DNA clones, covering the entire genome of the virus, were obtained by primer walking RT-PCR. The sequences of the 3′ and 5′ termini of the viral genome were amplified by 3′ and 5′ RACE. The viral genome was 15,618 nucleotides (nt) in length, which was consisted of six genes in the order 5′-leader-N-P/C/V-M-F-HN-L-tailer-3′. The junction sequences between two genes were highly conserved gene start and stop signal sequences, and trinucleotide intergenic regions (IGR) similar to those of other reported PIV3 strains. Phylogenetic analysis based on the complete genomes of JS2013 with other strains of genus Respirovirus demonstrated that the JS2013 obviously differed from HPIV1, Sendai virus, HPIV3 and other reported BPIV3 genotypes. Further analysis of HN genes of JS2013 along with two more CPIV3 strains isolated later indicated that CPIV3 strains formed a separate cluster. The results presented here suggested that CPIV3 is a new member of the genus Respirovirus.

Analysis of the highly diverse gene borders in Ebola virus reveals a distinct mechanism of transcriptional regulation.

Ebola virus (EBOV) belongs to the group of nonsegmented negative-sense RNA viruses. The seven EBOV genes are separated by variable gene borders, including short (4- or 5-nucleotide) intergenic regions (IRs), a single long (144-nucleotide) IR, and gene overlaps, where the neighboring gene end and start signals share five conserved nucleotides. The unique structure of the gene overlaps and the presence of a single long IR are conserved among all filoviruses. Here, we sought to determine the impact of the EBOV gene borders during viral transcription. We show that readthrough mRNA synthesis occurs in EBOV-infected cells irrespective of the structure of the gene border, indicating that the gene overlaps do not promote recognition of the gene end signal. However, two consecutive gene end signals at the VP24 gene might improve termination at the VP24-L gene border, ensuring efficient L gene expression. We further demonstrate that the long IR is not essential for but regulates transcription reinitiation in a length-dependent but sequence-independent manner. Mutational analysis of bicistronic minigenomes and recombinant EBOVs showed no direct correlation between IR length and reinitiation rates but demonstrated that specific IR lengths not found naturally in filoviruses profoundly inhibit downstream gene expression. Intriguingly, although truncation of the 144-nucleotide-long IR to 5 nucleotides did not substantially affect EBOV transcription, it led to a significant reduction of viral growth. Our current understanding of EBOV transcription regulation is limited due to the requirement for high-containment conditions to study this highly pathogenic virus. EBOV is thought to share many mechanistic features with well-analyzed prototype nonsegmented negative-sense RNA viruses. A single polymerase entry site at the 3' end of the genome determines that transcription of the genes is mainly controlled by gene order and cis-acting signals found at the gene borders. Here, we examined the regulatory role of the structurally unique EBOV gene borders during viral transcription. Our data suggest that transcriptional regulation in EBOV is highly complex and differs from that in prototype viruses and further the understanding of this most fundamental process in the filovirus replication cycle. Moreover, our results with recombinant EBOVs suggest a novel role of the long IR found in all filovirus genomes during the viral replication cycle.

Respiratory Syncytial Virus Polymerase Can Initiate Transcription from Position 3 of the Leader Promoter

The mechanisms by which the respiratory syncytial virus (RSV) RNA-dependent RNA polymerase (RdRp) initiates mRNA transcription and RNA replication are poorly understood. A previous study, using an RSV minigenome, suggested that the leader (Le) promoter region at the 3' end of the genome has two initiation sites, one at position +1, opposite the 3' terminal nucleotide of the genome, and a second site at position +3, at a sequence that closely resembles the gene start (GS) signal of the RSV L gene. In this study, we show that the +3 initiation site of the Le is utilized with apparently high frequency in RSV-infected cells and yields small RNA transcripts that are heterogeneous in length but mostly approximately 25 nucleotides (nt) long. Experiments with an in vitro assay in which RSV RNA synthesis was reconstituted using purified RdRp and an RNA oligonucleotide showed that nt 1 to 14 of the Le promoter were sufficient to signal initiation from +3 and that the RdRp could access the +3 initiation site without prior initiation at +1. In a minigenome assay, nucleotide substitutions within the Le to increase its similarity to a GS signal resulted in more-efficient elongation of the RNA initiated from position +3 and a reduction in RNA initiated from the NS1 gene start signal at +45. Taken together, these data suggest a new model for initiation of sequential transcription of the RSV genes, whereby the RdRp initiates the process from a gene start-like sequence at position +3 of the Le.

