Human Chromosome Fragments Research Articles

Monoclonal antibodies specific for human chromosome 5 obtained with a monochromosomal hybrid can be used to sort out cells containing the chromosome with a FACS

Using a human-mouse monochromosomal hybrid, BG15-6, that contains an intact human chromosome 5, we isolated four monoclonal antibodies, 2A10, 3H9, 5G9, and 6G12, as chromosome marker antibodies recognizing cell surface antigens specific for human chromosome 5. The binding patterns of these antibodies to BG15 subclones containing fragments of human chromosome 5 indicated that 2A10, 3H9, and 6G12 recognized the antigens produced by genes located on 5pter-q22, and that 5G9 recognized the antigen produced by a gene located on 5q23. Cells containing human chromosome 5 were very effectively sorted in a fluorescence-activated cell sorter (FACS) using monoclonal antibody 6G12. This method for sorting cells containing human chromosome 5 or an appropriate fragment of this chromosome from among human-rodent hybrid cells should be very useful in studies on gene expression, gene cloning and gene mapping.

Human-specific amplification of radiation hybrid DNA fractionated by pulsed-field gel electrophoresis

Recently, a method named interspersed repetitive sequence polymerase chain reaction (IRS-PCR) was described by which, using primers directed against an IRS, human DNA sequences flanked by the IRS are selectively amplified from complex DNA mixtures such as somatic cell hybrid DNA (1,2). Hybrids containing human chromosomal fragments, such as radiation hybrids (RH) (3, 4), have been used to further reduce the complexity of the human DNA template and increase the specificity of IRS-PCR amplification (5). Here we describe a method which facilitates the isolation of specific DNA sequences from a subchromosomal region. We have developed a method to amplify human-specific DNA sequences from pulsed-field gel (PFGE) fractionated RH DNA; by amplifying a fraction of digested RH DNA containing an identifiable DNA restriction fragment, this method provides a means to selectively amplify and enrich for DNA sequences contained within a specific DNA restriction fragment. Genomic DNA from RH 128, a RH harboring about 10% of a human X chromosome including region Xpl 1.22-Xpl 1.1 (P.N.Goodfellow and J.L.Gorski, unpublished data), was prepared in agarose blocks (6) and digested with SfiI (NEB). DNA blocks were loaded into 1.2% LMP agarose gels (BRL) made with 0.5 xTBE and electrophoresed using a contourclamped homogeneous electric field (CHEF) gel system (CHEFDRII; BioRad) at 200 V with pulse times of 60s (15 hrs) and 90s (9 hrs). Horizontal 5 mm gel slices were cut; DNA was recovered by electroelution, dialyzed against TE, sequentially extracted with phenol, chloroform, and ether, precipitated using ammonium acetate, ethanol, and carrier yeast tRNA (10 gg/ml), and resuspended in 50 Al of dH2O. PCRs were 100 ,tl in volume and contained 400 ng of DNA, 50 mM KCl, 10 mM Tris-HCl, 1.6 mM MgCl2, 0.01% gelatin, 250 uM each dNTP, 1 itg RNase A, and 0.5 ,tM primer; the primer, A-517N (5' AAGTGCGGCCGCGATCTCGGCTCACTGCAA 3'), was directed against a consensus Alu repetitive sequence (1) modified to contain a 5' NotI restriction endonuclease recognition sequence. PCR reactions were incubated at 37°C for 1 hr, 94°C for 9 min, and after the addition of 5 U AmpliTaq DNA polymerase (PerkinElmer/Cetus), 36 cycles of 94°C denaturation (1 min), 55°C annealing (1 min), and 72°C extension (4 min) were performed; amplification products were fractionated on a 1.2% agarose gel and stained with ethidium bromide. No products resulted from the amplification of hamster DNA indicating that the primer was specific for human DNA (Fig. 1). Amplification of hybrid DNA containing only a human X chromosome yielded a large number of products while amplification of RH 128 DNA and RH 128 DNA digested with Sfil yielded an identical subset of products (Fig. 1); Sfil-digested RH 128 DNA isolated from LMP agarose (Fig. 1; RH 128 Sfil gp) yielded a reduced but similar pattern of products. Compared to RH 128 DNA, amplification of a fraction of RH 128 DNA (450-500 kb) recovered from a preparative CHEF gel yielded relatively fewer products consistent with a further reduction of human template DNA complexity; the pattern of products observed upon the amplification of similar

