Human-specific amplification of radiation hybrid DNA fractionated by pulsed-field gel electrophoresis

Abstract

Recently, a method named interspersed repetitive sequence polymerase chain reaction (IRS-PCR) was described by which, using primers directed against an IRS, human DNA sequences flanked by the IRS are selectively amplified from complex DNA mixtures such as somatic cell hybrid DNA (1,2). Hybrids containing human chromosomal fragments, such as radiation hybrids (RH) (3, 4), have been used to further reduce the complexity of the human DNA template and increase the specificity of IRS-PCR amplification (5). Here we describe a method which facilitates the isolation of specific DNA sequences from a subchromosomal region. We have developed a method to amplify human-specific DNA sequences from pulsed-field gel (PFGE) fractionated RH DNA; by amplifying a fraction of digested RH DNA containing an identifiable DNA restriction fragment, this method provides a means to selectively amplify and enrich for DNA sequences contained within a specific DNA restriction fragment. Genomic DNA from RH 128, a RH harboring about 10% of a human X chromosome including region Xpl 1.22-Xpl 1.1 (P.N.Goodfellow and J.L.Gorski, unpublished data), was prepared in agarose blocks (6) and digested with SfiI (NEB). DNA blocks were loaded into 1.2% LMP agarose gels (BRL) made with 0.5 xTBE and electrophoresed using a contourclamped homogeneous electric field (CHEF) gel system (CHEFDRII; BioRad) at 200 V with pulse times of 60s (15 hrs) and 90s (9 hrs). Horizontal 5 mm gel slices were cut; DNA was recovered by electroelution, dialyzed against TE, sequentially extracted with phenol, chloroform, and ether, precipitated using ammonium acetate, ethanol, and carrier yeast tRNA (10 gg/ml), and resuspended in 50 Al of dH2O. PCRs were 100 ,tl in volume and contained 400 ng of DNA, 50 mM KCl, 10 mM Tris-HCl, 1.6 mM MgCl2, 0.01% gelatin, 250 uM each dNTP, 1 itg RNase A, and 0.5 ,tM primer; the primer, A-517N (5' AAGTGCGGCCGCGATCTCGGCTCACTGCAA 3'), was directed against a consensus Alu repetitive sequence (1) modified to contain a 5' NotI restriction endonuclease recognition sequence. PCR reactions were incubated at 37°C for 1 hr, 94°C for 9 min, and after the addition of 5 U AmpliTaq DNA polymerase (PerkinElmer/Cetus), 36 cycles of 94°C denaturation (1 min), 55°C annealing (1 min), and 72°C extension (4 min) were performed; amplification products were fractionated on a 1.2% agarose gel and stained with ethidium bromide. No products resulted from the amplification of hamster DNA indicating that the primer was specific for human DNA (Fig. 1). Amplification of hybrid DNA containing only a human X chromosome yielded a large number of products while amplification of RH 128 DNA and RH 128 DNA digested with Sfil yielded an identical subset of products (Fig. 1); Sfil-digested RH 128 DNA isolated from LMP agarose (Fig. 1; RH 128 Sfil gp) yielded a reduced but similar pattern of products. Compared to RH 128 DNA, amplification of a fraction of RH 128 DNA (450-500 kb) recovered from a preparative CHEF gel yielded relatively fewer products consistent with a further reduction of human template DNA complexity; the pattern of products observed upon the amplification of similar