Evaluation of the genetic diversity of avian paramyxovirus type 4

Avian paramyxoviruses (APMVs) belong to the genus Avulavirus in the family Paramyxoviridae and include at least nine serotypes, APMV-1 to -9, as well as two additional provisional serotypes. Newcastle disease virus (NDV), which comprises APMV-1, is the most extensively studied APMV because it is an important poultry pathogen. A moderate level of antigenic and genetic diversity is recognized for APMV-1 isolates, but our knowledge of the antigenic and genetic diversity of the other APMV serotypes is limited. APMV-4 is frequently isolated from waterfowl around the world. To date complete genome sequences of APMV-4 are available for only strains, which were isolated from ducks in Hong Kong, Korea and Belgium over a period of 37 years. We have carried out genome sequencing from the nucleocapsid (N) gene-end signal to the polymerase (L) gene-start signal of five APMV-4 strains recently isolated from Italy. Each of the eight APMV-4 strains has the same F protein cleavage site, DIQPR↓F. They also share a high level of nucleotide and amino acid sequence identity: for example, the F and HN glycoproteins have greater than 97% sequence identity between the various strains. Thus, comparison of these eight strains of APMV-4 did not provide evidence of substantial diversity, in contrast to similar studies with APMV-2, -3, and -6, in which the F and HN glycoproteins exhibited up to 20–30% amino acid sequence variation within a subgroup. Reciprocal cross-HI assay using post infection chicken sera also failed to detect significant antigenic variation among the available APMV-4 strains.

Viral detection using DNA functionalized gold filaments.

Early detection of pediatric viruses is critical to effective intervention. A successful clinical tool must have a low detection limit, be simple to use and report results quickly. No current method meets all three of these criteria. In this report, we describe an approach that combines simple, rapid processing and label free detection. The method detects viral RNA using DNA hairpin structures covalently attached to a gold filament. In this design, the gold filament serves both to simplify processing and enable fluorescence detection. The approach was evaluated by assaying for the presence of respiratory syncytial virus (RSV) using the DNA hairpin probe 5' [C6Thiol]TTTTTTTTTTCGACGAAAAATGGGGCAAATACGTCG[CAL] 3' covalently attached to a 5 cm length of a 100 microm diameter gold-clad filament. This sequence was designed to target a portion of the gene end-intergenic gene start signals which is repeated multiple times within the negative-sense genome giving multiple targets for each strand of genomic viral RNA present. The filament functionalized with probes was immersed in a 200 microm capillary tube containing viral RNA, moved to subsequent capillary tubes for rinsing and then scanned for fluorescence. The response curve had a typical sigmoidal shape and plateaued at about 300 plaque forming units (PFU) of viral RNA in 20 microL. The lower limit of detection was determined to be 11.9 PFU. This lower limit of detection was approximately 200 times better than a standard comparison ELISA. The simplicity of the core assay makes this approach attractive for further development as a viral detection platform in a clinical setting.

Complete genome sequence of Nariva virus, a rodent paramyxovirus

Nariva virus (NarPV) was isolated from forest rodents (Zygodontomys b. brevicauda) in eastern Trinidad in the early 1960s. Initial classification within the family Paramyxoviridae was based mainly on morphological observations including the structure of nucleocapsids and virion surface projections. Here, we report the characterization of the complete genome sequence of NarPV. The genome is 15,276 nucleotides in length, conforming to the rule-of-six, and has a genome organization typical of most members of the family, with six transcriptional units in the order 3′-N–P-M-F–H-L-5′. The gene junctions contain highly conserved gene start and stop signals and a tri-nucleotide intergenic sequence present in most members of the subfamily Paramyxovirinae. Sequence comparison studies indicate that NarPV is most closely related to Mossman virus, which was isolated from wild rats (Rattus leucopus) in Queensland, Australia, in 1970. This study confirmed the classification of NarPV as a member of the subfamily Paramyxovirinae and established the close genome organization and sequence relationship between the two rodent paramyxoviruses isolated almost a decade apart and from two locations separated by more than 15,000 km.