A novel and rapid method for isolating sequences adjacent to rare cutting sites and their use in physical mapping

We describe a simple PCR based technique which can be used to isolate sequences adjacent to rare cutter sites and can subsequently be employed for the construction of long range physical maps. The method involves the ligation of an adaptor to rare cutter sequences and its use as a target for forward priming in PCR. Primers to Alu repeat elements initiate synthesis of the reverse strand. Using this technique any rare cutter site which has a repeat element within amplification range can be cloned. We have isolated six unique sequences around NotI sites from an irradiation reduced hybrid containing a fragment of human chromosome 22 and are using these for physical mapping around the Ewing's sarcoma translocation breakpoint on chromosome 22.

Sublocalization on chromosome 21 of human interferon-alpha receptor gene and the gene for an interferon-gamma response protein

The cellular responses to alpha and beta interferons (IFN-alpha and -beta) are mediated through the IFN-alpha/beta (type I) receptor, while the response to IFN-gamma is mediated through the IFN-gamma (type II) receptor. The receptors for IFN-alpha/beta and IFN-gamma are encoded by genes on human chromosomes 21 and 6q, respectively. The presence of chromosome 21q confers both ligand binding and responsiveness to human IFN-alpha/beta, whereas chromosome 6q confers binding of Hu-IFN-gamma, but not cellular responsiveness on somatic cell hybrids. Chromosome 6q (i.e., the Hu-IFN-gamma receptor gene) and chromosome 21q are both necessary for the cellular response of somatic cell hybrids (from fibroblasts) to Hu-IFN-gamma. It is conceivable that the factor mediating activity through the IFN-gamma receptor is, in fact, the IFN-alpha receptor, or that the two genes are distinct but part of an "interferon response" region. Here we more precisely localize on human chromosome 21 the genes for the IFN-alpha receptor and for the factor(s) mediating the action of IFN-gamma through the chromosome 6-encoded receptor. Hamster-human somatic cell hybrids containing various fragments of human chromosome 21 were used. The presence of the human IFN-alpha/beta receptor was determined by binding 32P-labeled human IFN-alpha to cells, covalently cross-linking the [32P]IFN-alpha-receptor complex, and analyzing it by SDS-polyacrylamide gel electrophoresis. The presence of the IFN-gamma receptor-related factor mediating cellular responsiveness was determined by HLA induction in hybrid cells containing the IFN-gamma receptor (chromosome 6q), a transfected copy of the human HLA-B7 gene, and various portions of chromosome 21. In all hybrids examined, the two genes cosegregate. Specifically, both genes are localized to the region of chromosome 21 containing the markers D21S58, D21S65, and GART and appear to be proximal to D21S58. The implications for IFN action are discussed.

Generation of a panel of somatic cell hybrids containing unselected fragments of human chromosome 10 by X-ray irradiation and cell fusion: Application to isolating theMEN2A region in hybrid cells

We have used X-ray irradiation and cell fusion to generate somatic cell hybrids containing fragments of human chromosome 10. Our experiments were directed towards isolating the region of the MEN2A gene in hybrids and to use those as the source of DNA for cloning and mapping new markers from near the MEN2A locus. A number of hybrid clones containing human sequences that are tightly linked to the MEN2A gene were identified. Some 25% of our hybrids, however, proved to contain more than one human chromosome 10-derived fragment or showed evidence of deletions and/or rearrangements. A detailed analysis of the human content of X-ray irradiation hybrids is required to assess the integrity and number of human fragments retained. Despite retention of multiple human-derived fragments, these hybrids will prove useful as cloning and mapping resources.

Human-mouse hybrids carrying fragments of single human chromosomes selected by tumor growth

Fusion of human EJ bladder carcinoma cells to mouse C127 cells, with direct selection for tumor growth, gave rise to hybrid cells in which the human chromosome complement had been reduced dramatically, while selectively retaining the activated HRAS1 at chromosome band 11q15. A single-component hybrid retaining only part of human chromosome 11 is described in detail. Our results suggest a novel and general approach for investigating the chromosomal basis of neoplastic change and for subchromosomal mapping of and enrichment cloning for the human genome.

Regional localization of human ecto-5?nucleotidase to chromosome 6q14?q21

Human and mouse hybrids that contain fragments of human chromosome 6 as translocations were analysed for expression of ecto-5' nucleotidase enzymic activity measured by the conversion of AMP to adenosine and for antigenicity recognized by a monoclonal antibody specific for the human isozyme. Both methods allow a regional assignment of ecto-5'nucleotidase to 6q14-q21.

A method for generating hybrids containing nonselected fragments of human chromosomes

We have used an irradiation and fusion technique to generate somatic cell hybrids that contain human chromosomal fragments. As a model system, a human-hamster hybrid containing a single human X chromosome was γ-irradiated and fused with a rodent line. Hybrids were obtained without imposing direct selection for human material. Analysis of 29 clones by in sity hybridization and Southern blotting revealed that human fragments were incorporated into the hybrid cell genomes in most lines. Like chromosome-mediated gene transfer (CMGT)-generated hybrids, these hybrids contained multiple human fragments and retained alphoid centromeric sequences with a high frequency. However, unlike the CMGT, human fragments (apart from alphoid sequences) of less than 10 7 bp showed no evidence for rearrangements. This technique provides a method for constructing hybrids that contain a limited number of small human fragments derived exclusively from any chromosome of choice without the need to impose selection. Such hybrids provide a valuable resource for high-resolution mapping over short distances and for the isolation of disease and other loci mapped genetically.

Segregation of the Huntington disease region of human chromosome 4 in a somatic cell hybrid

We have developed an X-irradiation: cell fusion procedure that segregates segments of human chromosomes lacking selectable markers and have used this approach to construct somatic cell hybrids retaining fragments of human chromosome 4 as the only human material. To identify hybrids retaining a small chromosomal fragment in the region of the Huntington disease (HD) gene, we used Southern blot analysis to screen 72 hybrid lines for the presence or absence of seven chromosome 4 single-copy loci. These data, combined with in situ hybridization experiments, identified three hybrids of interest. One of these cell lines, C25, stably retains a 10,000- to 20,000-kb fragment of distal 4p in the vicinity of the HD gene, translocated to a hamster chromosome. Field-inversion gel electrophoresis revealed no evidence of rearrangements in the human DNA present in C25. In combination with similar radiation hybrids, C25 is a valuable tool for isolating DNA probes near the HD gene.

Selection for Precise Chromosomal Targeting of a Dominant Marker by Homologous Recombination

The antibiotic resistance gene neomycin phosphotransferase (neo) has been precisely targeted to a chromosomal region close to the cystic fibrosis (CF) locus on chromosome 7. The chromosomal target was the expressed SV40 array integrated at chromosome 7, band q31-q35 in a human-mouse hybrid cell line that contains chromosome 7 as the only human component. Stringent selection for neo expression by homologous recombination (3 of 11 correctly targeted) was achieved by fusing the SV40 large T antigen gene, in frame, to neo in a promoterless construct, such that G418 resistance depended on endogenous promoter function and read-through transcription. Chromosome-mediated gene transfer (CMGT) with G418 selection was then used generate mouse hybrids that carried the targeted locus intact, but retained only a fragment of human chromosome 7. This gene targeting strategy will access new regions of the human (or other mammalian) genome, create precise mutations efficiently by gene disruption, and potentially restore normal gene function by mutation correction.