The VSV polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation

Transcription by the vesicular stomatitis virus (VSV) polymerase has been characterized as obligatorily sequential with transcription of each downstream gene dependant on termination of the gene immediately upstream. In studies described here we investigated the ability of the VSV RNA-dependant RNA polymerase (RdRp) to access mRNA initiation sites located at increasing distances either downstream or upstream of a transcription termination signal. Bi-cistronic subgenomic replicons were constructed containing progressively extended intergenic regions preceding the initiation site of a downstream gene. The ability of the RdRp to access the downstream sites was progressively reduced as the length of the intergenic region increased. Alternatively, bi-cistronic replicons were constructed containing an mRNA start signal located at increasing distances upstream of a termination site. Analysis of transcription of these “overlapped” genes showed that for an upstream mRNA start site to be recognized it had to contain not only the canonical 3′-UUGUCnnUAG-5′ gene start signal, but that signal needed also to be preceded by a U7 tract. Access of these upstream mRNA initiation sites by the VSV RdRp was proportionately reduced with increasing distance between the termination site and the overlapped initiation signal. Possible mechanisms for how the RdRp accesses these upstream start sites are discussed.

Measles virus minigenomes encoding two autofluorescent proteins reveal cell-to-cell variation in reporter expression dependent on viral sequences between the transcription units

Transcription from morbillivirus genomes commences at a single promoter in the 3' non-coding terminus, with the six genes being transcribed sequentially. The 3' and 5' untranslated regions (UTRs) of the genes (mRNA sense), together with the intergenic trinucleotide spacer, comprise the non-coding sequences (NCS) of the virus and contain the conserved gene end and gene start signals, respectively. Bicistronic minigenomes containing transcription units (TUs) encoding autofluorescent reporter proteins separated by measles virus (MV) NCS were used to give a direct estimation of gene expression in single, living cells by assessing the relative amounts of each fluorescent protein in each cell. Initially, five minigenomes containing each of the MV NCS were generated. Assays were developed to determine the amount of each fluorescent protein in cells at both cell population and single-cell levels. This revealed significant variations in gene expression between cells expressing the same NCS-containing minigenome. The minigenome containing the M/F NCS produced significantly lower amounts of fluorescent protein from the second TU (TU2), compared with the other minigenomes. A minigenome with a truncated F 5' UTR had increased expression from TU2. This UTR is 524 nt longer than the other MV 5' UTRs. Insertions into the 5' UTR of the enhanced green fluorescent protein gene in the minigenome containing the N/P NCS showed that specific sequences, rather than just the additional length of F 5' UTR, govern this decreased expression from TU2.

Mutational analysis of the gene start sequences of pneumonia virus of mice

The transcriptional start sequence of pneumonia virus of mice is more variable than that of the other pneumoviruses, with five different nine-base gene start (GS) sequences found in the PVM genome. The sequence requirements of the PVM gene start signal, and the efficiency of transcriptional initiation of the different virus genes, was investigated using a reverse genetics approach with a minigenome construct containing two reporter genes. A series of GS mutants were created, where each of the nine bases of the gene start consensus sequence of a reporter gene was changed to every other possible base, and the resulting effect on initiation of transcription was assayed. Nucleotide positions 1, 2 and 7 were found to be most sensitive to mutation whilst positions 4, 5 and 9 were relatively insensitive. The L gene GS sequence was found to have only 20% of the activity of the consensus sequence whilst the published M2 gene start sequence was found to be non-functional. A minigenome construct in which the two reporter genes were separated by the F-M2 gene junction of PVM was used to confirm the presence of two alternative, functional, GS sequences that could both drive the transcription of the PVM M2 gene.

Roles of Human Parainfluenza Virus Type 3 Bases 13 to 78 in Replication and Transcription: Identification of an Additional Replication Promoter Element and Evidence for Internal Transcription Initiation

The genomic promoter of human parainfluenza virus type 3 (HPIV3) contains multiple cis-elements controlling transcription and replication. Previous work showed that regions 1 to 12 and 79 to 96 were critical in promoting replication of an HPIV3 minireplicon, while the intergenic sequence and N gene start signal (IS/Ngs, bases 49 to 61) were important for transcription. Because these data were collected primarily using point mutations, not every base from position 1 to 96 was analyzed, and some important control elements may have been missed. To clarify the role of bases 13 to 78 in transcription and replication, a series of mutations were made which collectively scanned this entire region. Mutation of bases 13 to 28 resulted in markedly decreased HPIV3 minireplicon replication, indicating these bases constitute an additional cis-element involved in the synthesis of the HPIV3 antigenomic RNA. The position dependence of the IS/Ngs was also examined. Analysis of mutants in which the IS/Ngs was shifted 5' or 3' showed that this segment could be moved without significantly disrupting transcription initiation. Additional mutants which contained two successive IS/Ngs segments were created to test whether the polymerase accessed the gene start signal by proceeding along the template 3' to 5' or by binding internally at the gene start signal. Based on analysis of the double gene start mutants, we propose a model of internal transcription initiation in which the polymerase enters the template at approximately the location of the natural N gene start but then scans the template bidirectionally to find a gene start signal and initiate transcription.