Confirmation and refinement of the localisation of the c-MEL locus on chromosome 19 by physical and genetic mapping

The human gene locus c-MEL was identified following transfection of genomic DNA from the human melanoma cell line NK14; it has previously been assigned to chromosome 19 (p13.2-q13.2) by analysis of somatic cell hybrids. We have further refined the position of this gene to the proximal region of 19p (cen-p13.2), using cell hybrids containing only fragments of human chromosome 19. We have confirmed this physical localisation by linkage analysis with a recently described restriction fragment length polymorphism for the c-MEL gene, and mapped the locus within the region of the low density lipoprotein receptor gene (LDLR) (Lod 4.43, theta = 0.10) and the anonymous marker D19S11 (13.1.25) (Lod 9.33, theta = 0). This gene thus maps to a region of chromosome 19 involved in karyotypic abnormalities in a variety of malignancies including melanomas and leukaemias.

Isolation and characterization of a human telomere

A method is described that allows cloning of human telomeres in S. cerevisiae by joining human telomeric restriction fragments to yeast artificial chromosome halves. The resulting chimeric yeast-human chromosomes propagate as true linear chromosomes, demonstrating that the human telomere structure is capable of functioning in yeast and suggesting that telomere functions are evolutionarily conserved between yeast and human. One cloned human telomere, yHT1, contains 4 kb of human genomic DNA sequence next to the tandemly repeating TTAGGG hexanucleotide. Genomic hybridizations using both cloned DNA and TTAGGG repeats have revealed a common structural organization of human telomeres. This 4 kb of genomic DNA sequence is present in most, but not all, human telomeres, suggesting that the region is not involved in crucial chromosome-specific functions. However, the extent of common features among the human telomeres and possible similarities in organization with yeast telomeres suggest that this region may play a role in general chromosome behavior such as telomere-telomere interactions. Unlike the simple telomeric TTAGGG repeats, our cloned human genomic DNA sequence does not cross-hybridize with rodent DNA. Thus, this clone allows the identifications of the terminal restriction fragments of specific human chromosomes in human-rodent hybrid cells.

Localization of the acetylcholine receptor gamma subunit gene to human chromosome 2q32----qter.

The nicotinic acetylcholine receptor of skeletal muscle (CHRN in man, Acr in mouse) is a transmembrane protein composed of four different subunits (alpha, beta, gamma, and delta) assembled into the pentamer alpha 2 beta gamma delta. These subunits are encoded by separate genes which derive from a common ancestral gene by duplication. We have used a murine full-length 1,900-bp-long cDNA encoding the gamma subunit subcloned into M 13 (clone gamma 18) to prepare single-stranded probes for hybridization to EcoRI-digested DNA from a panel of human x rodent somatic cell hybrids. Using conditions of low stringency to favor cross-species hybridization, and prehybridization with rodent DNA to prevent rodent background, we detected a single major human band of 30-40 kb. The pattern of segregation of this 30-40 kb band correlated with the segregation of human chromosome 2 within the panel and the presence of a chromosomal translocation in the distal part of the long arm of this t(X;2)(p22;q32.1) chromosome allowing the localization of the gamma subunit gene (CHRNG) to 2q32----qter. The human genes encoding the gamma and delta subunits have been shown to be contained in an EcoRI restriction fragment of approximately 20 kb (Shibahara et al., 1985). Consequently, this study also maps the delta subunit gene (CHRND) to human chromosome 2q32.1----qter. In the mouse, the Acrd and Acrg genes have been shown to be linked to Idh-1, Mylf (IDH1 and MYL1 in humans, respectively) and to the gene encoding villin on chromosome 1. Interestingly, we have recently localized the human MYL1 gene to the same chromosomal fragment of human chromosome 2. These results clearly demonstrate a region of chromosomal homoeology between mouse chromosome 1 and human chromosome 2.

Molecular genetic studies on alcohol and aldehyde dehydrogenase: individual variation, gene mapping and analysis of regulation.

Molecular genetic studies on alcohol and aldehyde dehydrogenase: individual variation, gene mapping and analysis of regulation.

Irradiation-reduced human chromosome 21 hybrids.