Evidence that the Respiratory Syncytial Virus Polymerase Is Recruited to Nucleotides 1 to 11 at the 3′ End of the Nucleocapsid and Can Scan To Access Internal Signals

The 3'-terminal end of the respiratory syncytial virus genomic RNA contains a 44-nucleotide leader (Le) region adjoining the gene start signal of the first gene. Previous mapping studies demonstrated that there is a promoter located at the 3' end of Le, which can signal initiation of antigenome synthesis. The aim of this study was to investigate the role of the 3' terminus of the RNA template in (i) promoter recognition and (ii) determining the initiation site for antigenome synthesis. A panel of minigenomes containing additional sequence at the 3' end of the Le were analyzed for their ability to direct antigenome and mRNA synthesis. Minigenomes containing heterologous extensions of 6 nucleotides or more were unable to support efficient RNA synthesis. However, the activity of a minigenome with a 56-nucleotide extension could be restored by insertion of Le nucleotides 1 to 11 or 1 to 13 at the 3' end, indicating that these nucleotides, in conjunction with the 3' terminus, are sufficient to recruit polymerase to the template. Northern blot and 5' rapid amplification of cDNA ends analysis of antigenome RNA indicated that antigenome initiation occurred at the first position of Le, irrespective of the terminal extension. This finding demonstrates that the 3' terminus of the RNA is not necessary for determining the antigenome initiation site. Data are presented which suggest that following recruitment to a promoter at the 3' end of Le, the polymerase is able to scan and respond to a promoter signal embedded within the RNA template.

Identification of internal sequences in the 3' leader region of human respiratory syncytial virus that enhance transcription and confer replication processivity.

Previous studies of respiratory syncytial virus have shown that the 44-nucleotide (nt) leader (Le) region is sufficient to initiate RNA replication, producing antigenome RNA, and that the Le and adjoining gene start (GS) signal of the first gene are sufficient to initiate transcription, producing mRNA. A cis-acting element necessary for both transcription and replication was mapped within the first 11 nt at the 3' end of Le. In the present study the remainder of the Le region was mapped to identify sequences important for transcription and replication. A series of minigenomes with mutant Le sequences was generated, and their ability to direct transcription and replication was determined by Northern blot analysis, which examined full-length antigenome and mRNA, and by primer extension analysis, which examined antigenome and mRNA initiation. With regard to transcription, nt 36 to 43, located immediately upstream of the GS signal, were found to be necessary for optimal levels of mRNA synthesis, although the GS signal in conjunction with the 3'-terminal region of Le was sufficient to direct accurate mRNA synthesis initiation. With regard to replication, the first 15 nt of Le were found to be sufficient to direct initiation of antigenome synthesis, but nt 16 to 34 were required in addition for efficient encapsidation and production of full-length antigenome. Analysis of transcripts produced from di- and tricistronic minigenomes indicated that a significant proportion of abortive replicases continue RNA synthesis to the end of the first gene and then continue in a transcription mode along the remainder of the genome.

Mapping of the RNA promoter of Newcastle disease virus

The RNA promoters of the genome and antigenome of Newcastle disease virus (NDV) were studied by mutational analysis of their 3′ terminal ends. Similarly to other paramyxoviruses, NDV RNA replication follows the rule of six, and the genomic and antigenomic promoters require two discontinuous regions: conserved region I (first 18 nucleotides) and conserved region II (nucleotides 73–90). Proper spacing between those regions and the phase of six in region II is critical for efficient RNA promoter activity. As expected, the gene start signal at the 3′ end of the NDV genome was required for mRNA transcription, but not for RNA replication. Surprisingly, mutation of the polyadenylation signal in the 5′ end did not affect gene expression transcription. Although the conserved region I of NDV (avulavirus) promoter appears to be more similar to that of Sendai virus (SeV) (respirovirus), conserved region II is analogous to that of rubulaviruses.

Complete nucleotide sequences of Nipah virus isolates from Malaysia.