Rodent-human somatic cell hybrids have been constructed which contain fragments of human chromosome 21 as their only human material. This was done by irradiating rodent-human somatic cell hybrids containing a complete chromosome 21 to fragment the genome and then rescuing human GAR synthetase and various amounts of flanking chromosome 21 DNA by fusing with GAR synthetase-deficient hamster cells and selecting for growth in purine-free medium. Four irradiation-reduction hybrids were produced by this method and contain the distal, proximal, and central portions of the long arm of human chromosome 21, all centered about GAR synthetase. These irradiation-reduction hybrids were used as a panel to regionally map single-copy and individual copies of repetitive sequences. Using these hybrids along with another independently constructed hybrid, the GAR synthetase gene was mapped distal to SOD-1 and proximal to CP21G1(D21S60). Of special interest is the regional mapping of the gene for the amyloid beta-protein distal to pPW236B(D21S11) and proximal to SOD-1.

Investigation of chromosome-mediated gene transfer using the HPRT region of the human X chromosome as a model.

A panel of over 50 hybrid cells containing varying portions of the long arm of the human X chromosome have been obtained by chromosome-mediated gene transfer (CMGT) of human chromosomes to mouse cells deficient in HPRT. This panel is used to investigate the size and integrity of transfected human chromosome fragments and also to examine the effect of including a selectable DNA plasmid in the transfection mix. Chromosomal rearrangements are found to be generated in the chromosome transfer process, and the human X centromeric region is detected in the transfected cells at an unusually high frequency. Extensive lengths of X chromosome DNA are transferred intact, suggesting potential uses of CMGT in cloning large genes and loci for which only the chromosomal map position is known.

Genetic analysis of the human Y chromosome by chromosome-mediated gene transfer.

Chromosome-mediated gene transfer (CMGT) can be used to segregate fragments of human chromosomes in human-rodent hybrid cells. As with all somatic cell genetics methods, a selection technique is needed to isolate the hybrid cell lines produced by CMGT. Expression of the MIC2 gene product on the cell surface (the 12E7 antigen) provides an endogenous selectable marker for the human Y chromosome. Using chromosome transfer followed by separation of 12E7 antigen-positive cells on the fluorescence-activated cell sorter, a series of cell lines containing segregated fragments of the Y chromosome have been derived. The possibility of using these fragments to derive fine structural mapping data for the Y chromosome is considered in this review.

Microdissection and microcloning of the long arm of human chromosome 7.

DNA-fragments from the region of the long arm of human chromosome 7 to which the CF-locus has been mapped recently were isolated by microdissection and microcloning. We developed a new fixation procedure resulting in inserts of 1.0-7.0 kb in length with a mean value of 2.9 kb. Regional mapping of three clones on 7q was carried out by the use of different hybrid cell lines containing fragments of human chromosome 7.

Physical and genetic analysis of cosmids from the vicinity of the cystic fibrosis locus.

Cosmid libraries have been constructed from DNA of somatic cell hybrid cell lines, each containing a fragment of human chromosome seven and including sequences closely linked to cystic fibrosis (CF). Cosmids containing human DNA as insert were isolated from the library. Three cosmids, when used as probes to total genomic DNA, detected polymorphic loci, each of which was shown to be in strong linkage disequilibrium with CF. Restriction endonuclease digestion of cosmid clones and use of a new, rapid method of chromosome walking based on competitive hybridisation of cosmid inserts has allowed identification of several groups of overlapping cosmids ("contigs") from the vicinity of CF.

The cystic fibrosis locus.

The identification of the cystic fibrosis locus (CF) provides a model for the study of single gene defects where the biochemical lesion is not known. Using families each of which has several affected siblings, it was possible to exclude a number of 'candidate genes' which had previously been proposed as possible sites of the CF mutation. Exclusion mapping of the genome using polymorphic protein and DNA markers showed that CF is on the long arm of human chromosome 7. The most closely linked flanking markers were identified, and human chromosome fragments containing them (and therefore the CF locus) were isolated in rodent cell lines by chromosome-mediated gene transfer. The transgenome was then analysed using cosmid contig mapping, pulse-field gel electrophoresis, HTF island identification and linkage disequilibrium. In this way, a candidate coding sequence has been identified which always segregates with CF.