We have completely sequenced the genomes of two Nipah virus (NiV) isolates, one from the throat secretion and the other from the cerebrospinal fluid (CSF) of the sole surviving encephalitic patient with positive CSF virus isolation in Malaysia. The two genomes have 18246 nucleotides each and differ by only 4 nucleotides. The NiV genome is 12 nucleotides longer than the Hendra virus (HeV) genome and both genomes have identical leader and trailer sequence lengths and hexamer-phasing positions for all their genes. Both NiV and HeV are also very closely related with respect to their genomic end sequences, gene start and stop signals, P gene-editing signals and deduced amino acid sequences of nucleocapsid protein, phosphoprotein, matrix protein, fusion protein, glycoprotein and RNA polymerase. The existing evidence demonstrates a clear need for the creation of a new genus within the subfamily Paramyxovirinae to accommodate the close similarities between NiV and HeV and their significant differences from other members of the subfamily.

Functional analysis of the genomic and antigenomic promoters of human respiratory syncytial virus.

The promoters involved in transcription and RNA replication by respiratory syncytial virus (RSV) were examined by using a plasmid-based minireplicon system. The 3' ends of the genome and antigenome, which, respectively, contain the 44-nucleotide (nt) leader (Le) and 155-nt trailer-complement (TrC) regions, should each contain a promoter for RNA replication. The 3' genome end also should have the promoter for transcription. Substitution for the Le with various lengths of TrC demonstrated that the 3'-terminal 36 nt of TrC are sufficient for extensive (but not maximal) replication and that when juxtaposed with a transcription gene-start (GS) signal, this sequence was also able to direct transcription. It was also shown that the region of Le immediately preceding the GS signal of the first gene could be deleted with either no effect or with a slight decrease in transcription initiation. Thus, the TrC is competent to direct transcription even though it does not do so in nature, and the partial sequence identity it shares with the 3' end of the genome likely represents the important elements of a conserved promoter active in both replication and transcription. Increasing the length of the introduced TrC sequence incrementally to 147 nt resulted in a fourfold increase in replication and a nearly complete inhibition of transcription. These two effects were unrelated, implying that transcription and replication are not interconvertible processes mediated by a common polymerase, but rather are independent processes. The increase in replication was specific to the TrC sequence, implying the presence of a nonessential, replication-enhancing cis-acting element. In contrast, the inhibitory effect on transcription was due solely to the altered spacing between the 3' end of the genome and GS signal, which implies that the transcriptase recognizes the first GS signal as a promoter element. Neither the enhancement of replication nor the inhibition of transcription was due to increased base-pairing potential between the 3' and 5' ends. The relative strengths of the Le and TrC promoters for directing RNA synthesis were compared and found to be very similar. Thus, these findings highlighted a high degree of functional similarity between the RSV antigenomic and genomic promoters, but provided a further distinction between promoter requirements for transcription and replication.

Precise Mapping of the Replication and Transcription Promoters of Human Parainfluenza Virus Type 3

The terminal RNA regions of the genomic and antigenomic RNAs of the paramyxoviruses and rhabdoviruses are known to contain sequences essential for directing RNA replication and transcription. The 3′ terminus (leader region) of the negative-sense, genomic RNA of the rhabdoviruses and paramyxoviruses is known as the leader (Le) promoter and directs synthesis of positive-sense replication and transcription products. The 3′ terminus of the antigenome is termed the trailer complementary (TrC) promoter and directs the synthesis of genomic RNA. By creating mutations in the corresponding regions of an HPIV3 minireplicon in which the viral protein coding sequences were replaced by the luciferase gene, we were able to precisely define the elements of the leader promoter involved in directing positive-strand replication of HPIV3. Nucleotides 1 through 12 (from the terminus) formed a domain critical for replication. The region from nucleotides 13 through 55 was important but not crucial for replication, while G residues at positions 79, 85, and 91 comprised another domain critical for replication. It was also shown that the TrC promoter is similar, though not identical, to the Le promoter. Nucleotides 1 through 12 of the TrC promoter were critical for synthesis of genomic RNA, though specific positions behaved differently from the corresponding positions of the Le promoter. While many of these mutations could not be analyzed for transcription because they completely abrogated genomic RNA synthesis (the template for transcription), we were surprised to find that no mutations in the leader promoter which decreased replication had any significant effect on transcription. However, mutations in the intergenic sequence and gene start signal following the leader and preceding the luciferase message severely decreased transcription, but not replication.